CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Monleón, I.
Right arrow Articles by Anel, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Monleón, I.
Right arrow Articles by Anel, A.
Cell Growth & Differentiation Vol. 13, 315-324, July 2002
© 2002 American Association for Cancer Research

Lack of Fas/CD95 Surface Expression in Highly Proliferative Leukemic Cell Lines Correlates with Loss of CtBP/BARS and Redirection of the Protein toward Giant Lysosomal Structures1

Inmaculada Monleón, María Iturralde, María José Martínez-Lorenzo, Luis Monteagudo, Pilar Lasierra, Luis Larrad, Andrés Piñeiro, Javier Naval, María Angeles Alava and Alberto Anel2

Departamento de Bioquímica y Biología Molecular y Celular, Facultad de Ciencias [I. M., M. I., A. P., J. N., M. A. A., A. A.]; Servicio de Inmunología, Hospital Clínico Universitario [M. J. M-L., L. L., P. L.]; and Departamento de Anatomía, Embriología y Genética, Facultad de Veterinaria [L. M.], Universidad de Zaragoza, Zaragoza E-50009, Spain


    Abstract
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 
Fas/CD95 is a type-I membrane glycoprotein, which inducesapoptotic cell death when ligated by its physiological ligand. We generated previously hyperproliferative sublines derived from the human T-cell leukemia Jurkat, Jurkat-ws and Jurkat-hp, which lost Fas/CD95 surface expression. We have now observed that the total amount of Fas protein is similar in the sublines and in the parental cells, indicating that in the sublines Fas remains in an intracellular compartment. We have found that the protein is directed toward lysosomes in the sublines, where it is degraded. This defect in the secretory pathway correlates with loss of polyunsaturated fatty acids from cellular lipids, and with the lack of expression of endophilin-I and CtBP/BARS, enzymes that regulate vesicle fission by catalyzing the acylation of arachidonate into lysophosphatidic acid. In addition, great multillamer bodies, which contained acid phosphatase activity, absent in the parental Jurkat cells, were observed by transmission electron microscopy in the sublines.


    Introduction
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 
Fas (CD95/Apo-1) is a type-I membrane glycoprotein, which induces apoptotic cell death when ligated by its physiological ligand in sensitive cells (1) . Fas-induced apoptosis takes place through the activation of the caspase cascade (2) . The Fas/Fas ligand system is of great importance in the function and regulation of the immune system. It is one of the effector mechanisms used by T cells in the elimination of viral infections or tumoral development, its main function being the down-modulation of the cellular immune response through an autocrine/paracrine mechanism (3) . Defects in this mechanism are associated with systemic lymphoproliferative and autoimmune diseases (4 , 5) .

Loss of Fas surface expression in tumoral or infected cells would make them more reluctant to control by the immune system. On the other hand, loss of proapoptotic mechanisms or overexpression of apoptosis inhibitors lie in the molecular etiology of cancer (6) . In previous studies, we generated hyperproliferative sublines derived from the human T-cell leukemia Jurkat by culture of the parental cells in serum-free medium (Jurkat-ws) or in exhausted medium (Jurkat-hp), and selection of the resistant cells. These selected cells demonstrated a much higher proliferative rate and saturation density than parental cells. Interestingly, these hyperproliferative sublines lost Fas surface expression and caspase-3 intracellular expression, and were resistant to Fas- and doxorubicin-induced apoptosis (7) . The resistance to doxorubicin should be rather attributed to loss of effector caspase expression than to loss of surface Fas expression (8) . On the other hand, the hyperproliferative phenotype of these sublines correlated rather with tyrosine phosphorylation of the p85 regulatory subunit of phosphatidylinositol 3'-kinase (9) .

In the present work, we have additionally analyzed the defect in Fas expression in these sublines. The Jurkat-derived sublines lack the surface expression not only of Fas but also of other functionally relevant surface proteins such as CD3, CD2, and CD59 (7) . Using immunoblot analysis, we have observed that the total amount of Fas and CD3 proteins is similar in the sublines and in the parental cells, indicating that the defect lies rather in the secretory pathway. Instead, we have found that, in the sublines, Fas is directed toward lysosomes where it is degraded, because inhibition of lysosomal hydrolases increases the level of Fas protein in the sublines but not in the parental cells. This defect in the secretory pathway correlates with loss of polyunsaturated fatty acids from cellular lipids and with the complete lack of expression of endophilin-I and CtBP/BARS, enzymes that regulate vesicle fission by catalyzing the acylation of arachidonate into lysophosphatidic acid (10, 11, 12, 13) .


    Results and Discussion
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 
Cell Surface Fas Expression Is Lost in Hyperproliferative Jurkat Sublines but Accumulates in Their Cytoplasm.
We have observed previously by flow cytometry analysis that the expression of several surface proteins (Fas/CD95, CD3, CD2, and CD59) was lost in Jurkat-ws and Jurkat-hp cells as compared with the parental Jurkat cells(see Ref. 7 and Fig. 1Citation ). However, the defect is not general to all of the surface receptors, because the expression level of the interleukin 2 receptor (CD25) is similar to that of the parental Jurkat cells, as shown in Fig. 1Citation .



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. Surface expression of Fas/CD95, CD3, and CD25 in parental Jurkat cells, and in the hyperproliferative sublines Jurkat-hp and Jurkat-ws. Jurkat (top panels), Jurkat-hp (middle panels), or Jurkat-ws cells (bottom panels) were stained at 4°C with FITC-labeled anti-Fas mAb SM1/23, anti-CD3 mAb OKT3, or anti-CD25 mAb 3G10, and the surface expression of the proteins analyzed by flow cytometry (black histograms). White histograms correspond to the staining of the same cells with an irrelevant mouse IgG coupled to the same fluorophore. Diagrams shown are representative of at least three different experiments performed for each experimental condition.

 
We have next analyzed the expression of Fas and of CD3 by immunoblot in these cells and results are shown in Fig. 2aCitation . The anti-Fas antibody used detects a Mr 46,000 band after cell protein separation by SDS-PAGE in nonreducing conditions, as described previously (14) . Despite the lack of expression of the protein on the surface of the sublines, the amount of the protein was rather the same in parental Jurkat cells and in the sublines (Fig. 2aCitation , top panel). The same result was obtained for CD3-{epsilon} expression using the mAb UCHT1, which detects a band at Mr 20,000 in all three of the cell lines, as shown in the bottom panel of Fig. 2aCitation .



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 2. Expression of Fas/CD95 and CD3 in parental Jurkat cells and in the hyperproliferative sublines Jurkat-ws and Jurkat-hp. a, proteins from Jurkat, Jurkat-ws, or Jurkat-hp cells (2 x 106 per lane) were extracted, separated by SDS-PAGE in nonreducing (top panel) or reducing conditions (bottom panel), transferred, and immunoblotted with the polyclonal anti-Fas antibody C20 (top panel) or with the anti-CD3{epsilon} mAb UCHT1 (bottom panel). The positions of molecular weight markers are indicated on the left. b and c, Fas/CD95 was located by confocal microscopy by using the SM1/23 mouse mAb and FITC-conjugated antimouse antibody. b, Jurkat cells; c, Jurkat-ws cells. Magnification, x2000.

 
Next, we analyzed the cellular distribution of Fas using confocal microscopy. In Jurkat parental cells, Fas was mostly localized in the plasma membrane or in cytoplasmic compartments close to it (Fig. 2b)Citation . However, in Jurkat-ws cells, the labeling pattern was completely different, not localized in the plasma membrane, but rather following a cytoplasmic and punctate distribution, with net accumulation of labeling in discrete intracellular regions (Fig. 2c)Citation . A similar staining was obtained in Jurkat-hp cells (data not shown). The staining pattern in single cells was also analyzed in successive focal planes, separated 1 µm. In the case of Jurkat cells, the staining followed the same pattern in all of the planes, indicating that the labeling was truly localized in the plasma membrane. However, in the sublines, the staining was absent in the first and last focal planes, being concentrated in the central part of the cell, additionally indicating a discrete cytoplasmic localization (data not shown).

Fas Colocalizes with Lamp-1 in the Sublines but not in Parental Jurkat Cells.
The punctate, cytoplasmic Fas staining pattern observed in the sublines was reminiscent of the cellular organization of lysosomes or late endosomes (15) . To test this hypothesis, we localized by confocal microscopy the distribution of Fas and of the lysosomal marker lamp-1 in Jurkat and in the sublines, and analyzed their colocalization. As shown in the top panels of Fig. 3Citation , Fas localized mainly at the plasma membrane of Jurkat cells (green fluorescence), whereas lamp-1 localized in cytoplasmic bright spots (red fluorescence). When superimposed, almost no colocalization (yellow fluorescence) was observed between both markers. However, the staining patterns of Fas and of lamp-1 were very similar in Jurkat-ws and Jurkat-hp cells, and the colocalization of Fas with lamp-1 was complete (lower panels of Fig. 3Citation ). Some zones positive for lamp-1 could also be observed that were negative for Fas staining, suggesting the presence of lysosomes devoid of Fas.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 3. Colocalization of Fas/CD95 with the lysosomal marker lamp-1 in Jurkat parental cells, and in the hyperproliferative sublines Jurkat-ws and Jurkat-hp. Fas was located by confocal microscopy by using the SM1/23 mouse mAb and FITC-conjugated antimouse antibody (green fluorescence, left panels). Lamp-1 was located using a polyclonal rabbit antibody and Cy3-conjugated antirabbit antibody (red fluorescence, middle panels). Fas staining images were superimposed with lamp-1 staining ones, as indicated, to show overlapping signals as yellow fluorescence (right panels). Magnification, x2000.

 
Inhibition of Lysosomal Hydrolases by Monensin Increases the Level of Fas Protein in the Sublines but not in Parental Jurkat Cells.
The presence of Fas in lysosomes would suggest that in the hyperproliferative sublines, once the protein has arrived to the TGN3 , it is channeled toward lysosomes for degradation. To test this hypothesis we treated the parental Jurkat cells or the derived sublines with monensin, which prevents lysosome acidification, thus inhibiting the hydrolase activity of lysosomal lipid and protein degrading enzymes (16) . As shown in the bottom panels of Fig. 4, a and bCitation , monensin treatment resulted in some reduction in the amount of Fas in Jurkat cells, as analyzed by immunoblot, whereas the amount of Fas in Jurkat-ws or Jurkat-hp cells progressively increased with the time of monensin exposure. The same membranes were immunoblotted with antitubulin antibody as a loading control, demonstrating that the variations in the amount of Fas protein were specific for this protein (see top panels of Fig. 4, a and bCitation ). These experiments were repeated at least three times for each experimental condition, obtaining the same qualitative results. As an additional control, we observed that the proteasome inhibitor lactacystin did not affect the level of Fas protein in the parental Jurkat cells nor in the sublines (Fig. 4c)Citation .



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 4. Effect of the inhibition of lysosomal hydrolases by monensin or of the proteasome by lacatacystin on the amount of Fas protein in Jurkat cells and in the sublines. a and b, 2 x 106 Jurkat, Jurkat-ws (a), or Jurkat-hp (b) cells were incubated for the times indicated in the absence (C) or presence of 10 µg/ml of monensin. c, 2 x 106 Jurkat, Jurkat-ws, or Jurkat-hp cells were incubated for the times indicated in the absence (C) or presence of 2 µM of lactacystin. Proteins were extracted with a buffer containing 1% Triton X-100, separated by SDS-PAGE, transferred, and immunoblotted with the polyclonal anti-Fas antibody C20. Equivalent protein loading in each lane was controlled by reblotting of the same membrane with antitubulin antibody (top panels in a and b). The positions of molecular weight markers are indicated on the left. The experiments shown are representative of at least three different experiments for each experimental condition.

 
This result suggests that, as a result of a defect in the secretory pathway, Fas is channeled in the sublines from the TGN to lysosomal structures where it is degraded. However, because the steady-state amount of Fas protein in the sublines is similar to that of the parental cells, lysosomal degradation should be compensated by a high biosynthetic rate in the sublines. This would not be surprising, given their high proliferation rate and saturation density. This also indicates that the mechanism by which Fas is not expressed at the cell surface in these sublines is in fact a futile cycle between active biosynthesis and active degradation.

Fas Lysosomal Localization in the Sublines Is Not Because of Increased Endocytosis.
Protein sorting from the TGN toward the plasma membrane or other cellular localizations is governed by interaction of protein cytoplasmic tails with specific adaptors (17) . The aberrant lysosomal localization of Fas in the sublines could be because of a mutation in the Fas cytoplasmic domain that normally leads the protein toward the plasma membrane, following the constitutive secretory pathway, conferring the possibility of interaction with adaptors that leads the protein toward lysosomes instead. However, this possibility is not very plausible, because other cell surface proteins, such as CD3, are also expressed at the same level in the sublines, being absent from the plasma membrane. Hence, the cause for the aberrant lysosomal localization of cell surface proteins in the sublines should be attributed to a more general defect.

One possibility could be that the endocytosis rate of cell surface proteins in the sublines would be much higher than in the parental cells. In this case, the protein would arrive to the plasma membrane and would immediately be endocytosed, with the steady-state level of cell surface expression being negligible. Endocytic compartments finally fuse with lysosomes in agreement with the lysosomal localization of Fas in the sublines shown in Fig. 3Citation . In fact, such a mechanism is used by adenovirus to down-modulate death receptor expression in infected cells. The adenovirus protein RID interacts with Fas and also with DR4, a death receptor for APO2 ligand/tumor necrosis factor-related apoptosis-inducing ligand, inducing its internalization and lysosomal degradation, making the infected cells less susceptible to immune control (18 , 19) . To test this hypothesis, we used the actin-disrupting agent latrunculin A, which has been shown to inhibit receptor-mediated endocytosis (20) . The inhibition of receptor internalization by latrunculin A results in the increase of cell surface expression of the transferrin receptor, for example (20) . Hence, if our hypothesis was correct, we would see some Fas cell surface expression in the sublines treated with latrunculin A. However, as shown in the top panels of Fig. 5Citation , latrunculin A treatment did not restore Fas surface expression in Jurkat-ws nor in Jurkat-hp cells.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5. Effect of endocytosis inhibition by latrunculin A and of arachidonic acid supplementation on Fas/CD95 surface expression in Jurkat cells and in the sublines. Jurkat (left panels), Jurkat-ws (middle panels), or Jurkat-hp cells (right panels) were left untreated, were incubated for 1 h with 40 µg/ml of latrunculin A (+Latr, top panels), or were supplemented with 10 µM arachidonic acid bound to serum proteins for 48 h (+20:4, bottom panels). After the incubations, cells were stained at 4°C with FITC-labeled anti-Fas mAb SM1/23 and Fas/CD95 surface expression analyzed by flow cytometry. Diagrams shown are representative of at least three different experiments performed for each experimental condition.

 
Loss of Arachidonic Acid in Cellular Lipids of the Sublines. Arachidonic Acid Supplementation Does Not Restore Fas Surface Expression.
Lipids are essential regulators of membrane traffic, both at the level of the secretory pathway and of the endocytic pathway, although a clear understanding of their specific role is far from sight. Phosphoinositides are the best studied lipids, and their role in the recruitment of protein adaptors, and effectors in the secretory and endocytic pathways is clear (21 , 22) . Recently, the role of ordered lipid rafts in these processes, apart from their role in signal transduction, is beginning to be considered (23) . However, the role of other important lipid parameters, such as their specific fatty acid composition, has to be studied still in more detail. Related to that, an interesting observation has been made by two different groups (12 , 13) . Schmidt et al. (12) found that the protein endophilin-I, which binds to dynamin, was essential for the formation of synaptic-like microvesicles from the plasma membrane. This was associated with the lysophosphatidic acid arachidonyl transferase activity of endophilin-I. Weigert et al. (13) demonstrated that a protein termed CtBP/BARS, characterized as an essential protein to maintain Golgi structure (24) , induced Golgi vesiculation through the same lysophosphatidic acid arachidonyl transferase activity. Lysophosphatidic acid is a lipid with an inverted cone shape, whereas phosphatidic acid, the product of arachidonyl esterification, has a cone shape (10 , 11) . Hence, the enzymatic activity of endophilin-I or CtBP/BARS, acting on the neck of a membrane budding, results in a change in the intrinsic curvature of the cytosolic monolayer because of a change in lipid composition, leading finally to vesicle fission (23) .

Taking into account that one of the most prominent effects of culture in serum-free medium would be a change in the fatty acid composition of cellular lipids, we analyzed the fatty acid composition of Jurkat-ws cells compared with the parental Jurkat cells. The prolonged culture in serum- and essential fatty acid-free medium resulted in the complete loss of arachidonic and other polyunsaturated fatty acids, and a concomitant increase in the content of monounsaturated fatty acids (Table 1)Citation . Hence, the most obvious effect of the described changes in fatty acid composition was a marked decrease in the ratio of polyunsaturated:monounsaturated fatty acids, from 0.37 in Jurkat to 0 in Jurkat-ws cells (see Table 1Citation ). The observed increase in the proportion of monounsaturated fatty acids (4-fold for 16:1n-7, 42% for 18:1n-9, 2-fold increase for 18:1n-7) and especially in n-7 fatty acids is a predictable result of essential fatty acid deficiency (25) . Strikingly, the fatty acid composition of Jurkat-hp cells, which are cultured in medium with serum, was very similar to that of Jurkat-ws cells. A marked reduction in the proportion of polyunsaturated and an enrichment in monounsaturated fatty acids was also observed with respect to parental cells, with a reduction of the polyunsaturated:monounsaturated fatty acid ratio of 9-fold. Arachidonic acid content was also markedly reduced in Jurkat-hp cells compared with parental cells, from 7.1% to 1%. This marked difference in fatty acid composition could be related to the observed defect in the secretory pathway, because the generation of constitutive secretory vesicles from the TGN could be impaired if CtBP/BARS activity is decreased because of substrate depletion. To test this hypothesis, we supplemented the culture medium of the cells with arachidonic acid (20:4 n-6) bound to BSA during 48 h and analyzed the level of Fas expression by flow cytometry. We also confirmed by lipid analysis that supplemented arachidonic acid was incorporated at a similar rate in the three cell lines (data not shown). However, the enrichment in this polyunsaturated fatty acid did not restore Fas expression in the sublines, as shown in the bottom panels of Fig. 5Citation .


View this table:
[in this window]
[in a new window]
 
Table 1 Fatty acid composition of Jurkat and derived hyperproliferative sublines

Data are expressed as percentage (by weight) of the total cellular fatty acids and are the mean ± SD of results obtained in three different experiments with samples analyzed in duplicate.

 
Loss of Endophilin I and CtBP/BARS Expression in the Sublines.
The fact that Fas surface expression was not restored by arachidonic acid supplementation could also be because of the absence of endophilin I and/or CtBP/BARS expression in the sublines. Hence, we analyzed the expression of mRNA for these proteins in the sublines and in Jurkat parental cells by RT-PCR using specific primers based on the sequences described (12 , 13) . As shown in Fig. 6Citation , whereas parental Jurkat cells expressed detectable amounts of both endophilin-I and CtBP/BARS mRNA, neither Jurkat-ws nor Jurkat-hp cells expressed mRNA for these two proteins.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 6. Expression of mRNA for endophilin-I and CtBP/BARS in Jurkat cells or in the sublines. Total RNA (1 µg) was obtained from Jurkat, Jurkat-ws, or Jurkat-hp cells, reversed transcribed, and the resulting cDNA subjected to PCR. Endophilin-I and CtBP/BARS fragments of 716 bp or 239 bp, respectively, were amplified and separated in agarose gels, as indicated. The same protocol was used to amplify a ß-actin fragment from the same samples, used as a loading control in the bottom panel. The experiment shown is representative of five different experiments.

 
The absence of these essential regulators of vesicle generation from the TGN would be sufficient to account for the observed defect in the secretory pathway in these sublines compared with the parental cells. Indeed, the defect is general enough to justify that a similar situation is observed for other membrane proteins, such as the TCR/CD3 complex, and to account for the lack of surface expression of many other functionally relevant receptors, such as CD2, CD59 (7) , CD4, CD43, and CD37 (data not shown). However, not all of the membrane proteins can be absent from the surface of those cells, because they have an active metabolism and need to incorporate nutrients at a high rate. For example, the interleukin 2 receptor (CD25) is expressed at the same level in the sublines and in the parental cells, as shown in Fig. 1Citation . This result suggests that different pathways of constitutive secretion of membrane proteins should exist.

Great Multillamer Bodies with Lysosomal Features Are Present in the Sublines but not in Jurkat Parental Cells.
Although the secretory pathway is greatly impaired in the sublines, the formation of lysosomes seems to proceed normally (see Fig. 3Citation ). Both the constitutive secretion vesicles and the lysosomes form from buddings that emerge from the TGN. We have performed TEM studies on the parental cells and, comparatively, in the sublines to detect possible differences in lysosome formation. As shown in Fig. 7ACitation , most of the volume of Jurkat cells is occupied by the nucleus (n), because the cytoplasm:nucleus ratio is small. Some typical structures can be observed in the cytoplasm of Jurkat cells, such as mitochondria (m), with sizes between 2 and 0.9 µm, depending on the cut angle, and round multivesicular bodies (Fig. 7ACitation , marked with arrows), with a size not exceeding 0.6 µm. In addition, smaller, electron-dense round structures with sizes corresponding with that described for mature lysosomes (between 100 and 240 nm) could be observed (Fig. 7ACitation , marked with arrowheads). A higher magnification of these compartments shows their nonmultivesicular ultrastructure (Fig. 7B)Citation . Jurkat-hp and Jurkat-ws cells had a similar cytoplasm:nucleus ratio as Jurkat cells (Fig. 7, C and ECitation , respectively). The most striking feature of these cells was the presence of big multilamellar cytoplasmic structures, marked with arrowheads in Figs. 7, C and ECitation , and with sizes between 1 and 2 µm, occasionally containing an electron-dense inclusion. Higher magnification of these compartments show their big size and ultrastructure characterized by the accumulation of membranous material in its interior (Figs. 7, D and FCitation for Jurkat-hp and Jurkat-ws cells, respectively).



View larger version (112K):
[in this window]
[in a new window]
 
Fig. 7. TEM of Jurkat and of the hyperproliferative sublines. Jurkat (A and B), Jurkat-hp (C and D), and Jurkat-ws cells (E and F) were embedded in a low-viscosity epoxy resin, using the Spurr protocol and ultrathin sections observed in a transmission electronic microscope.

 
We then performed acid phosphatase cytochemistry to show the localization of this specific lysosomal enzyme. As shown in Fig. 8Citation , the enzyme was only localized in the small structures observed previously in Jurkat cells (Fig. 8A)Citation , and in the giant MLBs observed in Jurkat-hp (Fig. 8B)Citation and Jurkat-ws cells (Fig. 8C)Citation . The enzyme was localized in discrete regions of the MLBs, associated with internal membranes.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 8. Acid phosphatase cytochemistry of Jurkat and of the hyperproliferative sublines. Jurkat (A), Jurkat-hp (B), and Jurkat-ws cells (C) were subjected to the acid phosphatase cytochemistry protocol described in "Materials and Methods," and afterward samples were treated in the same way as indicated in the legend of Fig. 7Citation .

 
Secretory vesicles form from TGN buddings, which do not have a clathrin coat, whereas lysosomal vesicles do (26) . During clathrin-mediated endocytosis, the large molecular weight GTPase dynamin assembles as a ring around the neck of the invaginated coated pit and seems to be implicated in the final fission step directly or indirectly by recruitment of other proteins (27) . Endophilin-I is one of the dynamin binding partners (12 , 27 , 28) , and given its described function in fission through modification of lipid composition at the budding neck (12) , it is conceivable that both dynamin and endophilin-I are implicated in fission (27) . On the other hand, CtBP/BARS has been shown to mediate vesicle fission from the Golgi by the same enzymatic activity described for endophilin-I (13) . However, in that study, clathrin and/or dynamin are not implicated in the fission process, which seems more related with constitutive secretory vesicle generation (13) . Hence, the lysophosphatidic acid arachidonyl transferase activity seems to be implicated in vesicle fission processes both dependent and independent of clathrin and dynamin. In our system, loss of endophilin-I and CtBP/BARS expression correlates with the impairment of constitutive secretion, indicating that this clathrin- and dynamin-independent process could be dependent on the expression of those enzymes. On the other hand, our TEM data indicate that the generation of lysosomes is also affected in the sublines. In these cells in which normal vesicle fission from the TGN is probably impaired, and with a high proliferative and biosynthetic rate, the driving force for lysosomal budding and fission could be the condensation of great amounts of cargo. The big size ({approx}1 µm) of the MLBs observed by TEM only in the sublines as compared with the smaller lysosomal size in hematopoietic cells (100–200 nm) would be in agreement with this hypothesis. On the other hand, the origin of similar MLBs has been assigned in other cell types to autophagy (29) , and this would be another plausible explanation for the formation of big MLBs in the sublines. In these cells, as a consequence of the defect in the secretory pathway, the final TGN structures could collapse in an autophagic-like process because of concentration of undelivered cargo and membranes.

This study defines a striking new mechanism of down-regulation of cell surface receptors in sublines derived from the Jurkat T-cell leukemia. Additional work is needed to characterize whether reconstitution of endophilin-I and/or CtBP/BARS expression would result in receptor surface expression or if other steps in the secretory pathway could be also affected. Whether this mechanism is shared by other tumoral cells awaits characterization. The down-modulation of death receptors from tumoral cells would increase their independence from regulatory homeostatic mechanisms and/or immune control. However, this cannot be directly associated with the hyperproliferative potential of the sublines studied, which should rather be attributed to the loss of executor caspase expression and with the tyrosine phosphorylation of the p85 subunit of phosphatidylinositol-3' kinase, as described previously (7 , 9) .


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 
Materials.
Monensin, butylated hydroxytoluene, arachidonic, and N-heptadecanoic acids, as well as the antitubulin mAb B512 and the secondary antirabbit antibody coupled to alkaline phosphatase used for immunoblot were from Sigma (Madrid, Spain). Lactacystin was from Calbiochem (Bad Soden, Germany). Latrunculin A was from Molecular Probes Europe (Leiden, the Netherlands). The rabbit polyclonal anti-Fas antibody C-20 from Santa Cruz Biotechnology (Santa Cruz, CA) was used for immunoblot studies, whereas for confocal microscopy and flow cytometry determinations of Fas surface expression, we used the mouse mAb SM1/23 (Bender Medsystems, Vienna, Austria), unconjugated or FITC-labeled, respectively. The anti-CD3-{delta} mAb OKT3 and the anti-CD25 mAb 3G10, both conjugated with FITC and used for flow cytometry determinations, were respectively from Coulter and Caltag, Barcelona, Spain. The anti-CD3-{epsilon} mAb UCHT1, purified from the supernatant of the corresponding hybridoma, a kind gift of Dr. Marisa Toribio, Centro de Biología Molecular, Madrid, Spain, was used for immunoblot. The rabbit anti-lamp1 antibody used for confocal microscopy was kindly provided by Dr. Jean Pierre Gorvel, Centre d’Immunologie de Marseille-Luminy, Luminy, France. Secondary antimouse antibody labeled with FITC and antirabbit antibody labeled with Cy3 were from Caltag. DNA primers for RT-PCR analysis of endophilin-I and CtBP/BARS expression were obtained from Genotek (Barcelona, Spain).

Cells and Cell Culture.
The human T-cell leukemia Jurkat, clone E6.1 (American Type Culture Collection, Rockville, MD) was cultured in RPMI 1640 supplemented with 10% FCS, 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (hereafter, complete medium).

The Jurkat-hp subline was generated by prolonging cultures in exhausted culture medium, allowing it to reach unusually high cell densities. Viable cells were separated from dead cells by Ficoll-Hypaque density centrifugation, and the procedure was repeated for several passages. Jurkat-hp cells exhibit a shorter doubling time and a 6-fold greater saturation density than parental Jurkat cells, and are cultured in the same complete culture medium (7) . The Jurkat-ws subline was generated by prolonged culture (>8 months) in a serum-free medium, as described previously (7) . Jurkat-ws cells showed a shorter doubling time and a 3-fold greater saturation density than parental Jurkat cells. Cells were free of Mycoplasma, as routinely tested by RT-PCR.

Immunoblotting.
Detection of Fas in cell lysates (2 x 106 cells per lane) was performed by immunoblot using the rabbit polyclonal anti-Fas antibody C-20 and a secondary antirabbit antibody coupled to alkaline phosphatase. Immunoreactivity was detected by incubation with bromo-4-chloro-3-indolylphosphate and nitroblue tetrazolium. In some experiments, cells were incubated previously during 3 or 7 h with 10 µg/ml of the lysosomotropic agent monensin (16) , or with 2 µM of the specific proteasome inhibitor lactacystin (30) . At the end of the incubations, cells were washed, cellular proteins extracted with a lysis buffer containing 1% Triton X-100, proteins separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted as indicated. Protein loading was controlled by reblotting of the same membrane with antitubulin antibody.

Confocal Microscopy.
Cells were collected from the cultures, washed with PBS, and fixed in a solution of 4% paraformaldehyde in PBS. Cell suspensions were then placed onto round coverglasses treated previously with L-polylysine, which were sequentially incubated with 1/200 dilutions of the primary anti-Fas or anti-lamp-1 antibodies in PBS with a 5% goat serum and 0.1% saponin, and 1/200 dilutions of the secondary antibodies in PBS with 0.1% saponin. After several washings, coverglasses were mounted onto glass slides using Mowiol (Calbiochem, Madrid, Spain). Preparations were observed in a Zeiss 310 confocal microscope, analyzed using the LSM 3.95 software, and finally processed using the Adobe PhotoShop 5.0 software. Single cells were observed in 10 successive focal planes, separated 1 µm, and adjusted from the bottom to the top of the cell. The pictures showing single cells correspond to the central part of the cell, normally the fifth/sixth focal plane. No labeling was observed when using the secondary antibodies alone.

Analysis of Protein Surface Expression by Flow Cytometry.
Cells (5 x 105) were collected from the cultures, resuspended in 50 µl of ice-cold PBS containing 0.2% BSA, and treated with 5 µg/ml of the FITC-labeled anti-Fas mAb SM1/23 for 1 h at 4°C. Cells were washed twice in cold buffer and fixed with 1% paraformaldehyde in PBS (pH 7.4). The samples were analyzed on an EPICS XL-MCL cytometer (Coulter). In some experiments, cells were incubated previously for 1 h with 40 µg/ml of the actin-disrupting agent latrunculyn A (20) or were supplemented with arachidonic acid for 48 h, as indicated below.

Arachidonic Acid Supplementation and Lipid Analysis.
In some experiments, cells were cultured for 48 h in the presence of arachidonic acid (10 µM) before the analysis of Fas surface expression. Arachidonic acid was added bound to carrier proteins of the fetal serum used as culture supplement (31) and did not inhibit cell proliferation at the concentrations used. For lipid analysis, control or supplemented cells were collected, washed twice by resuspension in ice-cold PBS, and cell lipids extracted by vigorous shaking in chloroform/methanol (2/1, v/v) as described previously (31) . Aliquots of the antioxidant butylated hydroxytoluene (1 µg/106 cells) and of the internal standard N-heptadecanoic acid (2 µg/106 cells) were then added. Fatty acid methyl esters from total cell lipids were prepared by treatment with 5% H2SO4 in anhydrous methanol under nitrogen atmosphere at 80°C for 1.5 h. Fatty acid methyl esters were analyzed by gas-liquid chromatography in a Shimadzu GC-14A chromatograph, equipped with a SP-2330 capillary column (30 m x 0.25 mm; Supelco, Barcelona, Spain), a flame ionization detector, and a computerized integrator. Fatty acids were identified by comparison with the appropriate commercial standards and quantified by comparison with the N-heptadecanoic integration area.

RT-PCR Analysis of Endophilin-I and CtBP/BARS Expression.
Total RNA was obtained from Jurkat and sublines cells using a Quickprep total RNA purification kit (Sigma) according to the manufacturer’s instructions. Total RNA (1 µg) was reversed-transcribed with Superscript II Rnase H-reverse transcriptase using random hexameric primers (First strand cDNA synthesis kit; Life Technologies, Inc.). The resulting cDNA was subjected to PCR. Primers used to amplify ß-actin have been described previously (32) . Primers used to amplify human endophilin I and CtBP/BARS cDNA were the following: (a) endophilin I (716 bp cDNA fragment; 5') TCATCCAGCCCCACCAAGTG and (3') ATATTTGTTCCCCTT CCCTGTG; and (b) CtBP/BARS (239 bp cDNA fragment; 5') GGGAGAGAGCATGTGTGTGGT and (3') GACAGCTAAGCAAACAGATCCT. RT-PCR reactions were performed using a thermal program of 95°C for 5 min; 30 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 1 min; and then 72°C for 10 min. A total of 10% of the final PCR products were loaded onto a 2% agarose gel.

Transmission Electron Microscopy.
Cell pellets (50 x 106 cells) were washed, fixed with 2% paraformaldehyde plus 2.5% glutaraldehyde in PBS, osmified, dehydrated, and embedded in a low-viscosity epoxy resin using the Spurr protocol (33) . Ultrathin sections (60 nm) were cut using a Leica Ultracut unit and collected onto Formvar-coated gold grids. Grids were contrasted with 2% uranyl acetate for 20 min and Reynolds solution for 3 min, and observed in a Jeol JEM 1010 transmission electronic microscope at 80 kV. Acid phosphatase cytochemistry was performed using the method of Hand and Oliver (34) . Cells were fixed for 10 min in suspension with 1% paraformaldehyde/1% glutaraldehyde/0.05% CaCl2/0.1 M sodium cacodylate (pH 7.4), pelleted, embedded in agar, and stored overnight in cacodylate buffer containing 7% sucrose. Blocks were washed with 5% sucrose/20 mM sodium acetate (pH 5.0) and incubated for 1 h at 37°C in 0.1% cytidine 5'-monophosphate/3.6 mM lead nitrate/5% sucrose/20 mM sodium acetate (pH 5.0). They were treated briefly with 1% ammonium sulfate, and postfixed and processed as indicated above.


    Acknowledgments
 
We thank Dr. Marta Taulés, Servicios Científico-Técnicos, Universidad de Barcelona, for TEM, Dr. Jean Pierre Gorvel, Centre d’Immunologie de Marseille-Luminy, Francia, for anti-lamp-1 antibodies, and Dr. Marisa Toribio, Centro de Biología Molecular, Universidad Autonóma de Madrid, for UCHT1 mAb.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grant P24/2000 from Diputación General de Aragón/Fondo Social Europeo, Grant SAF2001-1774 from Dirección General de Investigación (Spain), and Grant 99/1250 from Fondo de Investigaciones Sanitarias (Spain). I. M. was supported by a Fellowship from Diputación General de Aragón. Back

2 To whom requests for reprints should be addressed, at Departamento de Bioquímica y Biología Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Campus Pza. San Francisco, Zaragoza E-50009, Spain. Phone: 34-976-761279; Fax: 34-976-762123; E-mail: anel{at}posta.unizar.es Back

3 The abbreviations used are: TGN, trans-Golgi network; MLB, multillamelar body; RT-PCR, reverse transcription-PCR; TEM, transmission electronic microscopy; mAb, monoclonal antibody. Back

Received for publication 3/19/02. Revision received 5/30/02. Accepted for publication 6/30/02.


    References
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 

  1. Nagata S., Golstein P. The Fas death factor. Science (Wash. DC), 267: 1449-1456, 1995.[Abstract/Free Full Text]
  2. Rathmell J. C., Thompson C. B. The central effectors of cell death in the immune system. Annu. Rev. Immunol., 17: 781-828, 1999.[Medline]
  3. Lenardo M., Chan F. K. M., Hornung F., MacFarland H., Siegel R., Wang J., Zheng L. Mature T lymphocyte apoptosis: immune regulation in a dynamic and unpredictable antigenic environment. Annu. Rev. Immunol., 17: 221-253, 1999.[Medline]
  4. Rieux-Laucat F., Le Deist F., Hivroz C., Roberts I. A. G., Debatin K. M., Fischer A., de Villartay J. P. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science (Wash. DC), 268: 1347-1350, 1995.[Abstract/Free Full Text]
  5. Watanabe-Fukunaga R., Brannan C. I., Copeland N. G., Jenkins N. A., Nagata S. Lymphoproliferation disorder explained by defects in Fas antigen that mediates apoptosis. Nature (Lond.), 356: 314-317, 1992.[Medline]
  6. Thompson C. B. Apoptosis in the pathogenesis and treatment of disease. Science (Wash. DC), 267: 1456-1462, 1995.[Abstract/Free Full Text]
  7. Martínez-Lorenzo M. J., Gamen S., Etxeberria J., Lasierra P., Larrad L., Piñeiro A., Anel A., Naval J., Alava M. A. Resistance to apoptosis correlates with a highly proliferative phenotype and loss of Fas and CPP32 (caspase-3) expression in human leukemias. Int. J. Cancer, 75: 473-481, 1998.[Medline]
  8. Gamen S., Anel A., Lasierra P., Alava M. A., Martinez-Lorenzo M. J., Piñeiro A., Naval J. Doxorubicin-induced apoptosis in human T-cell leukemia is mediated by caspase-3 activation in a Fas-independent way. FEBS Lett., 417: 360-364, 1997.[Medline]
  9. Martínez-Lorenzo M. J., Anel A., Monleón I., Sierra J. J., Piñeiro A., Naval J., Alava M. A. Tyrosine phosphorylation of the p85 subunit of phosphatidylinositol 3-kinase correlates with high proliferation rates in sublines derived from the Jurkat leukemia. Int. J. Biochem. Cell Biol., 32: 435-445, 2000.[Medline]
  10. Barr F. A., Shorter J. Membrane traffic: do cones mark sites of fission?. Curr. Biol., 10: R141-R144, 2000.[Medline]
  11. Scales S. J., Scheller R. H. Lipid membranes shape up. Nature (Lond.), 401: 123-124, 1999.[Medline]
  12. Schmidt A., Wolde M., Thiele C., Fest W., Kratzin H., Podtelejnikov A. V., Witke W., Huttner W. B., Söling H. D. Endophilin I mediates synaptic vesicle formation by transfer of arachidonate to lysophosphatidic acid. Nature (Lond.), 401: 133-140, 1999.[Medline]
  13. Weigert R., Silletta M. G., Spano S., Turacchio G., Cericola C., Colanzi A., Senatore S., Mancini R., Polishchuk E. V., Salmona M., Facchiano F., Burger K. N. J., Mironov A., Luini A., Corda D. CtBP/BARS induces fission of Golgi membranes by acylating lysophosphatidic acid. Nature (Lond.), 402: 429-433, 1999.[Medline]
  14. Ruiz-Ruiz C., Robledo G., Font J., Izquierdo M., López-Rivas A. Protein kinase C inhibits CD95 (Fas/APO-1)-mediated apoptosis by at least two different mechanisms in Jurkat T cells. J. Immunol., 163: 4737-4746, 1999.[Abstract/Free Full Text]
  15. Méresse S., Gorvel J. P., Chavrier P. The rab7 GTPase resides on a vesicular compartment connected to lysosomes. J. Cell Sci., 108: 3349-3358, 1995.[Abstract]
  16. Gamen S., Anel A., Piñeiro A., Naval J. Caspases are the main executoniers of Fas-mediated apoptosis, irrespective of the ceramide-signaling pathway. Cell Death Differ., 5: 241-249, 1998.[Medline]
  17. Rohn W. M., Rouillé Y., Waguri S., Hoflack B. Bi-directional trafficking between the TGN and the endosomal/lysosomal system. J. Cell Sci., 113: 2093-2101, 2000.[Abstract]
  18. Tollefson A. E., Hermiston T. W., Liechtenstein D. L., Colle C. F., Tripp R. A., Dimitrov T., Toth K., Wells C. E., Doherty P. C., Wold W. S. M. Forced degradation of Fas inhibits apoptosis in adenovirus-infected cells. Nature (Lond.), 392: 726-730, 1998.[Medline]
  19. Tollefson A. E., Toth K., Doronin K., Kuppuswamy M., Doronina O. A., Lichtenstein D. L., Hermiston T. W., Smith C. A., Wold W. S. M. Inhibition of TRAIL-induced apoptosis and forced internalization of TRAIL receptor 1 by adenovirus proteins. J. Virol., 75: 8875-8887, 2001.[Abstract/Free Full Text]
  20. Lamaze C., Fujimoto L. M., Yin H. L., Schmid S. L. The actin cytoskeleton is required for receptor-mediated endocytosis in mammalian cells. J. Biol. Chem., 272: 20332-20335, 1997.[Abstract/Free Full Text]
  21. Martin T. F. J. PI(4, 5)P2 regulation of surface membrane traffic. Curr. Opin. Cell Biol., 13: 493-499, 2001.[Medline]
  22. Roth M. G. Lipid regulators of membrane traffic through the Golgi complex. Trends Cell Biol., 9: 174-179, 1999.[Medline]
  23. Huttner W. B., Zimmerberg J. Implications of lipid microdomains for membrane curvature, budding and fission. Curr. Opin. Cell Biol., 13: 478-484, 2001.[Medline]
  24. Spanò S., Silletta M. G., Colanzi A., Alberti S., Fiucci G., Valente C., Fusella A., Salmona M., Mironov A., Luini A., Corda D. Molecular cloning and functional characterization of brefeldin A-ADP-ribosylated substrate. A novel protein involved in the maintenance of the Golgi structure. J. Biol. Chem., 274: 17705-17710, 1999.[Abstract/Free Full Text]
  25. Cook H. W. Fatty acid desaturation and chain elongation in eucaryotes Vance D. E. Vance J. E. eds. . Biochemistry of Lipids, Lipoproteins and Membranes, 141-154, Elsevier Amsterdam 1991.
  26. von Figura K. Molecular recognition and targeting of lysosomal proteins. Curr. Opin. Cell Biol., 3: 642-646, 1991.[Medline]
  27. Hill E., van der Kaay J., Downes C. P., Smythe E. The role of dynamin and its binding partners in coated pit invagination and scission. J. Cell Biol., 152: 309-323, 2001.[Abstract/Free Full Text]
  28. Ringstad N., Nemoto Y., De Camilli P. The SH3p4/SH3p8/SH3p13 protein family: binding partners for synaptojanin and dynamin via a Grb2-like SH3 domain. Proc. Natl. Acad. Sci. USA, 94: 8569-8574, 1997.[Abstract/Free Full Text]
  29. Hariri M., Millane G., Guimond M. P., Guay G., Dennis J. W., Nabi I. R. Biogenesis of multilamellar bodies via autophagy. Mol. Biol. Cell., 11: 255-268, 2000.[Abstract/Free Full Text]
  30. Fentenay G., Schreiber S. L. Lactacystin, proteasome function and cell fate. J. Biol. Chem., 273: 8545-8548, 1998.[Free Full Text]
  31. Anel A., Naval J., Desportes P., Gonzalez B., Uriel J., Piñeiro A. Increased cytotoxicity of polyunsaturated fatty acids on human tumoral B and T-cell lines compared with normal lymphocytes. Leukemia (Baltimore), 6: 680-688, 1992.[Medline]
  32. Raff T., van der Giet M., Endemann D., Wiederholt T., Paul M. Design and testing of ß-actin primers for RT-PCR that do not co-amplify processed pseudogenes. Biotechniques, 23: 456-460, 1997.[Medline]
  33. Spurr A. R. A low-viscosity epoxy resin embedding medium for electron microscopy. J. Ultrastruct. Res., 37: 146-156, 1969.
  34. Hand A. R., Oliver C. Effects of secretory stimulation on the Golgi apparatus and GERL of rat parotid acinar cells. J. Histochem. Cytochem., 32: 403-412, 1984.[Abstract]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Monleón, I.
Right arrow Articles by Anel, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Monleón, I.
Right arrow Articles by Anel, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation