CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saavedra, H. I.
Right arrow Articles by Leone, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saavedra, H. I.
Right arrow Articles by Leone, G.
Cell Growth & Differentiation Vol. 13, 215-225, May 2002
© 2002 American Association for Cancer Research

Specificity of E2F1, E2F2, and E2F3 in Mediating Phenotypes Induced by Loss of Rb1

Harold I. Saavedra, Lizhao Wu, Alain de Bruin, Cynthia Timmers, Thomas J. Rosol, Michael Weinstein, Michael L. Robinson and Gustavo Leone2

Human Cancer Genetics Program, Department of Molecular Virology, Immunology and Medical Genetics and Departments of Molecular Genetics [H. I. S., L. W., A. d. B., C. T., M. W., G. L.], Veterinary Biosciences [A. d. B., T. J. R.], and Pediatrics [M. L. R.], and Division of Molecular and Human Genetics, Children’s Research Institute [M. L. R.], The Ohio State University, Columbus, Ohio 43210


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The Rb/E2F pathway plays a critical role in the control of cellular proliferation. Here, we report that E2F1, E2F2, and E2F3 make major individual contributions toward the in vivo phenotypic consequences of Rb deficiency. In the developing lens of Rb-/- embryos, loss of E2F1, E2F2, or E2F3 reduces the unscheduled proliferation of fiber cells, with the loss of E2F3 having the most pronounced effect. In Rb-deficient retinas, all three E2Fs contribute equally to the ectopic proliferation of postmitotic neuronal cells. In contrast, E2F1 is unique in mediating apoptosis in both Rb-/- lenses and retinas. In the central nervous system, loss of E2F1 or E2F3 can almost completely eliminate the ectopic DNA replication and apoptosis observed in Rb-/- embryos, and loss of E2F2 partially reduces the unscheduled DNA replication and has no effect on apoptosis. These results provide clear evidence for functional specificity among E2Fs in the control of Rb-dependent proliferation and apoptosis in a tissue-specific manner.


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
A large body of work suggests that the Rb tumor suppressor controls G1-S transitions of the cell cycle, at least in part, by regulating the activities of the E2F family of transcription factors. On mitogenic induction, cells enter G1, and Rb is inactivated by CDK3 -mediated phosphorylation. This leads to the release and accumulation of E2F activities and the concomitant activation of expression of numerous gene products whose functions are intimately linked with S phase entry and cell cycle progression (reviewed in Refs. 1 and 2 ). Disruption of various components of the pathway controlling E2F accumulation, including Rb, can lead to loss of cell growth control and the development of various human cancers. It is striking that this pathway has been disrupted in essentially all human tumors examined to date.

Of the seven known E2F family members, E2F1, E2F2, and E2F3a protein levels oscillate during the cell cycle. The expression of this group of E2Fs peaks late in G1 and coincides with the activation of G1-S-specific genes (3) . Consistent with an important role for these proteins in G1-S progression, their ectopic expression in quiescent cells leads to the activation of E2F target genes and drives cells to enter S phase (4 , 5) . On the basis of these properties, E2F1, E2F2, and E2F3a are thought to function as transcriptional activators. In contrast, the E2F3b, E2F4, and E2F5 genes are expressed throughout the cell cycle, and their protein products can be found in association with Rb and Rb-related proteins in growth-arrested G0 cells (6, 7, 8) . These observations, together with the fact that MEFs deficient for E2F4 and E2F5 are insensitive to a p16INK4A-mediated cell cycle arrest (9) , suggest that this group of E2F factors likely functions as transcriptional repressors important for driving cells into, or keeping them in, a G0-quiescent state.

Roles played by the various E2F family members in development have been studied by mouse knockout models. These models have unraveled important functions for the different E2Fs in the differentiation of multiple tissues and in full viability of the organism but have failed to demonstrate an in vivo role for E2Fs in the control of cell proliferation. E2F1-/- mice are viable but prone to various tumors. These mice show a defect in T-cell differentiation that is apparently because of a reduced capacity of their thymocytes to be appropriately activated to undergo programmed cell death (apoptosis; 10, 11, 12 ). E2F2-/- mice remain largely uncharacterized but are fully viable and do not show obvious developmental phenotypes (this study).4 E2F3-/- mice have reduced viability presumably because of a defect in proliferation in certain cell types, such as fibroblasts (13) . E2F4-/- mice are viable but show defects in differentiation of erythrocytes and the gut epithelium (14 , 15) . The development of E2F5-/- embryos appears normal, but newborn mice develop hydrocephalus because of a choroid plexus defect that results in excessive production of cerebrospinal fluid (16) .

The functional relationship between Rb and E2Fs has also been studied in vivo. A major consequence of disrupting Rb in mice is unscheduled DNA replication and extensive apoptosis in the lens and CNS (17 , 18) . These mice die in mid-gestation because of defects in erythropoietic differentiation and the resulting anemia (17, 18, 19) . Binding and inactivation of Rb by the DNA tumor virus oncogenes large T-antigen and E7 also lead to unscheduled proliferation and apoptosis of lens fiber cells (20 , 21) . The fact that Rb-/-E2F1-/- mice exhibit significantly less apoptosis than Rb-/- mice (22 , 23) demonstrates that E2F1, at least in part, mediates the apoptosis resulting from loss of Rb. Consistent with these findings, overexpression of E2F1 in rat fibroblasts leads to the induction of apoptosis (24 , 25) .

Here, we report the targeted disruption of E2F3 in mice, which leads to ablation of both the E2F3a and E2F3b proteins. Analysis of E2F1-/-, E2F2-/-, and E2F3-/- mice suggests that E2F1, E2F2, and E2F3 have largely redundant functions during early embryonic development but make major individual contributions toward the in vivo phenotypic consequences of Rb deficiency.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Loss of E2F3 Results in Gestational Mortality.
The E2F3 gene locus uses two separate promoters to regulate the expression of two distinct proteins, E2F3a and E2F3b, which differ only at the NH2 terminus (Fig. 1ACitation ; Ref. 7 ). To study the role for E2F3a and E2F3b in the control of cellular proliferation in vivo, we used Cre-LoxP gene-targeting techniques to generate E2F3-deficient mice (Fig. 1BCitation ; "Materials and Methods"). Deletion of exon 3, which encodes the DNA binding domain common to both E2F3a and E2F3b, from targeted ES cells was carried out by Cre-mediated homologous recombination and confirmed by Southern blot and PCR analysis (Fig. 1, C and D)Citation . The complete ablation of E2F3a and E2F3b proteins was confirmed by Western blot assays (Fig. 1E)Citation . The generation of E2F1-/- and E2F2-/- mice has been described elsewhere (10 , 11 , 26) . In contrast to loss of E2F1 (10 , 11) or E2F2 (26 ; Table 1Citation ), loss of E2F3 resulted in a high incidence of gestational mortality (Table 1)Citation . The few surviving E2F3-/- mice were small, and most died within 3 weeks of birth, consistent with a recent report describing the independent generation of E2F3 knockout mice (13) . Analysis of E13.5, E15.5, or E17.5 embryos revealed that most E2F3-/- animals died between E15.5 and E17.5 (Table 1)Citation . Visual or histological examination of E13.5 E2F1-/-, E2F2-/-, and E2F3-/- embryos revealed no gross differences with their wt counterparts (Fig. 1, F and GCitation and data not shown), although all three genes are known to be expressed at this embryonic stage of development (27) .



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 1. Generation of E2F3-deficient mice. A, genomic structure of the E2F3 locus. Exons are depicted as open boxes. Solid bar below exon 4, a ~900-bp SpeI-EcoRV fragment used as a Southern probe. B, targeted integration of a triple loxP-E2F3 vector in ES cells. Cre-mediated deletion of exon 3 from correctly targeted ES cells was verified at each step by Southern blotting and PCR analysis using the three primers labeled as A–C. LoxP sites are depicted as {blacktriangleup}. C, Southern blot analysis of DNA from embryos with the indicated genotypes. Genomic DNA was digested with EcoRV and hybridized with the Southern probe shown in A. D, PCR genotyping of offspring derived from heterozygous crosses. The 123-bp DNA marker is depicted as M with the fastest migrating band being 123 bp and the slowest migrating band being 369 bp. E, Western blot analysis of protein lysates derived from MEFs, using an E2F3-specific antibody from Santa Cruz Biotechnology (SC-879). F, E13.5 embryos with the indicated genotypes. G, H&E-stained sagittal section from E13.5 embryos with the indicated genotypes.

 

View this table:
[in this window]
[in a new window]
 
Table 1 Loss of E2F3 leads to gestational lethalitya

 
Loss of E2F1, E2F2, or E2F3 Does Not Affect Proliferation in the Developing Lens.
To directly determine the in vivo role of E2F3 and the possible contributions made by the other two members of the E2F-activating class, E2F1 and E2F2, toward the control of cell proliferation in vivo, we analyzed the developing lens of E2F mutant embryos. We focused on the developing lens for several reasons: (a) E2F1, E2F2, and E2F3 are expressed in the lens and have been speculated to play a role in normal proliferation of lens epithelial cells; although E2F1, E2F2, E2F3, E2F4, and E2F5 are all expressed in epithelial lens cells, only E2F1, E2F3, and E2F5 are expressed in lens fiber cells (28) ; (b) each of these E2Fs can specifically interact with Rb, and inactivation of Rb in mice leads to deregulated E2F function and lens cell proliferation (20 , 21 , 29) ; and (c) the architectural organization of the lens, where spatially regulated proliferation and differentiation events are dependent on Rb, provides a unique in vivo system to study the cell cycle. The lens consists of a proliferative layer of epithelial cells that divide laterally until they reach the lens equator (Fig. 2A)Citation . At this point, epithelial cells exit the cell cycle and migrate to the internal side of the lens, where they become postmitotic and elongate vertically to form lens fiber cells that eventually fill the cavity of the lens vesicle (reviewed in Ref. 30 ).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 2. Loss of E2F1, E2F2, or E2F3 does not affect normal proliferation in the developing lens. A, cellular structure of a wt eye. Transverse sections from a wt lens were stained with DAPI. The various cellular compartments of the eye are labeled accordingly. ep, epithelial cells; fb, fiber cells; rn, retinal neurons. The 0° to 90° area, encompassing the lens equator and the middle of the lens epithelial cells, respectively, represents one of the quadrants used to count the spatial distribution of BrdUrd-positive lens epithelial cells (31 , 32) . In B, E15.5 embryos with the indicated genotypes were sectioned and immunostained with an anti-BrdUrd antibody and counterstained with DAPI. C, the percentage of BrdUrd-positive cells in the lens epithelial (ep) and fiber cell (fb) compartments. The presented results are the average from sections derived from at least three embryos. Bars, SD. D, analysis of the spatial distribution of BrdUrd-positive cells in the epithelium of the lens of E15.5 wt ( ) or E2F3-/- embryos ({blacksquare}). The epithelial cells were divided into equal quarters, and cells were counted in 10° intervals from -20°, which correspond to -20° beyond the lens equator to 90° beyond the equator, which faces the cornea (31 , 32) .

 
Surprisingly, loss of any one of the three E2Fs had no significant effect on the proliferation of lens epithelial cells (P >= 0.1 for all pairwise comparisons; Fig. 2, B and CCitation ). We also analyzed discrete regions of the lens epithelium to determine whether E2Fs may be particularly important within confined regions of the lens epithelium. Thus, we performed the analysis described by McAvoy et al. (31 , 32) in which proliferating cells contained within 10 degree increments, beginning at the equatorial region of the lens (0 degrees) and continuing toward the area facing the cornea (90 degrees), were counted separately. This analysis revealed no differences in proliferation between lens epithelial cells of E2F3-/- embryos and their wt siblings (Fig. 2D)Citation . In addition, E2F-deficient fiber cells exited the cell cycle and differentiated normally since no unscheduled DNA replication could be detected in these cells (P >= 0.1 for all pairwise comparisons; Fig. 2, B and CCitation ), and the differentiation-specific markers, ß- and {gamma}-crystallins, were expressed appropriately (data not shown). One interpretation of these data are that under normal circumstances, loss of a single E2F member can be functionally compensated by the other related E2F activities.

E2F3 Makes a Major Contribution toward Proliferation in Rb-/- Embryos.
One major consequence of disrupting the Rb pathway in mice is unscheduled DNA replication in the lens and CNS (20, 21, 22, 23 , 29 , 33) . During normal differentiation of the lens, the Rb pathway is necessary to maintain the G0 state of the differentiated lens fiber cells. Targeted disruption of components of the Rb regulatory pathway either by the overexpression of cyclins (34) , inactivation of p57, p27 or Rb itself (29 , 33) , or inactivation of Rb by the viral oncogenes E7 and T-antigen (20, 21, 22) results in failure of lens epithelial and fiber cells to exit the cell cycle. Rb is thought to be required in maintaining a G0 state by controlling the activities of E2Fs. On Rb loss, many putative E2F-responsive genes, such as cyclins A, B1, and E and the CDKs cdc2, cdk2, and cdk4, are abnormally up-regulated in lens fiber cells, resulting in increased proliferation (35) . Considering that E2F1, E2F2, and E2F3 are the three growth-regulated activities capable of interacting specifically with Rb, and not with the other pocket-binding proteins p107 and p130, we sought to determine the relative contributions made by these E2Fs toward the phenotypic consequences of Rb loss. Consistent with previous results, we found that a significant proportion of lens fiber cells in E13.5 Rb-/- embryos was unable to exit the cell cycle, as measured by BrdUrd incorporation (Fig. 3A)Citation . Analysis of embryos deficient for Rb and each of the three activating E2Fs revealed a partial suppression of the unscheduled proliferation (P < 0.001 for each pairwise comparison). The fact that loss of E2F3 had the most pronounced impact suggests that E2F3 makes the major contribution toward the unscheduled proliferation of Rb-/- lenses (Fig. 3C)Citation . Moreover, observation of DAPI-stained lenses from Rb-/-E2F3-/- embryos by microscopy revealed a cellular arrangement that more closely resembles the typical "bow arrangement" found in properly differentiated lenses of wt embryos (Fig. 3)Citation .



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3. E2F1, E2F2, and E2F3 contribute toward the proliferation of Rb-/- fiber cells. In A, transverse sections of lenses from E13.5 embryos with the indicated genotypes were processed as in Fig. 2BCitation . Arrows, BrdUrd-positive neuronal retinal cells. B, analysis of the spatial distribution of BrdUrd-positive cells in the epithelium of the lenses of E13.5 wt ( ), Rb-/- ({blacksquare}), or Rb-/-E2F3-/- ({square}) embryos. The epithelial cells were divided into equal quarters and counted in 10° intervals from -20°, which correspond to -20° beyond the lens equator to 90° beyond the equator, which faces the cornea (31 , 32) . C, percentage of BrdUrd-positive lens fiber cells from E13.5 embryos with the indicated genotypes. D, percentage of BrdUrd-positive cells in the retinas of the indicated E13.5 embryos. E, percentage of BrdUrd-positive cells in the neuronal retinal cells of E13.5 embryos. For all of the bar graphs in this figure, the presented results are the average obtained from multiple sections derived from at least two embryos. Bars, SD.

 
Analysis of the proliferation zone of the epithelial cells revealed no differences in the number of proliferating cells between wt, Rb-/-, Rb-/-E2F1-/-, Rb-/-E2F2-/-, and Rb-/-E2F3-/- embryos (Fig. 3BCitation and data not shown). However, analysis of the epithelial cells of the lens by the method of McAvoy et al. (31 , 32) revealed a small increase in the number of proliferating cells in the transition zone between the lens epithelial and fiber cells of Rb-/- lenses relative to wt litter mates. In addition, the number of proliferating cells in the transition zone of Rb-/-E2F3-/- lenses was slightly lower than the ones in Rb-/- embryos, albeit not statistically significant (Fig. 3B)Citation . The number of replicating cells in the transition zone of Rb-/-E2F1-/- and Rb-/-E2F2-/- lenses was identical to the ones in Rb-/- embryos (data not shown). This is consistent with the results described in McCaffrey et al. (22) , where the expression of an E7 transgene in the lens of wt or E2F1-/- mice resulted in an increase in the proliferation of epithelial cells in the transition zone.

Although the analysis of wt, Rb-/-, and Rb-/-E2F3-/- embryos revealed no obvious changes in the total percentage of replicating cells of the retina (Fig. 3D)Citation , we did notice that Rb-/- embryos had increased numbers of BrdUrd-incorporating cells in an area of the retina that normally contains postmitotic neurons (Fig. 3E)Citation . Loss of E2F1, E2F2, and E2F3 from Rb-/- retinas resulted in a reduction in the number of neuronal retina cells undergoing unscheduled DNA replication.

In the CNS, as in the lens and retina, maintenance of a G0 state in differentiated neurons is also dependent on Rb. Loss of Rb function in the CNS has been shown to result in elevated levels of free E2Fs and E2F target genes and unscheduled DNA replication (36) . The patterns of expression of E2Fs in the CNS is complex and has been thoroughly described previously (27) . Although E2F1, E2F2, and E2F3 expression is distributed widely over the brain and spinal cord during early embryonic development, by E12.5, their expression is down-regulated in postmitotic neurons of the intermediate and marginal zone but not in the ventricular zone of the brain. E2F3 is present at low levels in the proliferating cells of the ventricular zone and at higher levels in the differentiated neurons of the intermediate and marginal zones. To determine whether the activating E2Fs can mediate the unscheduled proliferation observed in Rb-/- brain tissues, we analyzed postmitotic neurons in the intermediate zone adjacent to the fourth ventricle of the brain of doubly null Rb/E2F embryos for their ability to replicate DNA. As reported previously (36) , loss of Rb resulted in increased proliferation of the normally postmitotic neurons (Fig. 4A)Citation . As in the lens fiber cells, there was a significant reduction in the number of proliferating neurons in Rb-/-E2F1-/-, Rb-/-E2F2-/-, and Rb-/-E2F3-/- embryos (Fig. 4B)Citation . Although all three activating E2Fs contributed to the unscheduled proliferation induced by loss of Rb, E2F1 and E2F3 made the most pronounced contribution to this phenotype; the percentage of proliferating cells in the intermediate zone of Rb-/-E2F1-/- and Rb-/-E2F3-/- embryos was reduced to levels normally found in wt embryos.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. E2F1, E2F2, and E2F3 mediate unscheduled proliferation in the CNS of Rb-/- embryos. In A, transverse sections of brains from E13.5 embryos with the indicated genotypes were stained by the BrdUrd incorporation assay. We analyzed sections from the posterior area of the brain, adjacent to the fourth ventricle, specifically the neurons from the intermediate zone. Bars, the ventricular area (v), where proliferation occurs normally, and the intermediate zone, composed of normally postmitotic cells. B, percentage of BrdUrd-positive cells in the CNS of embryos with the indicated genotypes. The presented results are the average obtained from multiple sections derived from at least three embryos. Bars, SD of multiple embryos.

 
E2F1 and E2F3 Mediate Apoptosis in Rb-/- Embryos in a Tissue-specific Manner.
Loss of Rb also leads to extensive apoptosis in cells of the CNS, the developing lens, and in photoreceptor cells of the retina (17 , 18 , 21 , 23 , 29 , 37 , 38) . This is mediated, in part, by E2F1 as suggested by the significant suppression of apoptosis in Rb-/-E2F1-/- mice (23) . Given that E2F1, E2F2, and E2F3 are expressed in the CNS, the developing lens, and the retina, we sought to determine whether apoptosis arising in Rb-/- embryos is uniquely mediated via E2F1 or whether it could also be mediated by E2F2 and E2F3 (27 , 28) . Therefore, we compared the extent of apoptosis in the lens, retina, and CNS of Rb-/-, Rb-/-E2F1-/-, Rb-/-E2F2-/-, and Rb-/-E2F3-/- embryos. As expected, loss of Rb led to an increase in apoptosis observed in the CNS, the lens, and the retina (P <= 0.0006; Figs. 5Citation and 6Citation ). Loss of E2F1 suppressed the apoptosis resulting from Rb deficiency (P << 0.0001). In contrast to Rb-/-E2F1-/- embryos, lens fiber and postmitotic retina cells from Rb-/-E2F2-/- and Rb-/-E2F3-/- embryos contained similar or higher numbers of TUNEL-positive cells than in the Rb-/- cellular counterparts (P >= 0.11 and 0.01, respectively), suggesting that apoptosis in the lens and the retina is mediated specifically through E2F1 (Fig. 5)Citation . The apparent increase in apoptosis in Rb/E2F3 double knockout lenses is interesting and might stem from an emphasis of the E2F1 apoptotic function in the absence of a competing E2F3 activity, albeit a greater number of samples will need to be analyzed to strengthen the statistical significance of this result. Strikingly, loss of either E2F1 or E2F3, but not E2F2, almost completely abolished the apoptosis observed in the CNS of E13.5 Rb-/- embryos (P < 0.001; Fig. 6Citation ). These results demonstrate that although E2F1 specifically mediates apoptosis in the lens and the retina, both E2F1 and E2F3 are required for the apoptosis arising in the CNS of Rb-/- embryos.



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 5. E2F1 mediates apoptosis in the lens of Rb-/- embryos. In A, transverse sections of lenses and retinas from E13.5 embryos with the indicated genotypes were stained by the TUNEL peroxidase assay and counterstained with DAPI. Arrows, selected apoptotic (TUNEL positive) cells. B, percentage of TUNEL-positive fiber cells. C, percentage of TUNEL-positive neuronal retinal cells. The presented results are the average obtained from multiple sections derived from at least two embryos. Bars, SD of multiple embryos.

 


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 6. E2F1 and E2F3 mediate apoptosis in the CNS of Rb-/- embryos. In A, transverse sections of brains from E13.5 embryos with the indicated genotypes were stained by the TUNEL peroxidase assay and counterstained with DAPI to visualize nuclei. We analyzed sections from the posterior area of the brain, adjacent to the fourth ventricle, specifically the neurons from the intermediate zone. B, percentage of TUNEL-positive cells in the CNS of embryos with the indicated genotypes. The presented results are the average obtained from multiple sections derived from at least three embryos. Bars, SD of multiple embryos.

 

    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The Rb pathway is disrupted frequently during the progression of cancer (reviewed in Ref. 39 ). The tumor suppressor function of Rb is thought to be mediated, at least in part, through the regulation of the E2F transcription activators. Mice deficient for each of the three transcriptional activators (E2F1, E2F2, and E2F3) have been generated (reported here and in Refs. 10 , 11 , 13 , and 26 ). We report that E2F1, E2F2, and E2F3 make major contributions toward the phenotypic consequences of Rb loss. Importantly, our findings begin to document in vivo evidence for functional specificity among these E2Fs.

Of the seven known E2F family members, the expression of E2F1, E2F2, and E2F3 is cell cycle regulated, with their levels peaking at the G1-S transition. The oscillating nature of their DNA binding activities during the cell cycle exactly coincides with the expression of known E2F target genes whose protein products are thought to be essential for entry into S phase. Moreover, the ectopic expression of these E2Fs can efficiently induce S phase entry in otherwise quiescent fibroblasts. A series of recent experiments have suggested that there is specificity in promoter occupancy by different E2Fs (40) and in the target genes that are transcriptionally regulated by E2F1, E2F2, and E2F3 (41 , 42) . In view of these findings suggesting a critical role for E2Fs in cell growth control, it is surprising that E2F1-/- and E2F2-/- MEFs have no measurable growth defect and that E2F3-/- MEFs have only a mild defect (13 , 26) . Additionally, the disruption of E2F1, E2F2, or E2F3 in mice does not significantly affect cellular proliferation in the developing lens, retina, or CNS, tissues known to undergo unregulated proliferation on disruption of Rb. Neither do their loss significantly alter the localization or levels of the late stage lens differentiation markers, {gamma}- or ß-crystallins (data not shown). This is consistent with the lack of an overall change in the appearance and cellularity of E13.5 E2F mutant embryos (Figs. 1Citation and 2Citation and data not shown). One interpretation of these data are that under normal circumstances, loss of a single E2F member can be functionally compensated by other related E2F activities. This notion of functional redundancy among E2Fs is substantiated by our recent findings, indicating that E2F1-/-E2F3-/- and E2F2-/-E2F3-/- embryos are early embryonic lethal and that MEFs lacking all three E2Fs (conditionally deleted via Cre-mediated recombination) have a severe growth defect (43) . It will be important to determine whether ablation of multiple E2Fs from selected tissues, such as the lens, affects proliferation and differentiation in vivo.

In contrast to the lack of a strict requirement for individual E2F activities in the control of proliferation during normal embryonic development, we show that E2F1, E2F2, and E2F3 can make major contributions toward the phenotypic consequences of Rb deficiency (Figs. 3Citation 4Citation 5Citation 6)Citation . Each of these E2F family members contributes toward the inappropriate proliferation of Rb-/- lens fiber cells and neurons of the CNS and the retina, with E2F3 making the most profound contribution to this phenotype in the lens (Figs. 3, A and CCitation and 4, A and BCitation ). Whether E2F3 can mediate the unscheduled proliferation and/or apoptosis observed in Rb-/- embryos through E2F3a, E2F3b, or both remains to be determined. Perhaps most dramatic is the almost complete abolishment of apoptosis in the CNS, lens, and retina of Rb-/-E2F1-/- and in the CNS of Rb-/-E2F3-/- embryos (Figs. 5Citation and 6Citation ), suggesting important roles for E2F1 and E2F3 in the control of apoptosis. It appears that loss of the regulation imposed by Rb causes E2F function to become unchecked, leading to greatly exaggerated biological consequences, not unlike the unscheduled proliferation and/or apoptosis observed when these E2Fs are overexpressed in fibroblasts and in lens fiber cells (44) . Our present results provide striking in vivo evidence that E2F1, E2F2, and E2F3 are important effectors of Rb function that must be kept under constant control for the maintenance of a postmitotic state.

Specificity of function for E2Fs can also be inferred from the present studies. Previous work demonstrated that E2F1 can in part mediate the apoptosis and proliferation induced by loss of Rb (22 , 23) . The work described here illustrates that there is specificity of function among E2Fs in mediating proliferation and apoptosis in vivo. Although the apoptosis arising in Rb-/- lenses and retinas is uniquely mediated by E2F1, all three E2Fs contribute to the control of proliferation in cells of these tissues (Fig. 3)Citation . These findings are consistent with the previous observation that overexpression of E2F1, but not E2F2–5, can induce apoptosis in serum-starved rat fibroblasts and with recent findings linking E2F1, but not E2F2 or E2F3, in Myc-induced apoptosis of primary MEFs (4 , 26) . These results strongly suggest that, at least in the developing lens, apoptosis is not simply a consequence of the unscheduled proliferation resulting from the inactivation of Rb but likely reflects a specific signal mediated by E2F1. Our observations that E2F1 and E2F3, but not E2F2, are required to elicit an apoptotic signal in the CNS of Rb-/- embryos substantiates the concept of specificity among E2Fs. Clearly, E2F2, which has an identical spatial and temporal expression profile as E2F1 in the CNS and the retina (45) , is not without an effect in these tissues, as its loss significantly reduces the amount of proliferation occurring in postmitotic Rb-/- CNS and retinal neurons.

The unique ability of E2F1 to elicit an apoptotic response in the developing lens and retina of Rb-/- embryos likely reflects its ability to regulate a specific set of target genes. Some evidence for specific gene target activation by E2Fs exists. The overexpression of the various E2Fs in rat embryo fibroblasts can lead to the activation distinct sets of genes (4) . In these cells, E2F1, but not E2F2, can lead to the stabilization of p53 protein and apoptosis (46) . In mouse embryo fibroblasts, the specific induction of the proapoptotic Apaf1 gene by E2F1 is required for the efficient execution of an apoptotic response (47) , providing a further molecular basis for the unique function of E2F1 in apoptosis.

The accumulation of E2F1 is part of the normal cascade of events that occur during the stimulation of cellular proliferation. Several observations may help explain why cells induced to proliferate normally escape from E2F1-mediated cell death. In G0 cells stimulated to reenter the cell cycle, E2F1 DNA binding activity accumulates sharply at the G1-S boundary, quickly decreases as cells progress through S phase, and remains low thereafter during cycling conditions (3) . Thus, E2F1 activity in normal cells is tightly regulated and apparent only at specific points during the cell cycle. On the other hand, in the absence of Rb, E2F1 DNA binding activity accumulates to higher levels than normally found during G1-S and persists throughout the cell cycle. Such unregulated E2F activity might lead to the inappropriate persistent activation of target genes or to the activation of targets normally not activated during G1-S and the ensuing catastrophic consequence of apoptosis. Furthermore, the accumulation of E2F1 during a mitogenic response normally occurs in conjunction with the parallel activation of survival signals, such as those mediated by the phosphatidylinositol 3'-kinase/Akt pathway, allowing cells to proliferate and escape an apoptotic fate. Indeed, the apoptosis resulting from the overexpression of E2F1 in quiescent fibroblasts can be largely abrogated by the addition of serum.4 Thus, E2F1-mediated apoptotic signals could be viewed to represent a checkpoint for proper cell cycle exit/entry that must be negated by either direct binding to Rb or countered by the activation of appropriate survival signals.

Why does the loss of E2F3 rescue the apoptosis occurring in the CNS but not in the lens of Rb-/- embryos? Previous work using chimeric mice reconstituted from Rb+/+ and Rb-/- embryonic stem cells suggested that although Rb’s function in the developing lens appears to be cell autonomous, its function in the CNS may be cell nonautonomous (37 , 48) . More recent studies of the developing CNS have defined a role for Rb in the suppression of apoptosis that is cell nonautonomous and a role for suppression of ectopic S phase that is cell autonomous (48) . These findings raise the distinct possibility that suppression of apoptosis in the CNS of Rb/E2F3 double mutant embryos is a cell nonautonomous consequence. Hence, the developing lens may be a uniquely suited tissue in which to investigate the roles for E2Fs in the regulation of apoptosis and cell proliferation without confounding cell extrinsic effects. The replacement of specific E2Fs by other family members using knock-in strategies in vivo might provide more definitive answers to this important issue of functional specificity among E2F family members.

Alternatively, our observation that loss of E2F3 eliminates most of the apoptosis occurring in the CNS, but not in the lens and retina of Rb-/- embryos, might imply that the induction of E2F-mediated apoptosis can be influenced by tissue-specific factors. Considering the complexity of the organization of gene promoters, it is not difficult to envision how additional tissue-specific transcription factors or coactivators might impact, by interacting directly or indirectly with specific E2Fs, on the regulation of E2F target genes responsible for mediating apoptosis, e.g., a putative CNS-specific factor might, by specifically interacting with E2F3, shift its gene target spectrum to include apoptotic-type target genes.

Our finding that E2F1 is the only activating E2F that can mediate apoptosis in the lens and retina is in conflict with a recent report showing a dramatic reduction in apoptosis in the lenses of Rb-/-E2F3-/- mice (49) . Although the genetic background of our studies is similar (C57BL/6 x 129/Sv), these differences might be because of the degree of inbreeding between our strains. In this regard, genetic modifiers have been evoked to explain differences in the severity of growth characteristics of cells lacking E2F3 (13) and might explain the differences observed in the lens.

Finally, we believe that the results presented here directly impact on our understanding and possible development of therapeutic treatments of cancer. Although in normal cells, loss of a single E2F member will likely have no effect on the control of cellular proliferation, under oncogenic circumstances, where the Rb pathway is disrupted, loss of an individual E2F activity may have profound consequences on the fate of the malignant cell. We speculate that targeting the disruption of a single E2F member in human cancers may have either a positive or negative outcome, depending on the tissue origin of the tumor and the ability of the E2F to affect proliferation and/or apoptosis in that tissue.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Generation of E2F3-/- Mice.
To ablate E2F3 function, we targeted exon 3, which encodes the DNA binding domain that is common and essential for both E2F3a and E2F3b function. A triple LoxP targeting vector system was used to generate ES cells containing the modified E2F3 allele shown in Fig. 1BCitation . Details for the generation of the targeting vector, the targeted inactivation of E2F3 through homologous recombination, and the generation of E2F3 chimeras are described elsewhere (26) and can be obtained on request. All embryos were genotyped by PCR. PCR for the E2F3 gene was carried out using three primers as described in Fig. 1BCitation ; primers B (TGAATCATGGACAGAGCCAGG) and C (GATTGATTCTGGGTTGTCAGG) are specific for the wt allele and give rise to a 190-bp product, and primers A (GTGGCTGGAAGGGTGCCAAG) and C are specific for the knockout allele, giving rise to a 290-bp PCR fragment. The E2F1-/- mice have been described (10 , 11) . The E2F2-/- mice have been generated recently, and a detailed phenotypic analysis is in progress (26) .5 Double knockout embryos were generated by either intercrossing Rb+/-E2Fs+/- or, in some cases, by intercrossing Rb+/-E2Fs+/- with Rb+/-E2Fs-/- parents.

BrdUrd Incorporation and TUNEL Assays.
BrdUrd assays were performed as described previously (21) . Pregnant mice (13.5–15.5 days postcoitum) were injected i.p. with BrdUrd (100 µg/grams body weight) 2 h before sacrificing, and individual embryos were fixed in formalin. We analyzed at least three embryos of each genotype that were derived from at least two different litters (i.e., two different mothers). Sections (5 µm) were deparaffinized, rehydrated, digested with pepsin, and denatured in HCl. BrdUrd incorporation was detected using an anti-BrdUrd antibody (DAKO Co.) and a secondary FITC-antimouse monoclonal antibody (Vector Laboratories). Nuclei were counterstained with DAPI.

The TUNEL/peroxidase assay was done according to the manufacturer’s instructions (Invitrogen), except that cells were treated with 0.1% Triton X-100 for 10 min before proteinase K digestion, and the terminal deoxynucleotidyltransferase reaction was performed for 1.5 h. Nuclei were counterstained with DAPI. The percentage of apoptotic or proliferating cells was calculated by counting the total number of BrdUrd- or TUNEL-positive cells relative to the number of DAPI-stained cells. Approximately 150 epithelial cells, 300 fiber cells, and 300 neuronal cells from the retina were counted from each lens section. Approximately 400 cells from the intermediate zone adjacent to the fourth ventricle were analyzed per brain section. In each case, at least four sections per embryo were analyzed. The lens epithelial cells were also analyzed as described (31 , 32) . Briefly, the lens was divided into equal quarters, and two of the quarters were divided using a protractor into 10-degree sections that ranged from -20° to 90°. Cells were counted from the -20° area, which corresponds to 20° beyond the lens equator, facing the retina, to the 90° position, which corresponds to the middle of the epithelial cell layer facing the cornea (Fig. 2A)Citation . Statistical analysis was performed by the two-tailed, unequal variance paired t test using the Microsoft Excel program.


    Acknowledgments
 
We thank Michael Greenberg for providing the E2F1-/- mice, Tyler Jacks for providing the Rb-/- mice, and Cheryl Bock, Christian M. Rizo, Haotian Zhao, Elizabeth McGrew, and Allison Bonner for various technical assistance.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the National Eye Institute (RO1EY12995; to M. L. R.) and the National Cancer Institute (RO1CA82259 and RO1CA85619; to G. L.). H. I. S. was supported by an National Cancer Institute minority postdoctoral supplement; a NIH T-32 award supported L. W. C. T. was supported by an ACS Postdoctoral Fellowship, and G. L. is a V-Foundation and Pew scholar. Back

2 To whom requests for reprints should be addressed, at Human Cancer Genetics Program, Department of Molecular Virology, Immunology and Medical Genetics and Department of Molecular Genetics 620 MRF 420 12th Avenue, Columbus, Ohio 43210. Phone: (614) 688-4567; Fax: (614) 688-4245; E-mail: Leone-1{at}medctr.osu.edu Back

3 The abbreviations used are: CDK, cyclin-dependent kinase; CNS, central nervous system; DAPI, 4',6-diamidino-2-phenylindole; MEF, mouse embryonic fibroblast; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end labeling; wt, wild type; Rb, retinoblastoma. Back

4 G. Leone, unpublished data. Back

5 S. Field, personal communication. Back

Received for publication 3/ 4/02. Revision received 4/29/02. Accepted for publication 4/29/02.


    References
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Dyson N. The regulation of E2F by pRB-family proteins. Genes Dev., 12: 2245-2262, 1998.[Free Full Text]
  2. Nevins J. R. Toward an understanding of the functional complexity of the E2F and retinoblastoma families. Cell Growth Differ., 9: 585-593, 1998.[Medline]
  3. Leone G., DeGregori J., Yan Z., Jakoi L., Ishida S., Williams R. S., Nevins J. R. E2F3 activity is regulated during the cell cycle and is required for the induction of S phase. Genes Dev., 12: 2120-2130, 1998.[Abstract/Free Full Text]
  4. DeGregori J., Leone G., Miron A., Jakoi L., Nevins J. R. Distinct roles for E2F proteins in cell growth control and apoptosis. Proc. Natl. Acad. Sci. USA, 94: 7245-7250, 1997.[Abstract/Free Full Text]
  5. Johnson D. G., Schwarz J. K., Cress W. D., Nevins J. R. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature (Lond.), 365: 349-352, 1993.[Medline]
  6. Lees J. A., Saito M., Vidal M., Valentine M., Look T., Harlow E., Dyson N., Helin K. The retinoblastoma protein binds to a family of E2F transcription factors. Mol. Cell. Biol., 13: 7813-7825, 1993.[Abstract/Free Full Text]
  7. Leone G., Nuckolls F., Ishida S., Adams M., Sears R., Jakoi L., Miron A., Nevins J. R. Identification of a novel E2F3 product suggests a mechanism for determining specificity of repression by Rb proteins. Mol. Cell. Biol., 20: 3626-3632, 2000.[Abstract/Free Full Text]
  8. Vairo G., Livingston D. M., Ginsberg D. Functional interaction between E2F-4 and p130: evidence for distinct mechanisms underlying growth suppression by different retinoblastoma protein family members. Genes Dev., 9: 869-881, 1995.[Abstract/Free Full Text]
  9. Gaubatz S., Lindeman G. J., Ishida S., Jakoi L., Nevins J. R., Livingston D. M., Rempel R. E. E2F4 and E2F5 play an essential role in pocket protein-mediated G1 control. Mol. Cell, 6: 729-735, 2000.[Medline]
  10. Field S. J., Tsai F. Y., Kuo F., Zubiaga A. M., Kaelin W. G., Jr., Livingston D. M., Orkin S. H., Greenberg M. E. E2F-1 functions in mice to promote apoptosis and suppress proliferation. Cell, 85: 549-561, 1996.[Medline]
  11. Yamasaki L., Jacks T., Bronson R., Goillot E., Harlow E., Dyson N. J. Tumor induction and tissue atrophy in mice lacking E2F-1. Cell, 85: 537-548, 1996.[Medline]
  12. Yamasaki L., Bronson R., Williams B. O., Dyson N. J., Harlow E., Jacks T. Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rb1(+/-) mice. Nat. Genet., 18: 360-364, 1998.[Medline]
  13. Humbert P. O., Verona R., Trimarchi J. M., Rogers C., Dandapani S., Lees J. A. E2f3 is critical for normal cellular proliferation. Genes Dev., 14: 690-703, 2000.[Abstract/Free Full Text]
  14. Humbert P. O., Rogers C., Ganiatsas S., Landsberg R. L., Trimarchi J. M., Dandapani S., Brugnara C., Erdman S., Schrenzel M., Bronson R. T., Lees J. A. E2F4 is essential for normal erythrocyte maturation and neonatal viability. Mol. Cell, 6: 281-291, 2000.[Medline]
  15. Rempel R. E., Saenz-Robles M. T., Storms R., Morham S., Ishida S., Engel A., Jakoi L., Melhem M. F., Pipas J. M., Smith C., Nevins J. R. Loss of E2F4 activity leads to abnormal development of multiple cellular lineages. Mol. Cell, 6: 293-306, 2000.[Medline]
  16. Lindeman G. J., Dagnino L., Gaubatz S., Xu Y., Bronson R. T., Warren H. B., Livingston D. M. A specific, nonproliferative role for E2F-5 in choroid plexus function revealed by gene targeting. Genes Dev., 12: 1092-1098, 1998.[Abstract/Free Full Text]
  17. Jacks T., Fazeli A., Schmitt E. M., Bronson R. T., Goodell M. A., Weinberg R. A. Effects of an Rb mutation in the mouse. Nature (Lond.), 359: 295-300, 1992.[Medline]
  18. Lee E. Y., Chang C. Y., Hu N., Wang Y. C., Lai C. C., Herrup K., Lee W. H., Bradley A. Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature (Lond.), 359: 288-294, 1992.[Medline]
  19. Clarke A. R., Maandag E. R., van Roon M., van der Lugt N. M., van der Valk M., Hooper M. L., Berns A., te Riele H. Requirement for a functional Rb-1 gene in murine development. Nature, 359: 328-330, 1992.[Medline]
  20. Pan H., Griep A. E. Altered cell cycle regulation in the lens of HPV-16 E6 or E7 transgenic mice: implications for tumor suppressor gene function in development. Genes Dev., 8: 1285-1299, 1994.[Abstract/Free Full Text]
  21. Fromm L., Shawlot W., Gunning K., Butel J. S., Overbeek P. A. The retinoblastoma protein-binding region of simian virus 40 large T antigen alters cell cycle regulation in lenses of transgenic mice. Mol. Cell. Biol., 14: 6743-6754, 1994.[Abstract/Free Full Text]
  22. McCaffrey J., Yamasaki L., Dyson N. J., Harlow E., Griep A. E. Disruption of retinoblastoma protein family function by human papillomavirus type 16 E7 oncoprotein inhibits lens development in part through E2F-1. Mol. Cell. Biol., 19: 6458-6468, 1999.[Abstract/Free Full Text]
  23. Tsai K. Y., Hu Y., Macleod K. F., Crowley D., Yamasaki L., Jacks T. Mutation of E2f-1 suppresses apoptosis and inappropriate S phase entry and extends survival of Rb-deficient mouse embryos. Mol. Cell, 2: 293-304, 1998.[Medline]
  24. Wu X., Levine A. J. p53 and E2F-1 cooperate to mediate apoptosis. Proc. Natl. Acad. Sci. USA, 91: 3602-3606, 1994.[Abstract/Free Full Text]
  25. Qin X. Q., Livingston D. M., Kaelin W. G., Jr., Adams P. D. Deregulated transcription factor E2F-1 expression leads to S-phase entry and p53-mediated apoptosis. Proc. Natl. Acad. Sci. USA, 91: 10918-10922, 1994.[Abstract/Free Full Text]
  26. Leone G., Sears R., Huang E., Rempel R., Nuckolls F., Park C-H., Giangrande P., Wu L., Saavedra H. I., Field S. J. A., Thompson M., Yang H., Fujiwara Y., Greenberg M. E., Orkin S., Smith C., Nevins J. R. Myc requires distinct E2F activities to induce S phase and apoptosis. Mol. Cell, 8: 105-113, 2001.[Medline]
  27. Dagnino L., Fry C. J., Bartley S. M., Farnham P., Gallie B. L., Phillips R. A. Expression patterns of the E2F family of transcription factors during mouse nervous system development. Mech. Dev., 66: 13-25, 1997.[Medline]
  28. Rampalli A. M., Gao C. Y., Chauthaiwale V. M., Zelenka P. S. pRb and p107 regulate E2F activity during lens fiber cell differentiation. Oncogene, 16: 399-408, 1998.[Medline]
  29. Morgenbesser S. D., Williams B. O., Jacks T., DePinho R. A. p53-dependent apoptosis produced by Rb-deficiency in the developing mouse lens. Nature (Lond.), 371: 72-74, 1994.[Medline]
  30. Kondoh H. Transcription factors for lens development assessed in vivo. Curr. Opin. Genet. Dev., 9: 301-308, 1999.[Medline]
  31. McAvoy J. W. Cell division, cell elongation and the co-ordination of crystallin gene expression during lens morphogenesis in the rat. J. Embryol. Exp. Morphol., 45: 271-281, 1978.[Medline]
  32. Shirke S., Faber S. C., Hallem E., Makarenkova H. P., Robinson M. L., Overbeek P. A., Lang R. A. Misexpression of IGF-I in the mouse lens expands the transitional zone and perturbs lens polarization. Mech. Dev., 101: 167-174, 2001.[Medline]
  33. Zhang P., Wong C., DePinho R. A., Harper J. W., Elledge S. J. Cooperation between the Cdk inhibitors p27(KIP1) and p57(KIP2) in the control of tissue growth and development. Genes Dev., 12: 3162-3167, 1998.[Abstract/Free Full Text]
  34. Gome Zlahoz E., Liegeois N. J., Zhang P., Engelman J. A., Horner J., Silverman A., Burde R., Roussel M. F., Sherr C. J., Elledge S. J., DePinho R. A. Cyclin D- and E-dependent kinases and the p57(KIP2) inhibitor: cooperative interactions in vivo. Mol. Cell. Biol., 19: 353-363, 1999.[Abstract/Free Full Text]
  35. Fromm L., Overbeek P. A. Regulation of cyclin and cyclin-dependent kinase gene expression during lens differentiation requires the retinoblastoma protein. Oncogene, 12: 69-75, 1996.[Medline]
  36. Macleod K. F., Hu Y., Jacks T. Loss of Rb activates both p53-dependent and independent cell death pathways in the developing mouse nervous system. EMBO J., 15: 6178-6188, 1996.[Medline]
  37. Maandag E. C., van der Valk M., Vlaar M., Feltkamp C., O’Brien J., van Roon M., van der Lugt N., Berns A., te Riele H. Developmental rescue of an embryonic-lethal mutation in the retinoblastoma gene in chimeric mice. EMBO J., 13: 4260-4268, 1994.[Medline]
  38. Howes K. A., Ransom N., Papermaster D. S., Lasudry J. G., Albert D. M., Windle J. J. Apoptosis or retinoblastoma: alternative fates of photoreceptors expressing the HPV-16 E7 gene in the presence or absence of p53(Published erratum in Genes Dev., 8: 1738, 1994). Genes Dev., 8: 1300-1310, 1994.[Abstract/Free Full Text]
  39. Nevins J. R. The Rb/E2F pathway and cancer. Hum. Mol. Genet., 10: 699-703, 2001.[Abstract/Free Full Text]
  40. Takahashi Y., Rayman J. B., Dynlacht B. D. Analysis of promoter binding by the E2F and pRB families in vivo: distinct E2F proteins mediate activation and repression. Genes Dev., 14: 804-816, 2000.[Abstract/Free Full Text]
  41. Muller H., Bracken A. P., Vernell R., Moroni M. C., Christians F., Grassilli E., Prosperini E., Vigo E., Oliner J. D., Helin K. E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis. Genes Dev., 15: 267-285, 2001.[Abstract/Free Full Text]
  42. Ishida S., Huang E., Zuzan H., Spang R., Leone G., West M., Nevins J. R. Role for E2F in control of both DNA replication and mitotic functions as revealed from DNA microarray analysis. Mol. Cell. Biol., 21: 4684-4699, 2001.[Abstract/Free Full Text]
  43. Wu L., Timmers C., Maiti B., Saavedra H. I., Sang L., Chong G. T., Nuckolls F., Giangrande P., Wright F. A., Field S. J., Greenberg M. E., Orkin S., Nevins J. R., Robinson M. L., Leone G. The E2F1, E2F2, and E2F3 transcription factors are essential for cellular proliferation. Nature, 414: 457-462, 2001.[Medline]
  44. Chen Q., Hung F. C., Fromm L., Overbeek P. A. Induction of cell cycle entry and cell death in postmitotic lens fiber cells by overexpression of E2F1 or E2F2. Investig. Ophthalmol. Vis. Sci., 41: 4223-4231, 2000.[Abstract/Free Full Text]
  45. Dagnino L., Fry C. J., Bartley S. M., Farnham P., Gallie B. L., Phillips R. A. Expression patterns of the E2F family of transcription factors during murine epithelial development. Cell Growth Differ., 8: 553-563, 1997.[Abstract]
  46. Kowalik T. F., DeGregori J., Leone G., Jakoi L., Nevins J. R. E2F1-specific induction of apoptosis and p53 accumulation, which is blocked by Mdm2. Cell Growth Differ., 9: 113-118, 1998.[Abstract]
  47. Moroni M. C., Hickman E. S., Denchi E. L., Caprara G., Colli E., Cecconi F., Muller H., Helin K. Apaf-1 is a transcriptional target for E2F and p53. Nat. Cell Biol., 3: 552-558, 2001.[Medline]
  48. Lipinski M. M., Macleod K. F., Williams B. O., Mullaney T. L., Crowley D., Jacks T. Cell-autonomous and non-cell-autonomous functions of the Rb tumor suppressor in developing central nervous system. EMBO J., 20: 3402-3413, 2001.[Medline]
  49. Ziebold U., Reza T., Caron A., Lees J. A. E2F3 contributes both to the inappropriate proliferation and to the apoptosis arising in Rb mutant embryos. Genes Dev., 15: 386-391, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
J.-L. Chong, S.-Y. Tsai, N. Sharma, R. Opavsky, R. Price, L. Wu, S. A. Fernandez, and G. Leone
E2f3a and E2f3b Contribute to the Control of Cell Proliferation and Mouse Development
Mol. Cell. Biol., January 15, 2009; 29(2): 414 - 424.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
R. Rajagopal, L. K. Dattilo, V. Kaartinen, C.-X. Deng, L. Umans, A. Zwijsen, A. B. Roberts, E. P. Bottinger, and D. C. Beebe
Functions of the Type 1 BMP Receptor Acvr1 (Alk2) in Lens Development: Cell Proliferation, Terminal Differentiation, and Survival
Invest. Ophthalmol. Vis. Sci., November 1, 2008; 49(11): 4953 - 4960.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. T. Mihaylova, A. M. Green, M. Khurgel, O. J. Semmes, and G. M. Kupfer
Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage
Cancer Res., June 15, 2008; 68(12): 4843 - 4852.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. Angelis, A. Garcia, S. S. Chan, K. Schenke-Layland, S. Ren, S. J. Goodfellow, M. C. Jordan, K. P. Roos, R. J. White, and W. R. MacLellan
A Cyclin D2-Rb Pathway Regulates Cardiac Myocyte Size and RNA Polymerase III After Biomechanical Stress in Adult Myocardium
Circ. Res., May 23, 2008; 102(10): 1222 - 1229.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Dirlam, B. T. Spike, and K. F. Macleod
Deregulated E2f-2 Underlies Cell Cycle and Maturation Defects in Retinoblastoma Null Erythroblasts
Mol. Cell. Biol., December 15, 2007; 27(24): 8713 - 8728.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. H. Giangrande, J. Zhang, A. Tanner, A. D. Eckhart, R. E. Rempel, E. R. Andrechek, J. M. Layzer, J. R. Keys, P.-O. Hagen, J. R. Nevins, et al.
Distinct roles of E2F proteins in vascular smooth muscle cell proliferation and intimal hyperplasia
PNAS, August 7, 2007; 104(32): 12988 - 12993.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. A. McClellan, V. A. Ruzhynsky, D. N. Douda, J. L. Vanderluit, K. L. Ferguson, D. Chen, R. Bremner, D. S. Park, G. Leone, and R. S. Slack
Unique Requirement for Rb/E2F3 in Neuronal Migration: Evidence for Cell Cycle-Independent Functions
Mol. Cell. Biol., July 1, 2007; 27(13): 4825 - 4843.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. Ahuja, P. Sdek, and W. R. MacLellan
Cardiac Myocyte Cell Cycle Control in Development, Disease, and Regeneration
Physiol Rev, April 1, 2007; 87(2): 521 - 544.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Parisi, T. L. Yuan, A. M. Faust, A. M. Caron, R. Bronson, and J. A. Lees
Selective Requirements for E2f3 in the Development and Tumorigenicity of Rb-Deficient Chimeric Tissues
Mol. Cell. Biol., March 15, 2007; 27(6): 2283 - 2293.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
P. L. Wenzel, L. Wu, A. de Bruin, J.-L. Chong, W.-Y. Chen, G. Dureska, E. Sites, T. Pan, A. Sharma, K. Huang, et al.
Rb is critical in a mammalian tissue stem cell population
Genes & Dev., January 1, 2007; 21(1): 85 - 97.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Gu, R. P. Singh, S. Dhanalakshmi, S. Mohan, and R. Agarwal
Differential effect of silibinin on E2F transcription factors and associated biological events in chronically UVB-exposed skin versus tumors in SKH-1 hairless mice.
Mol. Cancer Ther., August 1, 2006; 5(8): 2121 - 2129.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Qin, R. Kishore, C. M. Dolan, M. Silver, A. Wecker, C. N. Luedemann, T. Thorne, A. Hanley, C. Curry, L. Heyd, et al.
Cell cycle regulator E2F1 modulates angiogenesis via p53-dependent transcriptional control of VEGF
PNAS, July 18, 2006; 103(29): 11015 - 11020.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
T. C. Hallstrom and J. R. Nevins
Jab1 is a specificity factor for E2F1-induced apoptosis
Genes & Dev., March 1, 2006; 20(5): 613 - 623.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Sun, Y. Chang, B. Schweers, M. A. Dyer, X. Zhang, S. W. Hayward, and D. W. Goodrich
An E2F Binding-Deficient Rb1 Protein Partially Rescues Developmental Defects Associated with Rb1 Nullizygosity
Mol. Cell. Biol., February 15, 2006; 26(4): 1527 - 1537.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Takahashi, B. Contreras, R. T. Bronson, M. Loda, and M. E. Ewen
Genetic Interaction between Rb and K-ras in the Control of Differentiation and Tumor Suppression
Mol. Cell. Biol., December 1, 2004; 24(23): 10406 - 10415.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
U. Ziebold, E. Y. Lee, R. T. Bronson, and J. A. Lees
E2F3 Loss Has Opposing Effects on Different pRB-Deficient Tumors, Resulting in Suppression of Pituitary Tumors but Metastasis of Medullary Thyroid Carcinomas
Mol. Cell. Biol., September 15, 2003; 23(18): 6542 - 6552.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. X. Li, J. W. Zhu, C. J. Hogan, and J. DeGregori
Defective Gene Expression, S Phase Progression, and Maturation during Hematopoiesis in E2F1/E2F2 Mutant Mice
Mol. Cell. Biol., May 15, 2003; 23(10): 3607 - 3622.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. D. MUNDLE and G. SABERWAL
Evolving intricacies and implications of E2F1 regulation
FASEB J, April 1, 2003; 17(6): 569 - 574.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saavedra, H. I.
Right arrow Articles by Leone, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saavedra, H. I.
Right arrow Articles by Leone, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation