Cell Growth & Differentiation Vol. 13, 195-203, April 2002
© 2002 American Association for Cancer Research
Increased Gene Expression of Lung Marker Proteins in the Homeobox B3-overexpressed Fetal Lung Cell Line M3E3/C3
Nobuatsu Nakamura,
Tatsuya Yoshimi1 and
Takashi Miura
Laboratory of Environmental Molecular Physiology, School of Life Science, Tokyo University of Pharmacy and Life Science, Tokyo 192-0392, Japan
 |
Abstract
|
|---|
Homeobox (Hox)-containing factors have been shown to play regulatory roles on lung development. Although HoxB3 gene expression is detected in the prenatal lung during development, its function has not been clarified precisely. We constructed an expression vector of a hamster HoxB3 coding region, which was cloned from hamster fetal lung cell line M3E3/C3. Sixteen-base deletion was found in the hamster HoxB3 coding sequence when compared with the mouse sequence. Under conditions of differentiation, cells transfected transiently with HoxB3 augmented the retinol-induced gene expression of Clara cell-specific secretory protein, whereas the cells showed reduced expression of surfactant-associated protein C. These alterations were attenuated by the transfection with HoxB3 antisense nucleotide. The results show that the cells with overexpressed HoxB3 were reinforced to have characteristics of Clara cells but did not have the characteristics of alveolar type II cells, and that HoxB3 played a stimulatory role on Clara cell differentiation in M3E3/C3 cells. In addition, the expression of Clara cell-specific secretory protein and surfactant-associated protein C genes was enhanced upon transfer of cells to collagen substrate, suggesting that collagen substrate has some regulatory functions on lung cell differentiation through cell adhesion.
 |
Introduction
|
|---|
The pulmonary epithelial cells are the main target of atmospheric xenobiotics such as ozone, nitrogen dioxide, and organic chemicals. Inspired oxidative stressors impair epithelial cells, especially those located at the junction between the bronchioles and alveolar ducts (1, 2, 3, 4)
. Clara, ciliated, and goblet cells are the major epithelial cells in the bronchioles. It is possible that Clara cells are involved in repair of injured lung as a progenitor cell in addition to playing an inductive role in the development and maturation of the airway epithelium (5)
. It is therefore important to clarify the proliferation and differentiation processes of the bronchiolar epithelial cells to understand the repair mechanism from bronchiolar injury and prevent severe pulmonary dysfunction. However, the complicated nature of the lung has hampered clarification of the mechanisms of proliferation and differentiation at the cellular and molecular levels. This is especially true of the bronchiolar system, where the origins of the epithelial cells and their differentiation processes have not yet been fully clarified.
Clara cells are secretory epithelial cells lining the bronchiole of the pulmonary system. They synthesize SPs2
A, B, D, and CCSP. The CCSP gene is activated by nuclear proteins such as TTF-1 and HNF3ß, which are expressed in developing lungs in humans (6)
and mice (7)
. It has been shown that TTF-1 and HNF3ß modulate expression of SP-B and CCSP promoter constructs in human and mouse adenocarcinoma cells (8, 9, 10)
. Hox genes are also expressed during embryonic and fetal lung development (11)
. HoxA4 and HoxA5 genes were proposed to be involved in patterning of embryonic lungs of mouse (12)
. The regional and cellular expression pattern of HoxB5 changes with advancing lung development (13)
, and treatment with HoxB5 antisense oligonucleotides results in decreased numbers of primary and subsequent branches in embryonic lung cultures (14)
. HoxB3 was expressed in the developing lung of mouse embryo (11)
. The TTF-1 promoter is activated only by HoxB3 among Hox proteins in the thyroid primordia and thyroid gland (15)
. Taken together, it seems possible that HoxB3, as an upstream transcription factor, regulates transcription of CCSP. However, an involvement of HoxB3 in the transcription of the CCSP gene is not yet clarified.
Recently, we have shown that the transcripts of TTF-1 and HNF3
were constantly found in the M3E3/C3 cell (16)
, a unique cell line, which was derived from normal hamster fetal lungs (17)
. Under appropriate conditions, this cell line differentiates into three types of cells with some characteristics of secretory cells (17)
, neuroendocrine cells (18)
, and alveolar type II cells (19)
. To clarify the involvement of HoxB3 in differentiation of M3E3/C3 cells into Clara-like cells, we first isolated cDNA of the hamster HoxB3 coding region and determined the sequences of nucleotide and deduced amino acid. The transfection of HoxB3 cDNA augmented the retinol-induced expression of the CCSP gene in M3E3/C3 cells under the differentiation conditions into Clara-like cells, whereas that of the SP-C gene, a marker protein of alveolar type II cells, decreased. Moreover, these alterations were suppressed by the transfection of the HoxB3 antisense nucleotide. These results show that HoxB3 plays a stimulatory role on expression of Clara cell marker gene during differentiation of M3E3/C3 cells into Clara-like cells.
 |
Results
|
|---|
Cloning of the cDNAs for HoxB3 Homologue from M3E3/C3 Cells and the Sequences of Nucleotide and Deduced Amino Acid.
To identify a hamster homologue of the HoxB3 gene, RNA samples obtained from cells cultured on tissue culture dish in conventional medium were subjected to RT-PCR. Because a full length of the coding region was difficult to amplify because of the GC-rich region, we used three sets of primers, designed on the basis of the coding regions of humans, mice, rats, and chickens. Amplified cDNAs were cut by restriction enzymes (Fig. 1A)
and cloned. Analysis of the sequences of cDNAs revealed a correspondence with the full-length coding region of the HoxB3 gene. Fig. 1B
shows the sequences of the entire nucleotide and deduced amino acid. The cDNA clone was 1275 bp long, encoding 425 amino acids. The nucleotide and amino acid sequences were 95 and 98% homologous with the coding region of mouse HoxB3, respectively. The hexapeptide consensus sequence and homeodomain were found at positions 386403 and 557739, respectively. When compared with the mouse HoxB3 gene, three deletions, 3, 12, and 1 nucleotides long, were found at positions of 448, 493, and 1273, respectively. The intron sequence (
810 bp) was also detected by genomic PCR similar to that reported in the mouse genome (20)
. A 3-base deletion at the 448 position was attributable to the two CAG repeats at which the intron was alternatively spliced out with 3 bases longer (data not shown). Although the 12-bp deletion encodes four glycines in the glycine-rich region, the HoxB3 structure might not be affected as much. The human HoxB3 sequence (GenBank HSU59298) also has a 6-bp deletion near the 12-bp deletion point of the hamster. One base deletion at the 3'-terminal region resulted in a lack of three amino acids in the hamster, caused by the termination codon appearing 9 bp earlier than that of the mouse and human homologues.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1. Structure and sequence of hamster HoxB3. A, structural map of three cDNAs for the coding region of the HoxB3 gene. The open rectangles indicate the open reading frame. The left solid box indicates the position of the hexapeptide, and the right solid box indicates the position of the homeodomain. Three overlapping cDNAs were generated by using RT-PCR and combined into one cDNA using restriction enzymes (RsrII and BsaMI). The filled triangle indicates the splicing site, and the open triangles indicate the deletion sites. B, nucleotide and deduced amino acid sequences. The hexapeptide and homeodomain region are surrounded by open boxes. The large box indicates the homeodomain, and the small box indicates the hexapeptide. The filled triangle and open triangle show the sites of the same position as shown in A. Information for this sequence is disclosed by GenBank as accession number AB056577.
|
|
Transfection of the HoxB3 Coding Region into M3E3/C3 Cells.
The coding region of HoxB3 was fused with FLAG and integrated into vector pcDNA3.1(+). The plasmid was transfected transiently into M3E3/C3 cells. The expression of the HoxB3 gene was detected by 20 cycles of PCR in transfected cells, whereas the gene was detected by 50 cycles in control cells (Fig. 2, B and C)
. The HoxB3 protein of transfected cells was abundantly observed at Mr <50,000 by Western blotting using antibody against FLAG, followed by decrease to about half at 3 days after transfection and almost disappeared after 8 days (Fig. 2A)
.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2. Overexpression of HoxB3 in M3E3/C3 cells. A, detection of HoxB3 by Western blotting. Right four lanes were detection by anti-FLAG antibody in FLAG-HoxB3-transfected cells and left lane in control cells. The first antibody was an anti-FLAG (mouse), and the second antibody was an antimouse IgG (horseradish peroxidase-conjugate). Flag-HoxB3 protein was detected Mr <50,000 (1 day N and 3 days C). B, detection of the HoxB3 gene expression by RT-PCR. The quantities of HoxB3 and GAPDH were estimated in the HoxB3-transfected and control cells. The PCR reaction was 20, 30, 40, 50, and 60 cycles for HoxB3 and 25 cycles for GAPDH. C, determination of HoxB3 mRNA level by RT-PCR. The HoxB3 mRNA level was determined semiquantitatively by RT-PCR using control and HoxB3-transfected samples. PCR products were estimated from gel images using Atto software. The value of GAPDH was 11.2 ± 1.0 and 11.0 ± 0.9 for control and transfected samples, respectively. Each point represents the mean (n = 3 or 4); bars, SD. The significant difference between control and HoxB3-transfected cells was observed at all cycles (P < 0.05).
|
|
Differentiation of HoxB3-transfected M3E3/C3 Cells into Clara-like Cells.
To ascertain differentiation potency of HoxB3-transfected cells into Clara-like cells, cells were cultured according to the culture schedule as shown in Fig. 3
. Two days after transfer of cells to a collagen-coated dish, the conventional medium was changed to DM supplemented with retinol and cultivated for further 5 days. The cells became attached to each other and formed large bud-like structures in the cytoplasm, which were increasingly observed with PAS staining as the incubation time elapsed (Fig. 4, C and E)
, whereas no PAS-positive structure was observed in cells grown on collagen-coated dishes in conventional medium for 2 days (Fig. 4A)
nor in DM in the absence of retinol (Fig. 4, B and D)
. These results indicate that HoxB3-transfected cells retain potency differentiating into Clara-like cells dependent on retinol.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 3. Schedule of differentiation experiment of M3E3/C3 cells. The M3E3/C3 cell, which was derived from fetal lung of hamster, was cultured as described in "Materials and Methods." After HoxB3-transfected cells were cultured in conventional medium for 1 day, cells were transferred to a collagen-coated dish and further cultured in CM for 2 days. Then the medium was changed to DM supplemented with retinol and incubated for 5 days. The retinol concentrations added are shown in the figure. The open triangles indicate the time point of sample collection.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 4. Differentiation of HoxB3-transfected M3E3/C3 cells in the presence of retinol. One day after transfection with HoxB3, M3E3/C3 cells were transferred to a collagen-coated dish and cultured in CM for 2 days, and the medium was changed to DM containing 12 µg/ml of retinol. PAS staining was used for detection of Clara-like cells that stained purplish red. A, B, and D, 3, 5, and 8 days in the absence of retinol, respectively. C and E, 5 and 8 days in the presence of 12 µg/ml of retinol, respectively. Spots of purplish red (arrows) were observed. Bar, 25 µm.
|
|
Expression of CCSP and SP-C Genes in HoxB3-transfected Cells under Differentiation Conditions.
The expression of CCSP and SP-C genes was determined by real-time RT-PCR to examine the effect of HoxB3 overexpression on gene transcription. The expression of the CCSP gene was increased by retinol in a concentration-dependent manner in control cells and augmented by HoxB3 overexpression (Fig. 5A)
. These increases were also in a time-dependent manner. The CCSP mRNA level was increased to 4.6-fold higher at 12 µg/ml of retinol after 5 days than that without retinol. After 8 days, the levels were further increased to 3.3-, 5.7- and 10.7-fold at 4, 8, and 12 µg/ml, respectively, over that without retinol (08 days). These increases are highly significant at the <1% level. In contrast, the gene expression of SP-C, alveolar type II cell marker protein, was decreased by retinol in concentration- and time-dependent manners (Fig. 5B)
. These results show that HoxB3 overexpression augmented the characteristics of the Clara cells at the transcription level.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5. Effects of retinol on gene expression of differentiation markers quantified by real-time RT-PCR in HoxB3-transfected cells. The expression of CCSP and SP-C genes was quantified by real-time RT-PCR using RNAs extracted from control and HoxB3-transfected cells. mock, empty vector; N, M3E3/C3 cells cultivated in conventional medium on tissue culture dish for 1 day; C, the cells cultivated in conventional medium on a collagen-coated dish for 2 days. After the medium was changed to DM containing retinol, the cells were collected 2 days (total, 5 days) and 5 days (total, 8 days) later, and RNA samples were prepared. 0, 4, 8, and 12, the retinol concentration (µg/ml) added. Each value of CCSP and SP-C mRNAs was normalized using that of GAPDH and shown as the mean (n = 3 or 4); bars, SD. The significant difference (*, P < 0.05) between control and HoxB3-overexpressed cells was observed. A, expression of the CCSP gene. B, expression of the SP-C gene.
|
|
Expression of CCSP and SP-C Genes in Cells Transfected with HoxB3 Antisense Expression Vector.
To examine the involvement of endogenous HoxB3 in CCSP gene expression in M3E3/C3 cells, they were transfected with HoxB3 antisense expression vector, and the expression of CCSP and SP-C genes was determined. The retinol-induced expression of CCSP was suppressed by 4049% of the control, whereas expression was little affected by transfection with the HoxB3 sense expression vector (Fig. 6)
. In contrast, the expression of the SP-C gene decreased by retinol was recovered to the level of that in the absence of retinol. The transfection of the HoxB3 sense expression vector did not affect the expression of the CCSP and SP-C genes. These results indicate that the transcription of the endogenous HoxB3 gene plays at least a part in the stimulatory role on the expression of the CCSP gene and a suppressive role on that of the SP-C gene.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 6. Expression of CCSP and SP-C genes in cells transfected with HoxB3 antisense nucleotide. M3E3/C3 cells were transfected with 1 µg of sense or antisense HoxB3 expression vector in 60-mm tissue culture dish (30% confluent) and cultured. The cultivation schedule was the same as in Fig. 3
. The cells were collected for 2 days (total, 5 days) and 5 days (total, 8 days) after cultivation under the differentiation condition and used for RNA extraction. The real-time RT-PCR was performed as described in "Materials and Methods." A, expression of CCSP. B, expression of SP-C. Each point represents the mean (n = 3); bars, SD. The significant difference (*, P < 0.05) between control and antisense-HoxB3 treated cells was observed.
|
|
Effects of Collagen on Expression of CCSP and SP-C Genes in M3E3/C3 Cells Cultivated in the Conventional Medium without Supplement of Retinol.
During the course of cultivation of M3E3/C3 cells in conventional medium, the expression of CCSP and SP-C genes was increased upon transfer from tissue culture dish to collagen-coated dish in both control and HoxB3-transfected cells (Fig. 5
, 3 days). The increase in CCSP mRNA level was remarkable in transfected cells and subsequently reduced by change of conventional medium to DM. To clarify the effect of collagen substrate, cells were cultivated in conventional medium for 1 day and transferred to tissue culture dish or a collagen-coated dish. After 2 days in conventional medium, the mRNA levels of CCSP and SP-C were 1.8- and 3.1-fold higher, respectively, on the collagen-coated dish than in the tissue culture dish in control cells (Fig. 7)
. In HoxB3-transfected cells, the expression of CCSP and SP-C genes was 41.3- and 5.0-fold higher, respectively, on the collagen-coated dish than in the tissue culture dish. The change of these gene expressions in mock cells was almost the same as that of control cells. These results indicate that cells on collagen substrate increased the expression of both CCSP and SP-C genes and that HoxB3 overexpression led to a direction of differentiation to Clara-like cells, even in conventional medium.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7. Effects of collagen gel on the expression of differentiation marker genes in control and HoxB3-transfected cells. Control (not transfected), mock, and HoxB3-transfected cells were cultivated in conventional medium for 1 day and transferred to a collagen-coated dish or tissue culture dish. They were cultivated for 2 days in conventional medium, and cells were collected to prepare RNA. The expression of CCSP, SP-C, and GAPDH was determined by real-time RT-PCR. The CCSP and SP-C mRNA levels were normalized using that of GAPDH and shown as the mean (n = 3 or 4); bars, SD. The significant difference between cells on a tissue culture dish and on a collagen-coated dish was observed at each sample (P < 0.05).
|
|
 |
Discussion
|
|---|
Hox proteins have been shown to control differentiation and pattern formation throughout embryogenesis (21)
. In the present study, we examined the role of HoxB3 on the differentiation into lung epithelial cells, Clara cells, using an in vitro model system and confirmed that the gene expression of CCSP was augmented by the overexpression of HoxB3 in the M3E3/C3 cell. This cell line has limited characteristics of epithelial cells and possesses some potency to differentiate at least into three types of lung cells such as Clara cells, alveolar type II cells, and pulmonary neuroendocrine cells, which are clearly distinguished from each other at morphological and immunohistochemical levels (17, 18, 19)
. Previously, we have shown that the CCSP mRNA level increases during differentiation of M3E3/C3 cells into Clara-like cells and that the expression of the gene for HNF3
is also up-regulated (16)
. On the basis of these results, we tried to clarify the upstream regulatory factor related to Clara cell differentiation (Fig. 8)
.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 8. Model for regulatory factors involved in Clara cell differentiation during lung development. The M3E3/C3 cell differentiates into at least three types of lung cells, Clara cells, alveolar type II cells, and pulmonary neuroendocrine cells. These cells may have originated from the endoderm or a lung bud. At the differentiation stages, numerous regulatory factors are involved. Among them, HoxB3 may be required for lung cellular differentiation, and TTF-1 is thought to be a target of HoxB3. It seems possible that Pbx-1 may interfere with actions of HoxB3 and of HoxB5. The HNF3 family regulates the CCSP and SP-C promoter and is involved in lung development.
|
|
Embryonic cells differentiate into limited characteristics of epithelial cells at an early stage and express complete characteristics of epithelial cells as they enter into terminal differentiation. It is conceivable that HoxB3 is involved in the lung differentiation process because the HoxB3 gene is expressed in embryonic lungs (20)
. Furthermore, in situ hybridization experiment revealed that the transcript of the HoxB3 gene existed in the lung bud-forming area (11)
, leading to the assumption that the HoxB3 gene is one of the early ones relevant to lung development. The overexpression of HoxB3 in M3E3/C3 cells resulted in stimulated differentiation toward Clara cells in cooperation with retinol. Furthermore, the differentiation into Clara cells was attenuated by the transfection with HoxB3 antisense expression vector, leading to the assumption that endogenous HoxB3 is physiologically active in M3E3/C3 cells. The HoxB3 protein in HoxB3-transfected cells decreased rapidly (Fig. 2A)
, whereas the transcript of the CCSP gene continued to increase (Fig. 5A)
. These phenomena suggest the involvement of HoxB3 in an early stage of Clara cell differentiation. The bud-like structures were detected with PAS staining in the cytoplasm of HoxB3-transfected cells in the presence of retinol (Fig. 4, C and E)
. The PAS-positive granules are observed in vivo specifically in Clara cells (22)
. Taken together, it seems probable that HoxB3 is involved in an early stage of differentiation into Clara cells as an upstream regulatory factor during lung development.
The expression of the CCSP gene was increased by the addition of retinol in a concentration-dependent manner in the process of differentiation of M3E3/C3 cells into Clara-like cells, which was confirmed morphologically (Figs. 4
and 5A
). When the HoxB3 gene was transiently overexpressed, the expression of the CCSP gene was increased by two to four times higher than that of HoxB3-untransfected cells (Fig. 5A)
. This induction was also dependent on the retinol concentration. On the contrary, the gene expression of SP-C was suppressed by HoxB3 overexpression (Fig. 5B)
. CCSP is a specific marker for bronchiolar epithelial Clara cells (5)
, and SP-C is a marker of alveolar type II epithelial cells (23)
, indicating that HoxB3 overexpression is more potent for M3E3/C3 cells to differentiate into Clara cells but not to alveolar type II cells in the presence of retinol. These results show that HoxB3 plays a complementary role in the development of a specific type of lung cells and/or determination of cell fate.
In the earlier phase (13 days) of the differentiation process of M3E3/C3 cells, HoxB3-transfected cells were transferred to collagen substrate and cultured in the conventional medium for 2 days in the absence of retinol (Fig. 3)
. The expression of CCSP and SP-C genes in control cells increased several folds (Fig. 5)
. The overexpression of HoxB3 augmented an enhanced expression of the CCSP gene and suppressed an increased expression of SP-C. These phenomena led to the assumption that contact with collagen substrate triggers differentiation, and that HoxB3 promotes determination to specific lung cell differentiation, similar to that reported in capillary morphogenesis (24)
. In endothelial cells, HoxD3, one of the genes paralogous to HoxB3, is required for expression of an integrin receptor contributing to cell adhesion, when cells were cultured on extracellular matrices and HoxB3 is proposed to function complementarily on an enhanced expression of integrin receptors. Some membrane receptors trigger the signal transduction upon contact with matrix and activate genes for transcription factors (25)
. When cells are transferred to collagen substrate, the expression of some Hox genes could be activated by extracellular matrix, as reported in Hoxa-1 and Hoxb-7 (26)
. It is therefore probable that overexpressed HoxB3 will work with other Hox proteins to promote Clara cell differentiation in the lung. The present study also showed that both CCSP and SP-C expression was down-regulated by HoxB3 overexpression in the tissue culture dish (Fig. 7)
. This reduction by HoxB3 may reflect dedifferentiation of the cells without collagen substrate.
Many of the positive or negative transcription regulators for genes of lung-specific molecules have been reported. For example, HNF3
and HNF3ß play opposite roles on the promoter of the CCSP gene in rabbits (27)
. The transcription of TTF-1 is regulated by HoxB3 (15)
and is detectable in HoxB3-transfected M3E3/C3 cells (data not shown). TTF-1 increases CCSP gene expression (28)
and SP (9)
. TTF-1 also activates SP-C expression in MLE-15 and HeLa cells (29
, 30)
; however, the expression of the SP-C gene has not been reported in Clara-derived cell lines. Although the transcript of the HNF3
gene was detected in the present model system and decreased in the absence of retinol (16)
, it seems reasonable to conclude that TTF-1 is one of the main regulatory factors, and HNF3
may act as a cofactor in M3E3/C3 cells during differentiation into Clara-like cells (Fig. 8)
. Further investigation will be needed about the molecular mechanisms that promote Clara cell differentiation.
Thirty-eight Hox proteins in mammals have been extensively investigated for their DNA-binding capabilities (31)
and cooperative effects (32)
, suggesting that one Hox protein could regulate transcription of genes for several or many downstream regulatory factors. Pbx-1, one of the Hox proteins, is shown to be a co-binding factor as a heterodimer with other Hox proteins through the consensus tetrapeptide region (33)
. HoxB3 and HoxB4 proteins act cooperatively as complexes with Pbx-1 that are expressed in the lung and bind to DNA through conserved hexapeptide and homeodomain regions (34)
and Pbx-1 (35)
, suggesting that HoxB3 may have a regulatory role on lung cell development.
The coding region of HoxB3 has 98% homology with the mouse coding region at the amino acid level; however, deletions of 3, 12, and 1 nucleotide long were found at positions of 448, 493, and 1273, respectively (Fig. 1)
. It appears probable that the first 3-bp deletion is caused by alternative splicing. Two 3'-CAG repeats were found in the hamster genome, judged from the intron sequence determined by genomic PCR (data not shown). Between the two 3'-CAG sequences, the spliceosome targeting the latter sequence resulted in mRNA three bases shorter in M3E3/C3 cells than that in mouse. The 12- and 1-bp deletions found at the 493 and 1273 positions were also confirmed. As a result, 16-bp nucleotides and 8 amino acids were deleted in HoxB3 of the M3E3/C3 cells, but the effect of these deletions on HoxB3 function is unclear.
The present study determined the sequences of nucleotide and deduced amino acid of the HoxB3 gene of fetal lung cells derived from hamster and showed that Clara-like cell differentiation was stimulated by HoxB3 overexpression in M3E3/C3 cells. The transfection with antisense HoxB3 expression vector suppressed this differentiation. It is possible that HoxB3 plays a regulatory role as an upstream regulatory factor to determine lung stem cells to Clara cells.
 |
Materials and Methods
|
|---|
Reagents used were of tissue culture grade from Wako Pure Chemical Industries, Ltd. (Osaka, Japan) or Nacalai Tesque, Inc. (Kyoto, Japan), except for those specified otherwise.
Cultivation of M3E3/C3 Cells.
The M3E3/C3 cell that was derived from fetal hamster lung was kindly donated by Dr. M. Emura (Medical School Hannover, Hannover, Germany). Cells were cultivated as described in the previous report (16)
, except for the use of a collagen-coated dish in place of a collagen gel matrix. In brief, they were cultured in the conventional medium at 2 x 104 cells/60-mm tissue culture dish for 1 day under 10% CO2/air at 37°C and then collected by treatment with 0.05% trypsin-EDTA and transferred to a 60-mm collagen-coated dish (collagen type I; Iwaki, Chiba, Japan), followed by cultivation in conventional medium for an additional 2 days. Three days after the onset of cultivation, the conventional medium was changed to the DM supplemented with all-trans retinol at the concentrations of 0, 4, 8, and 12 µg/ml. The medium was changed every 2 days. The cells cultivated for 1, 3, 5, and 8 days were collected for analyses. The cultivation conditions and schedule were shown in Fig. 3
.
RNA Extraction from M3E3/C3 Cells and Preparation of cDNA.
M3E3/C3 cells were collected by treatment with 0.25% trypsin-EDTA at the indicated time points. RNA was prepared from cell samples by using Isogen (Nippon Gene Co., Ltd., Toyama, Japan) and dissolved in diethylpyrocarbonate-treated water. One µg each of total RNA was reversely transcribed using poly(dT)1218 primer (Amersham Pharmacia Biotech, Uppsala, Sweden) with reverse transcriptase (ReverScript I; Wako Pure Chemical Industries, Ltd., Osaka, Japan) in the presence of RNase inhibitor (Takara Shuzo Co., Ltd., Shiga, Japan).
Detection of Hamster HoxB3.
PCR was performed (PTC-100TM Programmable Thermal Controller; MJ Research, Inc., Waltham, MA) using Taq polymerase (LA-Taq; Takara Shuzo Co.) to detect the transcript of HoxB3. The primer set used for HoxB3 was designed based on homology of HoxB3 in human, mouse, rat, and chicken. Because PCR amplification of full-length coding region was difficult because of the GC-rich region, the coding region was divided into three parts and combined (Fig. 1A)
. PCR conditions were at 94°C for 40 s, 68°C for 1 min, and 72°C for 1 min for the 5'-terminal region; at 94°C for 40 s, 68°C for 1 min, and 72°C for 1 min for the middle region; and at 94°C for 40 s, 63°C for 1 min, and 72°C for 1 min for the 3'-terminal region. Reaction was repeated twice at 30 cycles. The primer sets designed for hamster HoxB3 were as follows: 5'-CTCGCCCAGCGATGCAGAAAGC-3' (sense primer), 5'-CAGCTTGGACGTTTGCCTCGAC-3' (antisense primer); 5'-CGGATCCACTAGCAACAGCA(A/G)TAA(C/T)G-3' (sense primer), 5'-GGAATTCAGCGCGTAGGCATTCTGGTG-3' (antisense primer); and 5'-GACTAGTCCACGGCTGGCTTCATGAACG-3' (sense primer), 5'-TCCCATCACAGGTGTGTCAGTTTGG-3' (antisense primer) for three parts from the 5' to 3' regions.
Construction of Expression Vector of HoxB3 cDNA with FLAG at the 5'-Terminal End.
The 5' fragment was reamplified by PCR using sense primer 5'-CAAGCTTGGC-CACCATGGACTACAAAGACGATGACGACAAGCAGAAAG-CCACCTAC-3', which contained FLAG (CAAGCTTGGCCACCATGGACTACAAAGACGATGACGACAAGCA) sequence at the 5'-terminal end and antisense primer 5'-CAGCTTGGACGTTTGCCTCGAC-3' for 30 cycles (each consisting of denaturation at 94°C for 50 s, annealing at 60°C for 1 min, and extension at 72°C for 90 s). Amplified DNA fragments were electrophoresed on 3.5% polyacrylamide gel, extracted with Gilbert buffer followed by phenol/chloroform treatment, and subsequently dissolved in autoclaved Milli-Q water (Millipore, Co., Bedford, MA). The 5'-region fragment was linked to the second fragment by BsaMI (Promega Corp., Madison, WI) cutting, and the second fragment was linked to the third one using RsrII (New England Biolabs, Inc., Beverly, MA) cutting. They were inserted into the HindIII site of the pcDNA3.1(+) plasmid (Modifying Enzyme Ligation Pack; Nippon Gene Co., Ltd.), which was an expression vector with cytomegalovirus promoter (Invitrogen Co., San Diego, CA), and a closed-form plasmid was obtained using the Plasmid Midi kit (Qiagen Co., Chatsworth, CA).
Sequence Analysis of HoxB3 cDNA.
Nucleotide sequences were determined using ABI PRISM 377 and 310 Genetic Analyzer (PE-Applied Biosystems, Inc., Foster, CA). Hamster HoxB3 sequence (GenBank AB056577) was confirmed by several clones for each fragment. The cycle sequence reaction (96°C for 30 s, 50°C for 15 s, and 60°C for 4 min; 25 cycles) was performed with Big Dye Terminator RR Mix (PE-Applied Biosystems, Inc.).
Transient Transfection of the pcDNA3.1-FLAG-HoxB3 Coding Region.
One µg of the pcDNA3.1-FLAG-HoxB3 coding region was transiently transfected into M3E3/C3 cells at <30% confluency in a 35-mm dish using FuGENE 6 Transfection Reagent (Roche Diagnostics Co., Indianapolis, IN). Control cells received pcDNA3.1 plasmid.
Western Blotting Using FLAG Antibody.
The cells cultivated for 1, 3, and 8 days after transient transfection were homogenized in the sample buffer for SDS-PAGE, and aliquots (15 µg protein) were subjected to 7.5% PAGE (36)
. Protein content was determined using the BCA Protein Assay kit (Pierce Chemical, Rockford, IL). Western blotting was performed according to the method of Towbin et al. (37)
as follows. After electrophoresis, proteins were transferred to polyvinylidene difluoride membrane (Immobilon-P transfer membranes; Millipore Co., Bedford, MA) at 28 mA for 18 h. After transfer, the membrane was washed gently with Tris-buffered saline (TBS), blocked for 1 h in TBS containing 1% BSA and 0.1% Tween 20 (TTBS), and washed with TTBS for 15 min and then 5 min twice. The membrane was reacted with the first antibody, anti-FLAG (mouse) antibody (1:2000 dilution; Sigma Aldrich, Milwaukee, WI) in TTBS at room temperature for 1 h, washed with TTBS (15 min, and 5 min twice), and then reacted with the second antibody, antimouse IgG antibody (horseradish peroxidase-conjugate; 1:2000 dilution; Sigma Aldrich) in TTBS at room temperature for 1 h, followed by washing with TTBS (15 min, and 5 min five times). Color development of the membrane was performed using ECL Western blotting detection reagents (Amersham Pharmacia Biotech, Uppsala, Sweden) and exposed to X-ray film (type RX; Fuji Photo Film, Shizuoka, Japan).
Identification of HoxB3 Expression Using RT-PCR.
The HoxB3 mRNA was determined using HoxB3-transfected and control M3E3/C3 cells by PCR (94°C 40 s, 60°C 50 s, and 72°C 1 min; 2060 cycles). The primer set was 5'-GACTAGTCCACGGCTGGCTTCATGAACG-3' (sense primer), 5'-TCCCATCACAGGTGTGTCAGTTTGG-3' (antisense primer), which contained the stop codon of hamster HoxB3. The mRNA levels were normalized using mRNA of GAPDH. The primers for GAPDH were 5'-CTTCACCACCATGGAGAAGGC-3' (sense primer) and 5'-GGCATGGACTGTGGTCATGAG-3' (antisense primer). PCR products were electrophoresed on 2% agarose gels and stained with ethidium bromide. The content of each band was semiquantitatively estimated from gel images using densitograph analysis software (Atto Co., Tokyo, Japan).
Determination of CCSP and SP-C mRNAs in HoxB3-overexpressed and Control Cells under Differentiation Conditions.
The M3E3/C3 cells that were transiently transfected with the HoxB3 coding region were cultured as shown in Fig. 3
. RNA was extracted from cells collected at the indicated time points, and mRNAs of CCSP, SP-C, and GAPDH were determined by real-time RT-PCR (ABI PRISM 7700 Sequence Detection System; PE-Applied Biosystems, Inc.). The primers for CCSP were 5'-TTCAAGTCCTTGAGTTCCTC-3' (sense primer), 5'-TGATGTTCATTCTGGTCTTCTG-3' (antisense primer), and 5'-CAACCCTGGCTCAGACCTGCAAGATT-3' (real-time RT-PCR probe). The primers for SP-C were 5'-TGAGTCAGAAACATACCGAGATGG-3' (sense primer), 5'-GCTCTCTGGAGCCATCTTCATG-3' (antisense primer), and 5'-AGTGAACACATGGACACCATCGCTACCTTC-3' (real-time RT-PCR probe). The primer for GAPDH was 5'-CCTGGCCAAGGTCATCCATGACAACTTT-3' (real-time RT-PCR probe).
Vector Construction and Transfection of Antisense HoxB3.
Antisense and sense RNA expression vectors were designed for hamster HoxB3 (GenBank AB056577). The primers designed for antisense and sense HoxB3 were as follows: 5'-TACAAGCTTCAGAAAGCCACC-3' (sense primer) and 5'-AGCAAGCTTTTCAGCTTGGAC-3' (antisense primer). PCR conditions were at 98°C for 15 s and at 64°C for 2 s, at 74°C for 40 s at 35 cycles, using Taq polymerase (Kod DNA Polymerase; Toyobo Co., Osaka, Japan). Fragment was restrictively cut by HindIII and cloned into pcDNA3.1(+). The inserted direction was confirmed by sequencing.
One µg each of antisense HoxB3 or sense HoxB3 plasmid was transfected to M3E3/C3 cells in 60-mm tissue culture dishes (4 x 105 cells). Cultivation schedule was the same as in Fig. 3
. Cells were collected after 2 days (total, 5 days) and 5 days (total, 8 days) under the differentiation condition. Transfection and real-time RT-PCR were performed as mentioned above.
Cellular Staining.
Cells were washed twice with Ca/Mg-free PBS, fixed with 4% paraformaldehyde for 10 min, and permeabilized by 0.2% Triton X-100 in PBS for 2 min. They were washed with PBS, followed by sterilized water three times and subsequently subjected to PAS staining. Photographs were taken with a type B202 microscope (Olympus Optical Co., Tokyo, Japan).
Statistical Analysis.
Analyses of significant difference between HoxB3-overexpressed and control cells were performed using Students t test after one-way ANOVA.
 |
Acknowledgments
|
|---|
We thank Drs. Y. Takahashi and S. Takahashi of the Laboratory of Environmental Molecular Physiology, School of Life Science, Tokyo University of Pharmacy and Life Science for advice and Goh Hattori for construction of antisense expression vector. We greatly appreciate Dr. M. Emura (Medical School Hannover, Hannover, Germany) for kindly providing the M3E3/C3 cells.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 To whom requests for reprints should be addressed, at School of Life Science, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392, Japan. Phone: 81-426-76-5053; Fax: 81-426-76-6811; E-mail: yocchan{at}ls.toyaku.ac.jp 
2 The abbreviations used are: SP, surfactant protein; CCSP, Clara cell-specific secretory protein; TTF, thyroid transcription factor; HNF, hepatocyte nuclear factor; Hox, homeobox; RT-PCR, reverse transcription-PCR; DM, differentiation medium; PAS, periodic acid Schiff; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. 
Received for publication 6/15/01.
Revision received 2/19/02.
Accepted for publication 2/20/02.
 |
References
|
|---|
-
Evans M. J., Johnson L. V., Stephens R. J., Freeman G. Renewal in the terminal bronchiolar epithelium in the rat following exposure to NO2 and O3. Lab. Investig., 35: 246-257, 1976.[Medline]
-
Crapo J. D., Barry B. E., Chang L. Y., Mercer R. R. Alteration in lung structure caused by inhalation of oxidants. J. Toxicol. Environ. Health, 13: 301-321, 1984.[Medline]
-
Takahashi Y., Miura T. Response of cytochrome P-450 isozymes of rat lung to in vitro exposure to ozone. Toxicol. Lett., 54: 327-335, 1990.[Medline]
-
Reynolds S. D., Hong K. U., Giangreco A., Mango G. W., Guron C., Morimoto Y., Stripp B. R. Conditional Clara cell ablation reveals a self-renewing progenitor function of pulmonary neuroendocrine cells. Am. J. Physiol. Lung Cell Mol. Physiol., 278: L1256-L1263, 2000.[Abstract/Free Full Text]
-
Khoor A., Gray M. E., Singh G., Stahlman M. T. Ontogeny of Clara cell-specific protein and its mRNA: their association with neuroepithelial bodies in human fetal lung and in bronchopulmonary dysplasia. J. Histochem. Cytochem., 44: 1429-1438, 1996.[Abstract]
-
Stahlman M. T., Gray M. E., Whitsett J. A. Expression of thyroid transcription factor-1 (TTF-1) in fetal and neonatal human lung. J. Histochem. Cytochem., 44: 673-678, 1996.[Abstract]
-
Zhou L., Lim L., Costa R. H., Whitsett J. A. Thyroid transcription factor-1, hepatocyte nuclear factor-3ß, surfactant protein B, C, and Clara cell secretory protein in developing mouse lung. J. Histochem. Cytochem., 44: 1183-1193, 1996.[Abstract]
-
Bingle C. D., Hackett B. P., Moxley M., Longmore W., Gitlin J. D. Role of hepatocyte nuclear factor-3
and hepatocyte nuclear factor-3ß in Clara cell secretory protein gene expression in the bronchiolar epithelium. Biochem. J., 308: 197-202, 1995.
-
Bohinski R. J., Di Lauro R., Whitsett J. A. The lung-specific surfactant protein B gene promoter is a target for thyroid transcription factor 1 and hepatocyte nuclear factor 3, indicating common factors for organ-specific gene expression along the foregut axis. Mol. Cell. Biol., 14: 5671-5681, 1994.[Abstract/Free Full Text]
-
Sawaya P. L., Stripp B. R., Whitsett J. A., Luse D. S. The lung-specific CC10 gene is regulated by transcription factors from the AP-1, octamer, and hepatocyte nuclear factor 3 families. Mol. Cell. Biol., 13: 3860-3871, 1993.[Abstract/Free Full Text]
-
Bogue C. W., Lou L. J., Vasavada H., Wilson C. M., Jacobs H. C. Expression of Hoxb genes in the developing mouse foregut and lung. Am. J. Respir. Cell Mol. Biol., 15: 163-171, 1996.[Abstract]
-
Packer A. I., Mailutha K. G., Ambrozewicz L. A., Wolgemuth D. J. Regulation of the Hoxa4 and Hoxa5 genes in the embryonic mouse lung by retinoic acid and TGFß1: implications for lung development and patterning. Dev. Dyn., 217: 62-74, 2000.[Medline]
-
Volpe M. V., Martin A., Vosatka R. J., Mazzoni C. L., Nielsen H. C. Hoxb-5 expression in the developing mouse lung suggests a role in branching morphogenesis and epithelial cell fate. Histochem. Cell. Biol., 108: 495-504, 1997.[Medline]
-
Volpe M. V., Vosatka R. J., Nielsen H. C. Hoxb-5 control of early airway formation during branching morphogenesis in the developing mouse lung. Biochim. Biophys. Acta, 1475: 337-345, 2000.[Medline]
-
Guazzi S., Lonigro R., Pintonello L., Boncinelli E., Di Lauro R., Mavilio F. The thyroid transcription factor-1 gene is a candidate target for regulation by Hox proteins. EMBO J., 13: 3339-3347, 1994.[Medline]
-
Yoshimi T., Takahashi Y., Takahashi S., Miura T. Changes in lung-specific molecular expression during differentiation of hamster embryonic M3E3/C3 cell line. Biochem. Cell Biol., 78: 659-666, 2000.[Medline]
-
Emura M., Mohr U., Riebe M., Aufderheide M., Dungworth D. L. Regulation of growth and differentiation by vitamin A in a cloned fetal lung epithelial cell line cultured on collagen gel in hormone-supplemented medium. In Vitro Cell Dev. Biol., 24: 639-648, 1988.[Medline]
-
Emura M., Ochiai A., Gobert-Bohlen A., Panning B., Dungworth D. L. Neuroendocrine phenotype differentiation in a hamster lung epithelial cell line under low oxygen pressure or after transformation by diethylnitrosamine. Toxicol. Lett., 72: 59-64, 1994.[Medline]
-
Germann P. G., Ueberschar S., Gerull A., Emura M. In vitro induction of type II pneumocyte-related differentiation in a clonal fetal bronchiolo-alveolar epithelial cell line (M3E3/C3). Exp. Toxicol. Pathol., 45: 315-324, 1993.[Medline]
-
Sham M. H., Hunt P., Nonchev S., Papalopulu N., Graham A., Boncinelli E., Krumlauf R. Analysis of the murine Hox-2.7 gene: conserved alternative transcripts with differential distributions in the nervous system and the potential for shared regulatory regions. EMBO J., 11: 1825-1836, 1992.[Medline]
-
Krumlauf R. Hox genes in vertebrate development. Cell, 78: 191-201, 1994.[Medline]
-
Plopper C. G., St. George J. A., Nishio S. J., Etchison J. R., Nettesheim P. Carbohydrate cytochemistry of tracheobronchial airway epithelium of the rabbit. J. Histochem. Cytochem., 32: 209-218, 1984.[Abstract]
-
Weaver T. E. Synthesis, processing and secretion of surfactant proteins B and C. Biochim. Biophys. Acta, 1408: 173-179, 1998.[Medline]
-
Myers C., Charboneau A., Boudreau N. J. Homeobox B3 promotes capillary morphogenesis and angiogenesis. J. Cell Biol., 148: 343-351, 2000.[Abstract/Free Full Text]
-
Mahlapuu M., Ormestad M., Enerback S., Carlsson P. The forkhead transcription factor Foxf1 is required for differentiation of extra-embryonic and lateral plate. Development (Camb.), 128: 155-166, 2001.[Abstract]
-
Srebrow A., Friedmann Y., Ravanpay A., Daniel C. W., Bissell M. J. Expression of Hoxa-1 and Hoxb-7 is regulated by extracellular matrix-dependent signals in mammary epithelial cells. J. Cell. Biochem., 69: 377-391, 1998.[Medline]
-
Sawaya P. L., Luse D. S. Two members of the HNF-3 family have opposite effects on a lung transcriptional element: HNF-3
stimulates and HNF-3ß inhibits activity of region I from the Clara cell secretory protein (CCSP) promoter. J. Biol. Chem., 269: 22211-22216, 1994.[Abstract/Free Full Text]
-
Ray M. K., Chen C-Y., Schwartz R. J., Demayo F. J. Transcriptional Regulation of a mouse Clara cell-specific protein (mCC10) gene by the Nkx transcription factor family members thyroid transcription factor 1 and cardiac muscle-specific homeobox protein (CSX). Mol. Cell. Biol., 16: 2056-2064, 1996.[Abstract/Free Full Text]
-
Kelly S. E., Bachurski C. J., Burhans M. S., Glasser S. W. Transcription of the lung-specific surfactant protein C gene is mediated by thyroid transcription factor 1. J. Biol. Chem., 271: 6881-6888, 1996.[Abstract/Free Full Text]
-
Glasser S. W., Burhans M. S., Eszterhas S. K., Bruno M. D., Korfhagen T. R. Human SP-C gene sequences that confer lung epithelium-specific expression in transgenic mice. Am. J. Physiol. Lung Cell Mol. Physiol., 278: 933-945, 2000.
-
Vigano M. A., Di Rocco G., Zappavigna V., Mavilio F. Definition of the transcriptional activation domains of three human HOX proteins depends on the DNA-binding context. Mol. Cell. Biol., 18: 6201-6212, 1998.[Abstract/Free Full Text]
-
Barrow J. R., Capecchi M. R. Targeted disruption of the Hoxb-2 locus in mice interferes with expression of Hoxb-1 and Hoxb-4. Development (Camb.), 122: 3817-3828, 1996.[Abstract]
-
Knoepfler P. S., Lu Q., Kamps M. P. Pbx-1 Hox heterodimers bind DNA on inseparable half-sites that permit intrinsic DNA binding specificity of the Hox partner at nucleotides 3' to a TAAT motif. Nucleic Acids Res., 24: 2288-2294, 1996.[Abstract/Free Full Text]
-
Krosl J., Baban S., Krosl G., Rozenfeld S., Largman C., Sauvageau G. Cellular proliferation and transformation induced by HOXB4 and HOXB3 proteins involves cooperation with PBX1. Oncogene, 16: 3403-3412, 1998.[Medline]
-
Schnabel C. A., Selleri L., Jacobs Y., Warnke R., Cleary M. L. Expression of Pbx1b during mammalian organogenesis. Mech. Dev., 100: 131-135, 2001.[Medline]
-
Laemmli U. Cleavage of structural proteins during the assembly of the head of bacteriophage. Nature (Lond.), 227: 680-685, 1970.[Medline]
-
Towbin H., Staehelin T., Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Biotechnology, 24: 145-149, 1979.