CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Flory, M. R.
Right arrow Articles by Davis, T. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Flory, M. R.
Right arrow Articles by Davis, T. N.
Cell Growth & Differentiation Vol. 13, 47-58, February 2002
© 2002 American Association for Cancer Research

Pcp1p, an Spc110p-related Calmodulin Target at the Centrosome of the Fission Yeast Schizosaccharomyces pombe1

Mark R. Flory, Mary Morphew, James D. Joseph, Anthony R. Means and Trisha N. Davis2

Molecular and Cellular Biology Program [M. R. F., T. N. D.] and Department of Biochemistry [T. N. D.], University of Washington, Seattle, Washington 98195; Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, Colorado 80309 [M. M.]; and Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina 27710 [J. D. J., A. R. M.]


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
In the budding yeast Saccharomyces cerevisiae, the calmodulin-binding protein Spc110p/Nuf1p facilitates mitotic spindle formation from the fungal centrosome or spindle pole body (SPB). The human Spc110p orthologue kendrin is a centrosomal, calmodulin-binding pericentrin isoform that is specifically overexpressed in carcinoma cells. Here we establish an evolutionary and functional link between Spc110p and kendrin through identification and analysis of similar calmodulin-binding proteins in the fission yeast Schizosaccharomyces pombe (Pcp1p, pole target of calmodulin in S. pombe) and the filamentous fungus Aspergillus nidulans. Like Spc110p and kendrin, Pcp1p and the A. nidulans protein contain predicted coiled-coil secondary structure and a COOH-terminal calmodulin-binding region. Green fluorescent protein fusions of Pcp1p localize to the SPB as analyzed by fluorescence and immunoelectron microscopy. Pcp1p overexpression causes chromosome missegregation, multiple mitotic spindle fragments, and multiple abnormal SPB-like structures, a phenotype remarkably similar to that of many human carcinoma lines, which exhibit chromosome and spindle defects, and supernumerary centrosomes.


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Fidelity of chromosome segregation during eukaryotic cell division depends on the integrity of the mitotic spindle apparatus. The centrosome is the principal MTOC in the cell and initiates formation of the microtubule fibers composing the mitotic spindle (1) . Attention has focused on understanding mechanisms underlying centrosomal function, given the importance of this organelle in regulating microtubule nucleation and the observation that centrosomal abnormalities correlate with cancerous growth. Many carcinoma cell lines and tissues contain supernumerary centrosomal structures and centrosomes of aberrant morphology, but whether centrosomal defects have a direct role in causing genomic instability has yet to be determined (2, 3, 4, 5) . In normal vertebrate cells, the centrosome is composed of two cylindrical centrioles surrounded by a fibrous layer of pericentriolar material from which microtubules emanate. Identification of the molecular subunits of the centrosome has been hampered by the extremely low abundance of centrosomal proteins (6) .

The combination of genetic manipulation and completion of the sequence of the Saccharomyces cerevisiae genome database has facilitated a more complete description of the fungal centrosome, the SPB.3 The budding yeast SPB is a laminar structure composed of three disc-shaped plaques that are embedded in the ne through the entire cell cycle (7, 8, 9) . Cytoplasmic microtubules are nucleated by the outer plaque, whereas nuclear spindle microtubules emanate from the inner plaque (10) . In the divergent yeast Schizosaccharomyces pombe, which divides by medial fission, the SPB is more dynamic, undergoing cell cycle related changes in localization (11) . During interphase, the fission yeast SPB localizes to the cytoplasm on the periphery of the ne. After SPB duplication and as cells enter mitosis, a small hole or "fenestrae" opens in the ne, into which the duplicated, side-by-side SPBs insert. The SPBs initiate microtubule nucleation and subsequently move apart within the ne as mitotic spindle formation proceeds. At the completion of mitosis, the SPBs move back into the cytoplasm just outside the ne. Cut11p, a component of both the fission yeast SPB and nuclear pore complex, anchors the mitotic SPB to the ne (12) .

Despite the differences in morphology between the vertebrate centrosome and the fungal SPB, recent work has revealed that these organelles share many common molecular components. Calmodulin is found in both the vertebrate centrosome (13, 14, 15) and fungal SPBs (16 , 17) , as is the small {gamma}-tubulin complex at the minus end of microtubules (18, 19, 20, 21, 22) . In vertebrate cells, recruitment and attachment of the vertebrate {gamma}-tubulin complex to the centrosome appears essential for microtubule nucleation (23 , 24) . Thus, attention has been focused on identifying the proteins that anchor the {gamma}-tubulin complex to the centrosome.

In budding yeast, the coiled-coil protein Spc110p facilitates mitotic spindle assembly by anchoring the {gamma}-tubulin complex to the inner plaque of the SPB. The NH2-terminal region of Spc110p binds directly to the {gamma}-tubulin complex (25 , 26) . The Spc110p COOH-terminal region binds to the core or central plaque of the SPB, and this association is dependent on calmodulin binding to the Spc110p COOH-terminal calmodulin-binding site (27, 28, 29) . Given the importance of Spc110p at the budding yeast SPB, we searched for Spc110p-related proteins in other organisms. Aided by sequence data from a calmodulin-binding cDNA expression clone isolated from the filamentous fungus Aspergillus nidulans (30) , we identified calmodulin-binding SPB/centrosome components in the fission yeast S. pombe, mouse and human (31) . Like Spc110p, these related proteins contain predicted coiled-coil secondary structure and a COOH-terminal calmodulin-binding domain. We demonstrated previously that the human Spc110p-related protein, kendrin, shares sequence homology with the murine centrosome component pericentrin and also contains a unique COOH-terminal calmodulin-binding domain not found in murine pericentrin. Kendrin localizes to human centrosomes in human diploid fibroblasts. Kendrin is overexpressed in a subset of carcinoma cell lines (31) . However, the relationship between this overexpression and the centrosomal defects and genomic instability exhibited by many carcinoma lines has not been established.

Here we report the cloning and characterization of a Spc110p homologue from the genetically tractable fission yeast S. pombe. Localization of the S. pombe homologue (pcp1+, pole target of calmodulin in S. pombe) suggests a SPB assembly mechanism for Pcp1p distinct from that described for budding yeast Spc110p (9) . Overexpression of Pcp1p in fission yeast cells produces multiple, abnormal, SPB-like structures similar to the supernumerary centrosomes known to occur in many carcinoma lines. Pcp1p overexpression also causes a chromosome missegregation phenotype reminiscent of the genomic instability exhibited by carcinoma cells. Our data indicate fundamental roles for Pcp1p in both SPB assembly and microtubule nucleation.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Identification of S. cerevisiae Spc110p Homologues in the Filamentous Fungus A. nidulans and the Fission Yeast S. pombe.
An expression cloning strategy was used to identify novel calmodulin-binding proteins in A. nidulans (30) . Positive phage plaques contained cDNA inserts (GenBank accession no. AF365926 for nucleotide sequence) that encoded a protein fragment predicted to contain a large coiled-coil domain followed by the putative calmodulin-binding region. The similarity of this predicted protein structure with that of Spc110p indicated a possible relationship between the two proteins (Fig. 1)Citation . Therefore, we used the A. nidulans partial cDNA sequence to identify Spc110p-related proteins in S. pombe and found a single high-scoring match on cosmid c6G9 from S. pombe Chromosome I in the S. pombe genome database (Pairwise BLASTP expect score 6e-25, 20% amino acid identity, 40% amino acid similarity; Fig. 1Citation ). This sequence mapped to an ORF predicted to encode a protein of Mr 140,000 with a long central coiled-coil domain spanning residues 149-1085, with small gaps of predicted noncoiled sequence at 804–872, 904–916, and 1022–1029. This gene was subsequently named pcp1+ for pole target of calmodulin in S. pombe.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1. Alignment of the COOH-terminal region amino acid sequences from S. pombe Pcp1p, S. cerevisiae Spc110p, and the A. nidulans protein (here labeled An110p). Identical residues are boxed and shaded in dark gray, and conservative amino acid replacements are shaded in light gray. Predicted calmodulin-binding sites in the three COOH-terminal regions include residues 765–781 (residue numbering specific to this alignment and not to entire proteins). The second block of homology upstream of the calmodulin-binding site is region 692–726. Residue 1 in the alignment is residue 412 in Pcp1p, residue 147 in Spc110p, and residue 1 of the protein predicted from the A. nidulans partial cDNA.

 
The protein sequences of Pcp1p and the S. cerevisiae SPB component Spc110p are predicted to contain similar overall structures, including a long central coiled-coil domain flanked by noncoiled ends. Furthermore, the COOH-terminal regions of Spc110p, Pcp1p, and the A. nidulans protein contain two blocks of higher homology (Fig. 1)Citation . One corresponds to the previously identified calmodulin-binding site in Spc110p (31) . The other is a region upstream of the calmodulin-binding site, which is also found in human kendrin (Ref. 32 ; see "Discussion").

The ability of the predicted calmodulin-binding sites of Pcp1p and the A. nidulans protein to bind calmodulin was determined by a calmodulin overlay. For these assays, we used COOH-terminal fragments, rather than full-length target proteins, given that these fragments, which are readily expressed in bacterial hosts, contain the small {alpha}-helical target sequence we predicted by sequence analysis to be sufficient for calmodulin binding. As shown in Fig. 2ACitation , a fusion between GST and the COOH-terminal region of Pcp1p directly binds purified protein A-tagged fission yeast calmodulin (Protein A-Cam1p). In addition to the full-length GST-fusion protein, two smaller bands that retain the calmodulin-binding site, which we assume to be degradation products, are also present. A GST fusion to a truncated version of the Pcp1p COOH-terminal region that lacks the predicted calmodulin-binding site does not bind Protein A-Cam1p, nor does GST alone, although these two proteins are overproduced (Fig. 2A)Citation . Protein A alone did not produce a signal in control blots run in parallel (data not shown). Similarly, a hexahistidine-tagged A. nidulans COOH-terminal fragment bound purified protein A-tagged A. nidulans calmodulin (Fig. 2B)Citation . A truncated A. nidulans COOH-terminal fragment lacking the predicted calmodulin-binding site does not bind calmodulin (Fig. 2B)Citation .



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 2. The predicted calmodulin-binding sites in the COOH-terminal regions of Pcp1p and the A. nidulans protein physically bind calmodulin as shown by calmodulin overlay blotting and truncation analysis. A (left), Coomassie blue-stained acrylamide gel of protein extracts from E. coli cells expressing either fusions of GST to indicated residues of Pcp1p or GST alone. A (right), Calmodulin overlay blotting showing specific binding of protein A-tagged S. pombe calmodulin to the GST-Pcp1p (960–1208) fusion protein that contains the predicted calmodulin-binding site (arrows). A fusion between GST and Pcp1p residues 960-1141, which do not include the predicted calmodulin-binding site, does not bind calmodulin. B (left), Coomassie blue-stained polyacrylamide gel of purified hexahistidine-tagged COOH-terminal A. nidulans protein fragment. B (right), Calmodulin overlay blotting showing specific binding of protein A-conjugated A. nidulans calmodulin to the COOH-terminal fragment of the A. nidulans protein. Arrows, the position of the full-length protein that binds calmodulin. A purified hexahistidine-tagged COOH-terminal truncation of the A. nidulans protein that lacks the predicted calmodulin-binding site does not bind calmodulin.

 
S. pombe pcp1+ Is an Essential Gene.
To determine whether pcp1+ is essential for growth, we created a diploid S. pombe strain hemizygous for pcp1+, in which one copy of the pcp1+ ORF was precisely replaced with the nutritional marker ura4+ by PCR-mediated gene deletion (see "Materials and Methods"). Deletion of pcp1+ in this strain was confirmed by PCR and Southern blot analyses. The hemizygous diploid strain was sporulated, and the resultant spores were germinated on rich medium. Notably, visual inspection of meiotic asci by light microscopy indicated that sporulation was disrupted, including the formation of two- and three-spore tetrads and ascus cases of abnormal morphology (data not shown). This reduction in sporulation efficiency precluded dissection of tetrads to examine the termination phenotype. However, of 170 resultant colonies generated by random spore germination, 169 (99.4%) were unable to grow on medium lacking uracil, indicating that spores carrying the ura4+ nutritional marker were unable to undertake vegetative growth. These data indicate that pcp1+ is an essential gene.

Pcp1p Localizes Specifically to Fission Yeast SPBs throughout the Cell Cycle.
We examined the subcellular localization of Pcp1p throughout the cell cycle of S. pombe using fusions of Pcp1p and GFP. GFP was integrated at the 3' end of the pcp1+ ORF using PCR-mediated gene tagging (33) , resulting in strain MFP5 containing a single-copy GFP-tagged pcp1+ allele under the control of the endogenous pcp1+ promoter. We used similar methods to construct a strain MFP6 carrying a single-copy, integrated pcp1+ allele in which GFP is fused to the 5' end of the pcp1+ ORF, and expression is controlled by the attenuated nmt1 promoter (33) . These two strains demonstrate indistinguishable localization patterns by fluorescence microscopy and show no growth defects. In live fission yeast cells, the pattern of punctate fluorescence matched exactly that described for fission yeast SPBs (Refs. 17 and 34 ; Fig. 3Citation ). Interphase cells of smaller size demonstrated one dot of fluorescence at the nuclear periphery (Fig. 3, A and B)Citation . Cells entering mitosis contained a single bright dot of fluorescence that divided into two dots (Fig. 3, C and D)Citation , which subsequently migrated toward the ends of the cell along an axis roughly parallel to that of the cell body (Fig. 3, E and F)Citation . Dots approached the ends of the cell, and cytokinesis subsequently resulted in two daughter cells, each containing one dot of fluorescence (Fig. 3, G and H)Citation .



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 3. Localization of Pcp1p-GFP to the SPB of S. pombe. In A–H, an equal volume of a culture of strain MFP5 (GFP:pcp1+) grown to logarithmic phase in supplemented liquid YE medium at 30° was mixed with supplemented minimal medium containing 1% low-melting-temperature agarose on a microscope slide and visualized by fluorescence microscopy (A, C, E, and G) or phase contrast (B, D, F, and H). These images show different cells at different stages of the cell cycle from an asynchronous MFP5 culture. In I–N, Pcp1p colocalizes with Sad1p, a known component of the S. pombe SPB, but not the two cytoplasmic MTOCs that appear near the cell equator at the end of mitosis. MFP5 cultured as above was prepared for immunofluorescence according to the formaldehyde procedure and stained with antibody to Sad1p or {gamma}-tubulin as described in "Materials and Methods." The fluorescent signals in panels M and N were imaged using deconvolution fluorescence microscopy as described in "Materials and Methods." In O–T, Pcp1p localization SPBs is not dependent on microtubules. MFP10 cultured as above was prepared for immunofluorescence according to the formaldehyde procedure described in "Materials and Methods," except that for panels R–T, cells were incubated on ice for 30 min before fixation to depolymerize microtubules. Cells were stained with antibodies to {alpha}-tubulin and DAPI. Unless otherwise noted, cells were imaged by standard fluorescence microscopy as described in "Materials and Methods." Bars, 5 µm.

 
In all cells examined, Pcp1p-GFP colocalized with Sad1p, a recognized component of the fission yeast SPB (Ref. 35 ; Fig. 3, I–LCitation ). Fortuitously, our formaldehyde and combined aldehyde fixation procedures required for immunofluorescence (see "Materials and Methods") preserved Pcp1p:GFP fluorescence and localization, greatly facilitating colocalization experiments with antibody probes. We also compared the localization of Pcp1p-GFP with {gamma}-tubulin, a component of both fission yeast SPBs and the two cytoplasmic MTOCs that appear near the septum after mitosis (34 , 36) . Cells in interphase or early mitosis demonstrated colocalization of {gamma}-tubulin with Pcp1p at the SPBs (data not shown). In cells exiting mitosis, cytoplasmic MTOCs are evident, but Pcp1p never localized to these structures (Fig. 3, M versus N)Citation .

As an additional confirmation of localization to the SPB, Pcp1p COOH-terminally tagged with 13XMyc localizes to the ends of the mitotic spindle. In interphase cells, a single dot of Myc staining was observed in a pattern matching that seen with the GFP fusions (data not shown). In mitotic cells, two dots of Myc staining always flanked the ends of the linear mitotic spindle (Fig. 3, O–Q)Citation .

Pcp1p Associates with the SPB Both Before and After Mitotic Insertion of the SPB into the ne.
The localization of Pcp1p-GFP to the SPB was further examined by immunoelectron microscopy. Pcp1p-GFP was detected throughout the SPB in interphase cells, which contain a cytoplasmic SPB near the nuclear periphery (Fig. 4A)Citation . Background staining was very low, suggesting a high specificity of antibody binding. Pcp1p-GFP was also detected in SPBs in the process of duplication but before insertion into the ne (Fig. 4B)Citation and on mitotic SPBs inserted into the ne and associated with the ends of the mitotic spindle (Fig. 4, C and D)Citation .



View larger version (110K):
[in this window]
[in a new window]
 
Fig. 4. Pcp1p-GFP localizes to the interphase and mitotic SPBs by immunoelectron microscopy. Strain MFP5 (pcp1+:GFP) was grown to logarithmic phase at 32° and prepared for immunoelectron microscopy with primary antibodies against GFP and with gold-labeled secondary antibodies as described in "Materials and Methods." A, cross-section through an interphase nucleus showing gold particles on the spb in the cytoplasm near the ne. In B, duplicated side-by-side spbs both contain gold particles before insertion into the ne. C and D, cross-sections through mitotic nuclei showing gold particles on the spb that is associated with spindle microtubules (mts).

 
Overexpression of GFP-Pcp1p Results in the Formation of Ectopic SPB-like Structures, Defects in Mitotic Spindle Architecture, and Missegregation of DNA.
We examined the effects of moderate, constitutive overexpression of GFP-Pcp1p on spindle formation and DNA segregation. The strain MFP19 contains a single-copy GFP-tagged pcp1+ allele under the control of the wild-type nmt1 promoter. When cultured in the presence of excess thiamine, which partially represses expression from the nmt1 promoter, strain MFP19 overexpresses GFP-Pcp1p >=5-fold. Because MFP19 exhibits wild-type viability during initial passage on yeast extract agar medium but produces colonies of heterogeneous size after restreaking, all experiments with strain MFP19 were done with colonies freshly struck from a freezer stock. Under these conditions, MFP19 cells often contained more than two dots of GFP fluorescence (43 of 232, 19%; Fig. 5, A, D, G, and JCitation ; see also Fig. 8, E, I, M, and QCitation ). The number of foci per cell ranged from one to eight. These foci were observed in both mitotic and interphase cells. Many of the extra structures contained another SPB component: Sad1p (Fig. 5, B and E)Citation . Some of the extra structures also colocalized with {gamma}-tubulin (Fig. 5, H and K)Citation . A significant number of cells containing more than two GFP-Pcp1p foci demonstrated severe defects in DNA segregation, as indicated by DAPI staining (25 of 55, 46%). These defects included hypercondensation of chromosomes (Fig. 5F)Citation , misplacement of DNA (Fig. 5L)Citation , and fragmentation of the chromosomal mass into three or more DAPI-staining masses (see below). Immunoelectron microscopy also revealed extra cytoplasmic structures containing GFP-Pcp1p (Fig. 6, A and B)Citation . These structures were often located near the SPB (Fig. 6C)Citation .



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 5. Overexpression of GFP-Pcp1p results in formation of multiple structures containing Sad1p and {gamma}-tubulin. Strain MFP19 (nmt1-GFP:pcp1+) was grown to logarithmic phase in supplemented liquid YE medium at 30° and prepared for immunofluorescence microscopy according to the formaldehyde procedure and stained with antibodies to Sad1p or antibodies to {gamma}-tubulin and DAPI as described in "Materials and Methods." All cells in this figure were imaged using deconvolution fluorescence microscopy as described in "Materials and Methods." A–F, colocalization of a subset of multiple GFP-Pcp1p foci with the SPB component Sad1p. G–L, colocalization of a subset of multiple GFP-Pcp1p foci with {gamma}-tubulin. F and L, hypercondensed and missegregated chromosomes. Bar, 5 µm.

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 8. GFP-Pcp1p, tubulin, and DNA morphologies in five representative cells overexpressing GFP-Pcp1p. A fresh isolate of strain MFP19 (nmt1-GFP:pcp1+) from a -80° glycerol stock was grown to logarithmic phase in supplemented liquid YE medium at 30° and prepared for immunofluorescence microscopy according to the combined aldehyde procedure described in "Materials and Methods." Fluorescent signals were imaged using deconvolution microscopy as described in "Materials and Methods." A–D, cell containing GFP-Pcp1p foci of unequal intensity associated with a poorly formed spindle and hypercondensed chromosomes. E–H and I–L, two cells, respectively, each containing two clusters of GFP-Pcp1p foci associated with tubulin and chromosomal material. M–P, cell containing three GFP-Pcp1p foci flanking an abnormal splayed, V-shaped spindle. Q–T, large cell containing multiple GFP foci and a long, abnormally V-shaped spindle associated with three chromosomal masses. Bar, 5 µm.

 


View larger version (93K):
[in this window]
[in a new window]
 
Fig. 6. Pcp1p-GFP overexpression results in multiple abnormal cytoplasmic and nuclear structures by immunoelectron microscopy. Strain MFP19 (nmt1-GFP:pcp1+) was grown to logarithmic phase at 32° and prepared for immunoelectron microscopy with primary antibodies against GFP and with gold-labeled secondary antibodies. A and B, cross-section through an interphase nucleus showing gold particles on the spb and extra structures (es) in the cytoplasm near the ne. C, abnormal structure showing gold labeling in cytoplasm near cell wall (white area in top right corner). D, abnormal structure showing gold labeling in nucleus (es) and spb and associated extra structure (es) showing gold labeling near ne.

 
Given the abnormalities in SPB number and DNA segregation patterns caused by overexpression of GFP-Pcp1p, we evaluated the morphology of microtubules in strain MFP19 by immunofluorescence microscopy. As a control, we analyzed strain MFP5, which expresses Pcp1p-GFP from the endogenous pcp1+ promoter, and found that the GFP signal remains robust after combined aldehyde fixation (Fig. 7, A, E, I, and M)Citation . In agreement with previous descriptions of mitosis in S. pombe (34) , SPBs in MFP5 were located at the ends of the mitotic spindle and undergo separation concomitant with spindle elongation and chromosome segregation (Fig. 7, A–L)Citation . After spindle disassembly, interphase cells demonstrate a cortical array of microtubules nucleated from the non-SPB cytoplasmic MTOCs that appear near the septum in late mitosis (Ref. 34 ; Fig. 7, M–PCitation ).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 7. GFP-Pcp1p, tubulin, and DNA morphologies in four representative cells expressing wild-type levels of GFP-Pcp1p. Strain MFP5 (pcp1+:GFP) was grown to logarithmic phase in supplemented liquid YE medium at 30° prepared for immunofluorescence microscopy according to the combined aldehyde procedure and stained with antibodies to {alpha}-tubulin and DAPI as described in "Materials and Methods." Fluorescent signals were imaged using deconvolution microscopy as described in "Materials and Methods." A–D, mitotic cell containing a short spindle. E–H, mitotic cell containing a medium spindle. I–L, mitotic cell containing a full-length spindle; M–P, interphase cell containing cytoplasmic microtubules. Bar, 5 µm.

 
In contrast to these control cells, 65% (n = 31) of MFP19 cells containing more than two dots of GFP-Pcp1p also contained profound defects in microtubule architecture. Mitotic cells often demonstrated poorly formed spindles that were associated with SPBs of varying intensity (Fig. 8A)Citation . We also observed cells with multiple short spindle fragments, each of which were associated with GFP foci and one or two DNA masses (Fig. 8, E–L)Citation . In these cells, the GFP foci localize to the ends of the short spindle structures (Fig. 8, G and K)Citation , and three DNA masses are present in each cell (Fig. 8, H and L)Citation . We also observed cells with mitotic spindle defects in later stages of mitosis. These cells often contained fractured, V-shaped spindles (9 of 20, 45%; Fig. 8, M–OCitation ). Large cells frequently contained long spindle fragments (Fig. 8, Q–T)Citation . GFP foci were often associated with both the ends of the microtubule structures and along their axes. In these cells, small gaps of tubulin staining along the length of the long microtubule structures (Fig. 8, Q–SCitation , arrows) often corresponded with GFP. These cells often demonstrated three missegregated DNA masses (Fig. 8, H, L, and T)Citation , but the so-called "cut" phenotype (37) , in which the septum abnormally severs DNA at the cell midzone, was not observed.


    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Here we describe the cloning and characterization of Pcp1p, a Spc110p-related calmodulin-binding component of the fission yeast SPB. Pcp1p provides a unifying link between budding yeast Spc110p and the human Spc110p orthologue kendrin, and establishes that Spc110p-related centrosomal calmodulin targets represent a protein family conserved in eukaryotes from fungi to mammals. Our identification of the Spc110p protein family highlights a particularly striking example of the similarities on the molecular level between the vertebrate centrosome and fungal SPB, which are known to be functional counterparts despite their conspicuous differences in morphology. Pcp1p and the A. nidulans protein, like Spc110p and kendrin, contain predicted central coiled-coil secondary structure flanked by noncoiled regions.

All three fungal proteins and kendrin contain a COOH-terminal, calmodulin-binding site (31) . We show here that this site is required for calmodulin binding in both Pcp1p and the A. nidulans protein. Evidence for the importance of the calmodulin-Spc110p interaction comes from analysis of the phenotype conferred by a conditional mutation that interferes with calmodulin binding. Disruption of the Spc110p-calmodulin interaction results in the formation of a large electron-dense intranuclear structure associated with microtubules (27) , highlighting that the interaction between calmodulin and Spc110p is required for proper assembly of SPB components (27, 28, 29) . These findings suggest that calmodulin facilitates proper assembly of Spc110p into the SPB and that Spc110p subsequently directs the recruitment of other proteins necessary for microtubule nucleation to the SPB. In vertebrates, analysis of the Spc110p orthologue kendrin, and a related centrosomal calmodulin-binding protein AKAP450, identified a COOH-terminal 90 amino acid calmodulin-binding domain required to target these proteins to the centrosome (32) . As described in this study, overexpression of S. pombe Pcp1p in fission yeast cells causes the formation of ectopic structures containing known SPB components, including {gamma}-tubulin (see below), suggesting Pcp1p and calmodulin also directly assemble {gamma}-tubulin.

By immunoelectron microscopy, Pcp1p associates with the SPB before insertion of the SPB into the ne. At the transition to mitosis in S. pombe, the SPB undergoes a dramatic insertion event as it moves from the cytoplasmic periphery of the ne into a "fenestrae" in the ne (11) . Pcp1p incorporates into the fission yeast SPB before this insertion process, suggesting a mechanism distinct from that which facilitates assembly of Spc110p into the budding yeast SPB. Spc110p, unlike Pcp1p, contains a nuclear localization sequence, and it enters the nucleus before its incorporation into the daughter SPB during the SPB duplication process (9) . Thus, Pcp1p appears to be dependent on the SPB for entry into the ne, whereas Spc110p is not. This represents a fundamental difference in the way Pcp1p and Spc110p are assembled into the fission yeast SPB and budding yeast SPB, respectively.

After mitotic insertion into the ne, Pcp1p is maintained as an integral SPB component during microtubule nucleation and mitotic spindle assembly. The assembly mechanism of Pcp1p suggests a model in which Pcp1p affects mitotic spindle formation. Most {gamma}-tubulin in the interphase fission yeast cell is found inside the nucleus just below the future site of the fenestrae, which will allow insertion of the SPB (11) . Spindle microtubule nucleation is initiated just as the SPB inserts into the ne (11) , bringing Pcp1p into the nucleus and into proximity with the {gamma}-tubulin. Given that budding yeast Spc110p recruits the {gamma}-tubulin complex to the inner plaque of the budding yeast SPB (38) , microtubule nucleation in S. pombe may be initiated when Pcp1p is brought into contact with the nuclear pool of {gamma}-tubulin by SPB insertion. It should prove interesting to examine whether Pcp1p interacts directly with the recently described fission yeast {gamma}-tubulin complex (39) .

The phenotype of strain MFP19, which moderately overexpresses GFP-Pcp1p, includes the accumulation of supernumerary SPB-like structures, which recruit the SPB proteins Sad1p, a transmembrane-domain protein (35) , and {gamma}-tubulin (36) . The ability of excess Pcp1p to recruit such disparate proteins indicates that Pcp1p can direct the formation of structures that are organized similarly to wild-type SPBs. Examination of microtubules in strain MFP19 indicates that these abnormal SPB-like structures may disrupt mitotic spindle formation. A majority of MFP19 cells with defects in chromosome segregation contain aberrant spindle structures. We observed V-shaped spindles similar to those reported for cut11ts alleles (12) , suggesting the spindle apparatus has lost its anchoring point at the SPB. This observation suggests that Pcp1p may mediate interaction between the SPB and the ne. Although disruption of calmodulin function causes mitotic defects in S. pombe, two lines of evidence indicate the pcp1+ overexpression phenotype does not simply result from a shortage of calmodulin: (a) titration of calmodulin in fission yeast cells by heterologous overexpression of the mouse calmodulin-binding protein Sha1 in S. pombe disrupts the mitotic spindle but does not affect SPB duplication or cause accumulation of supernumerary SPB-like structures (40) ; and (b) a conditional lethal S. pombe calmodulin mutant (camE14V) produces the cut phenotype (17) , whereas the cut phenotype is not observed in MFP19 cells overexpressing Pcp1p.

Strain MFP19 forms multiple spindle-like structures within a single cell. Each of these spindles, whose ends are flanked by abnormal SPB-like structures that contain GFP-Pcp1p, is associated with chromosomal DNA. This suggests that the abnormal SPB-like structures organized by excess Pcp1p contain microtubule nucleation capability and can direct the formation of spindle-like structures that are capable of capturing DNA. Alternatively, these microtubule structures may represent fragments of defective spindles, broken in the process of segregating DNA, that have been captured by Pcp1p-GFP-containing structures. Finally, we also observe abnormally large cells, presumably a result of cell cycle arrest because of abortive mitosis. These cells contain large microtubule arrays with Pcp1p-GFP-containing structures, both at the ends and along the longitudinal axes of these structures. The presence of GFP foci at the ends and along the length of these arrays suggests these arrays may be composed of multiple spindles and/or spindle fragments aggregated by a microtubule-bundling activity, e.g., that proposed for the S. pombe motor Cut7p (41) .

Cells overexpressing Pcp1p are strikingly similar to a variety of human carcinoma cell lines and tissues that contain centrosomes of abnormal number and morphology (2, 3, 4) . Immunostaining studies using antibodies directed against multiple centrosome markers, including the human Pcp1p orthologue kendrin (31) , demonstrate that carcinoma cells contain extra centrosome-like structures in addition to abnormal spindle structures and missegregated DNA. We show here that moderate overexpression of Pcp1p in fission yeast cells similarly produces extra centrosome-like structures, abnormal spindle structures, and missegregated DNA. This is in contrast to overexpression of budding yeast Spc110p, which results in the formation of large nuclear polymers of a calmodulin/Spc110p complex that associates with microtubules and results in lethality during the subsequent mitosis (28) . It should prove interesting to investigate whether the Pcp1p overexpression phenotype is related to the increases in kendrin mRNA transcript level and centrosome number known to occur in certain human cancer lines (31) . Combined analysis of the Spc110p-related protein family, now firmly established by our identification and analysis of S. pombe Pcp1p, will undoubtedly shed light on conserved mechanisms underlying centrosome function.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Database Searching and Sequence Analysis
The S. pombe genome was searched using the Sanger Center BLAST server with default settings.4 Coiled-coil secondary structure was predicted using PAIRCOIL (42) .5 Sequence alignments were performed using multiple algorithms bundled in the Biology Workbench6 and National Center for Biotechnology Information BLAST7 Internet sites.

Media
Escherichia coli media was Luria-Bertani (43) , supplemented with 100 µg/ml ampicillin when needed. S. pombe-rich media were YE (44) and minimal medium (BIO 101, Inc., Vista, CA), supplemented with 100 µg/ml adenine, leucine, histidine, and/or uracil. G418 (Life Technologies, Inc.) was added to YE agar at 100 µg/ml when required. For mating and meiotic induction of S. pombe, strains of opposite mating type were mixed and grown on YPD. YPD is yeast extract-peptone (45) , supplemented with 2% glucose, 50 µg/ml adenine, and 25 µg/ml uracil.

Strains
S. pombe.
The genotype of wild-type strain 99 is h-, ade6-M210, leu1–32, ura4-D18, and his3-D1 (46) . A hemizygous strain carrying a single precise deletion of the pcp1+ ORF was created by integrating the PCR product amplified from plasmid cassette KS- (33) using oligonucleotides MF42 (5'AGTTTCTATATAATTTTATGCACTTGCGCTAGTTGGTGGATAATTTTAATAAATACATGCATCCGCAGTTACGTTCGCCAGGGTTTTCCCAGTCACGAC3') and MF43 (5'TTAAAATAATTATAGTAGTAGAATTAATTGAATGTTGTTAAAAAAAAAGAGAGTAAAAAACGTAAGTATCCCAGAAGCGGATAACAATTTCACACAGGA3') into a Ura- diploid strain (h+/h-, ade6-M210/ade6-M216, leu1–32/leu1–32, ura4-D18/ura4-D18, and his3-D1/his3-D1). Transformants with a Ura+ phenotype were identified and cultured on YPD medium for 48 h at 25°C to promote sporulation. Random spore analysis was then performed (47) , and the resulting colonies were screened for Ura+ prototrophy. The deletion allele in the hemizygous diploid strain was confirmed by the appearance of an amplification product of expected size on PCR amplification of the pcp1+ locus using primers with homology to the 5' and 3' pcp1+ untranslated regions. Southern blotting analysis using probes to the 5' and 3' untranslated regions were additionally used to confirm that the single-copy pcp1+ deletion allele is correctly localized in the genome.

To fuse GFP in-frame with the 3' end of the pcp1+ ORF, a PCR product was first generated by amplification of plasmid cassette pFA6a-GFP(S65T)-kanMX6 (33) using oligonucleotides MF16 (5'AAGAATGAGTGGCTAAAACAAGCTCAATTGAAACAATCATTGCAAAGAGCTGCCGCAAAGGCAAAGACCGCAAACTACCGGATCCCCGGGTTAATTAA3') and MF17 (5'AAATTAAAATAATTATAGTAGTAGAATTAATTGAATGTTGTTAAAAAAAAAGAGAGTAAAAAACGTAAGTATCCCAGAGAATTCGAGCTCGTTTAAAC3'). The resulting PCR product was integrated at the pcp1+ locus in strain MP5–1C (17) according to recommended methods (33) , creating the strain MFP5 (h-, ade6-M216, leu1–32, ura4-D18, and pcp1+:GFP). A 13XMyc tag was similarly added to the 3' end of the pcp1+ open-reading frame in strain 99 using plasmid cassette pFA6a-13 Myc-kanMX6 (33) and oligonucleotides MF16 and MF17 (see above), creating strain MFP10 (h-, ade6-M210, leu1–32, ura4-D18, his3-D1, and pcp1+:13XMyc). Integrated fusions of GFP to the 5' end of the pcp1+ ORF under control of wild-type (48) and attenuated nmt1 promoter sequences (49) were created using plasmid cassettes pFA6a-kanMX6-P3 nmt1-GFP and pFA6a-kanMX6-P81 nmt1-GFP (33) , respectively. Oligonucleotides MF39 (5'ATCAGATTGGCTGATCACAGAATTCGCGTTTTCATCTTTAAATTTGGGAGATTGCGTATTAAAATCTCGTTCAGACATGATTTAACAAAGCGACTATA3') and MF40 (5'ATCAGATTGGCTGATCACAGAATTCGCGTTTTCATCTTTAAATTTGGGAGATTGCGTATTAAAATCTCGTTCAGACATTTTGTATAGTTCATCCATGC3' were used for both PCR amplifications. The two resulting strains were named MFP19 (h-, ade6-M210, leu1–32, ura4-D18, his3-D1, and nmt1(highest strength)-GFP:pcp1+) and MFP6 (h-, ade6-M210, leu1–32, ura4-D18, his3-D1, and nmt1(lowest strength)-GFP:pcp1+).

All PCR reactions for tagging and deletion methods in S. pombe were performed using Expand polymerase (Roche Molecular Biochemicals) with Buffer 3, and all oligonucleotides (Integrated DNA Technologies, Coralville, IA) used for these methods were purified by the vendor using PAGE. All integrations were verified by PCR analysis of the chromosomal pcp1+ locus. The deletion allele was additionally confirmed by Southern blot analysis.

Plasmids
S. pombe.
An S. pombe genomic DNA fragment containing the entire pcp1+ ORF was amplified from S. pombe chromosomal DNA using oligonucleotides MF23 (5'CTCATTGGTGTAACCGGAGC3') and MF24 (5'GCCTCCGATTGAGAGAATGC3'; Integrated DNA Technologies) and then digested with XbaI and EcoRV. The resulting XbaI-EcoRV fragment, which contains the entire pcp1+ ORF, was then inserted into the unique XbaI and EcoRV sites of pBluescript KS+ (Stratagene), creating plasmid pMF13. The pcp1+ sequence (GenBank accession no. AF348506) in pMF13 precisely matched the corresponding sequence in the S. pombe database.

For protein A-calmodulin overlay assays, plasmid pMF27 encoding a fusion of GST to the Pcp1p COOH-terminal region was created. First, BamHI sites flanking the region of pMF13 encoding Pcp1p amino acids 960-1208 were engineered using oligo-mediated mutagenesis (50) with pMF13 as template and oligonucleotides MF45 (5'TACTAATCTGGGATCCTTACGTTTTTTAC3') and MF47 (5'GCTATAATAAGCAAGGATCCAAGTTGCAGG3'; Integrated DNA Technologies), creating plasmid pMF18. The resulting BamHI fragment in pMF18 was inserted into the unique BamHI site of pGEX-2T (Amersham Pharmacia), creating plasmid pMF27 containing an in-frame fusion of GST to Pcp1p residues 960-1208. Plasmid pMF59, encoding a fusion of GST to a Pcp1p COOH-terminal truncation (residues 960-1141) lacking the predicted calmodulin-binding site, was created by site-directed mutagenesis of plasmid pMF27 using QuikChange (Stratagene) and oligonucleotides MF100 (5'CAGGATACGAAACATGCAATTAAATAAATTTACGTATGCTGCAG3') and MF101 (5'CTGCAGCATACGTAAATTTATTTAATTGCATGTTTCGTATCCTG3'; Integrated DNA Technologies). QuikChange was used according to the manufacturer’s recommendations, except that the annealing temperature for PCR was raised to 64°C in all cases. Plasmid pMF11 encoding an in-frame fusion of the staphylococcal protein A IgG-binding domain to S. pombe cam1+ was constructed by replacing an NcoI/PstI fragment encoding vertebrate calmodulin in pMF8 (a derivative of pRIT-2T; Amersham Pharmacia), with an NcoI/PstI fragment containing S. pombe cam1+ from plasmid pEC/pCAM (51) .

A. nidulans.
The hexahistidine-tagged, COOH-terminal fragment of the A. nidulans protein used in protein A calmodulin overlay assays was generated by first subcloning a 2.7-kb EcoRI/KpnI fragment containing the 3' end of the A. nidulans cDNA from pBluescript phagemid 2.5 identified in the initial expression screen (GenBank accession no. AF365926) into pGEM-4Z (Promega). From the resulting plasmid, a 2.7-kb SalI/EcoRI fragment was cloned into the EcoRI/SalI site of pET30b (Invitrogen), thereby generating pA110C. A truncated version lacking the calmodulin-binding site was generated by subcloning a 2.3-kb EcoRI/FspI fragment of pBluescript 2.5 into the EcoRI/SmaI sites of pGEM-3Z (Promega). The final truncation construct expressing the A nidulans COOH-terminal protein fragment lacking the calmodulin-binding site ({Delta}CaM b.s.) was generated by cloning the EcoRI/SacI fragment into the EcoRI/SacI sites of pET30b (Invitrogen).

Calmodulin Overlay Blot
S. pombe.
Protein A-calmodulin overlay blotting was done as described previously (52) , with the following modifications. A protein A-Cam1p fusion protein and protein A alone were expressed in E. coli strain POP2136 (American Type Tissue Collection) using plasmid pMF11 and pRIT-2T (Pharmacia), respectively. Expression of protein A and the protein A-calmodulin fusion protein were induced in mid-log phase cultures by shifting the growth temperature from 30°C to 42°C for 2 h. Cells were lysed in a French pressure cell (American Instrument Co., Silver Spring, MD), and one-step purification was performed on IgG-Sepharose (Pharmacia), according to the manufacturer’s recommendations. Fusions of GST to Pcp1p fragments (amino acids 960-1208 and 960-1141) and GST alone were expressed in E. coli strain GM-1 (53) using plasmids pMF27, pMF59, and pGEX-2T (Amersham Pharmacia), respectively. Expression of GST and GST fusions were induced at mid-log phase by culturing cells for 3 h in the presence of 0.2 mM isopropyl ß-D-thiogalactopyranoside. Bacterial lysates were prepared in 0.01 M sodium phosphate (pH 7.2), 1% ß-mercaptoethanol, 1% SDS, and 6 M urea.

A. nidulans.
A. nidulans CaM-Protein A overlays were performed as described (30 , 52) . Both hexahistidine-tagged fusion proteins were expressed in BL21 bacteria by growing the culture to an A600 nm of 0.6 and inducing protein expression with the addition of 1 mM isopropyl ß-D-thiogalactopyranoside for 2 h. The bacteria were then pelleted by centrifugation and lysed by resuspension in 8 M urea, 100 mM sodium phosphate buffer, and 10 mM Tris buffer (pH 6.8). The lysate was clarified by centrifugation, and the proteins were isolated using nickel nitriloacetic acid-agarose resin after the protocol recommended by Qiagen.

Fluorescence Microscopy
Live S. pombe cells expressing GFP fusions were prepared for inspection by fluorescence microscopy as described previously (17) . For immunofluorescence microscopy, S. pombe cells were grown to mid-log phase in YE liquid medium at 30°C. Cells were then fixed, washed, digested with mutanase (Novo Nordisk BioChem) and/or Zymolyase-100T (ICN), and stained according either to a procedure using formaldehyde alone as fixative (54) or to the combined formaldehyde/glutaraldehyde method (34) , with the following modifications. PBS, PBS supplemented with 1% BSA and 0.05% sodium azide (PBS/BSA), and 1.1 M sorbitol in 0.1 M sodium phosphate buffer, pH 6.5 (SP) were substituted for PEM (Pipes-EGTA-MgSO4), PEMS (PEM-sorbitol), and PEMBAL (PEM-bovine serum albumin) buffers, respectively. Cells fixed in formaldehyde alone were digested in 0.5 ml of SP containing 0.5 mg/ml Zymolyase-100T for ~1 h at 30°. Cells fixed by the combined aldehyde method were digested in 1 ml of SP containing 0.3 mg/ml Zymolyase-100T and 1 mg/ml mutanase (Novo Nordisk BioChem) for ~1 h at 30°C. Cells were incubated for 12–36 h at room temperature on a rotating wheel in primary antibodies.

The antibodies were affinity-purified rabbit anti-Sad1p antibodies (1:25; Ref. 35 ), mouse ascites anti-{gamma}-tubulin antibody GTU-88 (1:100; Sigma Chemical Co.), affinity-purified rabbit anti-c-Myc antibodies (1:30; Santa Cruz Biotechnology), or purified rat anti-{alpha}-tubulin monoclonal antibody YOL1/34 (1:50; Harlan Sera-Lab) in 100–200 µl of PBS/BSA. After three washes in PBS/BSA, cells were resuspended in 200 µl of PBS/BSA containing secondary antibody conjugates: rhodamine-isothiocyanate-labeled goat antirabbit IgG (1:800; Boehringer Mannheim), Alexa 568 goat antimouse IgG (1:50; Molecular Probes), antirabbit Oregon Green 488 goat antirat IgG (1:800; Molecular Probes), or Alexa Fluor 568 goat antirat IgG (1:50; Molecular Probes). After incubations in secondary antibody for >=4 h at room temperature on a rotating wheel, cells were washed three times in PBS/BSA. DNA was stained with 100 ng/ml DAPI (Sigma Chemical Co.), and cells were then mounted onto #1.5 polylysine-coated glass Gold Seal coverslips (VWR) in Citifluor Glycerol (Ted Pella). Depolymerization of microtubules was induced by incubating cells on ice for 25 min before fixation (35) .

For standard immunofluorescence microscopy, cells were imaged using a Zeiss Axioplan microscope with a 100 x objective and an Optivar set at 1.25. Images were captured using Imagepoint or Quantix cooled CCD video cameras (Photometrics). For deconvolution fluorescence microscopy, cells prepared as described above were imaged using a Zeiss Axiovert microscope with a 63 x objective. The images were captured using a Quantix-LC cooled CCD video camera (Photometrics) and analyzed using DeltaVision software (Applied Precision). Figs. 2NCitation ; 7, A–PCitation ; and 8, A–TCitation are deconvolved projections of 10–30 digital sections.

Immunoelectron Microscopy
For immunoelectron microscopy, cells were grown in liquid culture to early-to-mid log phase and processed as described (11) . Immunoelectron microscopy was done as described previously (12) with antibodies against GFP (55) .


    Acknowledgments
 
We thank Dick McIntosh for analysis of electron microscopy images and for critical reading of the manuscript and Dale Hailey for help with deconvolution microscopy. We also thank Iain Hagan for anti-Sad1p antibodies and Novo Nordisk BioChem for mutanase.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grant R01 GM40506 (to T. N. D.), GM33976 (to A. R. M.), and Training Grant T32 GM-07270-22 (to M. R. F.). Back

2 To whom requests for reprints should be addressed, at Molecular and Cellular Biology Program, Department of Biochemistry, University of Washington, Box 357350, Seattle, WA 98195. Phone: (206) 543-5345; Fax: (206) 685-1792; E-mail: tdavis{at}u.washington.edu Back

3 The abbreviations used are: SPB, spindle pole body; GFP, green fluorescent protein; ORF, open reading frame; GST, glutathione-S-transferase; MTOC, microtubule-organizing center; DAPI, 4',6-diamidino-2-phenylindole; nmt, no message in thiamine; SP, sodium phosphate buffer; cut, chromosomes untimely torn; ICN, Zymolyase-100T; ne, nuclear envelope; YE, yeast extract; YPD, yeast extract-peptone-dextrose. Back

4 Internet address: http://www.sanger.ac.uk/Projects/S_pombe/blast_server.shtml. Back

5 Internet address: http://nightingale.lcs.mit.edu/cgi-bin/score. Back

6 Internet address: http://workbench.sdsc.edu. Back

7 Internet address: http://www.ncbi.nlm.nih.gov/blast/. Back

Received for publication 6/ 7/01. Revision received 12/10/01. Accepted for publication 12/17/01.


    References
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Urbani L, Stearns T. The centrosome. Curr. Biol., 9: R315-R317, 1999.[Medline]
  2. Lingle W. L., Lutz W. H., Ingle J. N., Maihle N. J., Salisbury J. L. Centrosome hypertrophy in human breast tumors: implications for genomic stability and cell polarity. Proc. Natl. Acad. Sci. USA, 95: 2950-2955, 1998.[Abstract/Free Full Text]
  3. Pihan G. A., Purohit A., Wallace J., Knecht H., Woda B., Quesenberry P., Doxsey S. J. Centrosome defects and genetic instability in malignant tumors. Cancer Res., 58: 3974-3985, 1998.[Abstract/Free Full Text]
  4. Lingle W. L., Salisbury J. L. Altered centrosome structure is associated with abnormal mitoses in human breast tumors. Am. J. Pathol., 155: 1941-1951, 1999.[Abstract/Free Full Text]
  5. Pihan G. A., Purohit A., Wallace J., Malhotra R., Liotta L., Doxsey S. J. Centrosome defects can account for cellular and genetic changes that characterize prostate cancer progression. Cancer Res., 61: 2212-2219, 2001.[Abstract/Free Full Text]
  6. Kellogg D. R., Moritz M., Alberts B. M. The centrosome and cellular organization. Annu. Rev. Biochem., 63: 639-674, 1994.[Medline]
  7. Bullitt E., Rout M. P., Kilmartin J. V., Akey C. W. The yeast spindle pole body is assembled around a central crystal of Spc42p. Cell, 89: 1077-1086, 1997.[Medline]
  8. O’Toole E. T., Winey M., McIntosh J. R. High-voltage electron tomography of spindle pole bodies and early mitotic spindles in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell, 10: 2017-2031, 1999.[Abstract/Free Full Text]
  9. Adams I. R., Kilmartin J. V. Localization of core spindle pole body (SPB) components during SPB duplication in Saccharomyces cerevisiae. J. Cell Biol., 145: 809-823, 1999.[Abstract/Free Full Text]
  10. Francis S. E., Davis T. N. The spindle pole body of Saccharomyces cerevisiae: architecture and assembly of the core components. Curr. Top. Dev. Biol., 49: 105-132, 2000.[Medline]
  11. Ding R., West R. R., Morphew D. M., Oakley B. R., McIntosh J. R. The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds. Mol. Biol. Cell, 8: 1461-1479, 1997.[Abstract]
  12. West R. R., Vaisberg E. V., Ding R., Nurse P., McIntosh J. R. cut11(+): a gene required for cell cycle-dependent spindle pole body anchoring in the nuclear envelope and bipolar spindle formation in Schizosaccharomyces pombe. Mol. Biol. Cell, 9: 2839-2855, 1998.[Abstract/Free Full Text]
  13. Willingham M. C., Wehland J., Klee C. B., Richert N. D., Rutherford A. V., Pastan I. H. Ultrastructural immunocytochemical localization of calmodulin in cultured cells. J. Histochem. Cytochem., 31: 445-461, 1983.[Abstract]
  14. Zavortink M., Welsh M. J., McIntosh J. R. The distribution of calmodulin in living mitotic cells. Exp. Cell Res., 149: 375-385, 1983.[Medline]
  15. Li C. J., Heim R., Lu P., Pu Y., Tsien R. Y., Chang D. C. Dynamic redistribution of calmodulin in HeLa cells during cell division as revealed by a GFP-calmodulin fusion protein technique. J. Cell Sci., 112: 1567-1577, 1999.[Abstract]
  16. Geiser J. R., Sundberg H. A., Chang B. H., Muller E. G., Davis T. N. The essential mitotic target of calmodulin is the 110-kilodalton component of the spindle pole body in Saccharomyces cerevisiae. Mol. Cell. Biol., 13: 7913-7924, 1993.[Abstract/Free Full Text]
  17. Moser M. J., Flory M. R., Davis T. N. Calmodulin localizes to the spindle pole body of Schizosaccharomyces pombe and performs an essential function in chromosome segregation. J. Cell Sci., 110: 1805-1812, 1997.[Abstract]
  18. Murphy S. M., Urbani L., Stearns T. The mammalian {gamma}-tubulin complex contains homologues of the yeast spindle pole body components spc97p and spc98p. J. Cell Biol., 141: 663-674, 1998.[Abstract/Free Full Text]
  19. Martin O. C., Gunawardane R. N., Iwamatsu A., Zheng Y. Xgrip109: a {gamma} tubulin-associated protein with an essential role in {gamma} tubulin ring complex ({gamma}TuRC) assembly and centrosome function. J. Cell Biol., 141: 675-687, 1998.[Abstract/Free Full Text]
  20. Tassin A. M., Celati C., Moudjou M., Bornens M. Characterization of the human homologue of the yeast spc98p and its association with {gamma}-tubulin. J. Cell Biol., 141: 689-701, 1998.[Abstract/Free Full Text]
  21. Zheng Y., Wong M. L., Alberts B., Mitchison T. Nucleation of microtubule assembly by a {gamma}-tubulin-containing ring complex. Nature (Lond.), 378: 578-583, 1995.[Medline]
  22. Moritz M., Braunfeld M. B., Sedat J. W., Alberts B., Agard D. A. Microtubule nucleation by {gamma}-tubulin-containing rings in the centrosome. Nature (Lond.), 378: 638-640, 1995.[Medline]
  23. Moritz M., Zheng Y., Alberts B. M., Oegema K. Recruitment of the {gamma}-tubulin ring complex to Drosophila salt-stripped centrosome scaffolds. J. Cell Biol., 142: 775-786, 1998.[Abstract/Free Full Text]
  24. Schnackenberg B. J., Khodjakov A., Rieder C. L., Palazzo R. E. The disassembly and reassembly of functional centrosomes in vitro. Proc. Natl. Acad. Sci. USA, 95: 9295-9300, 1998.[Abstract/Free Full Text]
  25. Knop M., Schiebel E. Spc98p and Spc97p of the yeast {gamma}-tubulin complex mediate binding to the spindle pole body via their interaction with Spc110p. EMBO J., 16: 6985-6995, 1997.[Medline]
  26. Nguyen T., Vinh D. B. N., Crawford D. K., Davis T. N. A genetic analysis of interactions with Spc110p reveals distinct functions of Spc97p and Spc98p, components of the yeast {gamma}-tubulin complex. Mol. Biol. Cell, 9: 2201-2216, 1998.[Abstract/Free Full Text]
  27. Sundberg H. A., Goetsch L., Byers B., Davis T. N. Role of calmodulin and Spc110p interaction in the proper assembly of spindle pole body compenents. J. Cell Biol., 133: 111-124, 1996.[Abstract/Free Full Text]
  28. Kilmartin J. V., Goh P. Y. Spc110p: assembly properties and role in the connection of nuclear microtubules to the yeast spindle pole body. EMBO J., 15: 4592-4602, 1996.[Medline]
  29. Stirling D. A., Welch K. A., Stark M. J. Interaction with calmodulin is required for the function of Spc110p, an essential component of the yeast spindle pole body. EMBO J., 13: 4329-4342, 1994.[Medline]
  30. Joseph J. D., Means A. R. Identification and characterization of two Ca2+/CaM-dependent protein kinases required for normal nuclear division in aspergillus nidulans. J. Biol. Chem., 275: 38230-38238, 2000.[Abstract/Free Full Text]
  31. Flory M. R., Moser M. J., Monnat R. J., Jr., Davis T. N. Identification of a human centrosomal calmodulin-binding protein that shares homology with pericentrin. Proc. Natl. Acad. Sci. USA, 97: 5919-5923, 2000.[Abstract/Free Full Text]
  32. Gillingham A. K., Munro S. The PACT domain, a conserved centrosomal targeting motif in the coiled-coil proteins AKAP450 and pericentrin. EMBO Rep., 1: 524-529, 2000.[Medline]
  33. Bahler J., Wu J. Q., Longtine M. S., Shah N. G., McKenzie A., III, Steever A. B., Wach A., Philippsen P., Pringle J. R. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast, 14: 943-951, 1998.[Medline]
  34. Hagan I. M., Hyams J. S. The use of cell division cycle mutants to investigate the control of microtubule distribution in the fission yeast Schizosaccharomyces pombe. J. Cell Sci., 89: 343-357, 1988.[Abstract/Free Full Text]
  35. Hagan I., Yanagida M. The product of the spindle formation gene sad1+ associates with the fission yeast spindle pole body and is essential for viability. J. Cell Biol., 129: 1033-1047, 1995.[Abstract/Free Full Text]
  36. Horio T., Uzawa S., Jung M. K., Oakley B. R., Tanaka K., Yanagida M. The fission yeast {gamma}-tubulin is essential for mitosis and is localized at microtubule organizing centers. J. Cell Sci., 99: 693-700, 1991.[Abstract]
  37. Yanagida M. Fission yeast cut mutations revisited: control of anaphase. Trends Cell Biol., 8: 144-149, 1998.[Medline]
  38. Knop M., Schiebel E. Receptors determine the cellular localization of a {gamma}-tubulin complex and thereby the site of microtubule formation. EMBO J., 17: 3952-3967, 1998.[Medline]
  39. Vardy L., Toda T. The fission yeast gamma-tubulin complex is required in G(1) phase and is a component of the spindle assembly checkpoint. EMBO J., 19: 6098-6111, 2000.[Medline]
  40. Craig R., Norbury C. The novel murine calmodulin-binding protein Sha1 disrupts mitotic spindle and replication checkpoint functions in fission yeast. J. Cell Sci., 111: 3609-3619, 1998.[Abstract]
  41. Hagan I., Yanagida M. Kinesin-related cut7 protein associates with mitotic and meiotic spindles in fission yeast. Nature (Lond.), 356: 74-76, 1992.[Medline]
  42. Berger B., Wilson D. B., Wolf E., Tonchev T., Milla M., Kim P. S. Predicting coiled coils by use of pairwise residue correlations. Proc. Natl. Acad. Sci. USA, 92: 8259-8263, 1995.[Abstract/Free Full Text]
  43. Miller J. H. eds. . Experiments in Molecular Genetics, : Cold Spring Harbor Laboratory Cold Spring Harbor NY 1972.
  44. Gutz H., Heslot H., Leupold U., Loprieno N. Schizosaccharomycs pombe King R. C. eds. . Handbook of Genetics, : Plenum Publishing New York 1972.
  45. Sherman F. Fink G. R. Hicks J. B. eds. . Methods in Yeast Genetics, : Cold Spring Harbor Laboratory Cold Spring Harbor, NY 1986.
  46. Burke J. D., Gould K. L. Molecular cloning and characterization of the Schizosaccharomyces pombe his3 gene for use as a selectable marker. Mol. Gen. Genet., 242: 169-176, 1994.[Medline]
  47. Fantes P. A., Warbrick E., Hughes D. A., MacNeill S. A. New elements in the mitotic control of the fission yeast Schizosaccharomyces pombe. Cold Spring Harb. Symp. Quant. Biol., 56: 605-611, 1991.[Abstract/Free Full Text]
  48. Maundrell K. nmt1 of fission yeast. A highly transcribed gene completely repressed by thiamine. J. Biol. Chem., 265: 10857-10864, 1990.[Abstract/Free Full Text]
  49. Basi G., Schmid E., Maundrell K. TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene, 123: 131-136, 1993.[Medline]
  50. Kunkel T. A., Roberts J. D., Zakour R. A. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol., 154: 367-382, 1987.[Medline]
  51. Moser M. J., Lee S. Y., Klevit R. E., Davis T. N. Ca2+ binding to calmodulin and its role in Schizosaccharomyces pombe as revealed by mutagenesis and NMR spectroscopy. J. Biol. Chem., 270: 20643-20652, 1995.[Abstract/Free Full Text]
  52. Stirling D. A., Petrie A., Pulford D. J., Paterson D. T., Stark M. J. Protein A-calmodulin fusions: a novel approach for investigating calmodulin function in yeast. Mol. Microbiol., 6: 703-713, 1992.[Medline]
  53. Coulondre C., Miller J. H. Genetic studies of the lac repressor. III. Additional correlation of mutational sites with specific amino acid residues. J. Mol. Biol., 117: 525-567, 1977.[Medline]
  54. Sohrmann M., Fankhauser C., Brodbeck C., Simanis V. The dmf1/mid1 gene is essential for correct positioning of the division septum in fission yeast. Genes Dev., 10: 2707-2719, 1996.[Abstract/Free Full Text]
  55. Seedorf M., Damelin M., Kahana J., Taura T., Silver P. A. Interactions between a nuclear transporter and a subset of nuclear pore complex proteins depend on Ran GTPase. Mol. Cell. Biol., 19: 1547-1557, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JCBHome page
V. A. Tallada, K. Tanaka, M. Yanagida, and I. M. Hagan
The S. pombe mitotic regulator Cut12 promotes spindle pole body activation and integration into the nuclear envelope
J. Cell Biol., June 1, 2009; 185(5): 875 - 888.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
Y. Huang, H. Yan, and M. K. Balasubramanian
Assembly of normal actomyosin rings in the absence of Mid1p and cortical nodes in fission yeast
J. Cell Biol., December 15, 2008; 183(6): 979 - 988.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
I. Samejima, V. J. Miller, L. M. Groocock, and K. E. Sawin
Two distinct regions of Mto1 are required for normal microtubule nucleation and efficient association with the {gamma}-tubulin complex in vivo
J. Cell Sci., December 1, 2008; 121(23): 3971 - 3980.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
H. Yan, W. Ge, T. G. Chew, J. Y. Chow, D. McCollum, A. M. Neiman, and M. K. Balasubramanian
The Meiosis-Specific Sid2p-related Protein Slk1p Regulates Forespore Membrane Assembly in Fission Yeast
Mol. Biol. Cell, September 1, 2008; 19(9): 3676 - 3690.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Saitoh, Y. Kobayashi, Y. Ogiyama, and K. Takahashi
Dual Regulation of Mad2 Localization on Kinetochores by Bub1 and Dam1/DASH that Ensure Proper Spindle Interaction
Mol. Biol. Cell, September 1, 2008; 19(9): 3885 - 3897.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K.-W. Fong, Y.-K. Choi, J. B. Rattner, and R. Z. Qi
CDK5RAP2 Is a Pericentriolar Protein That Functions in Centrosomal Attachment of the {gamma}-Tubulin Ring Complex
Mol. Biol. Cell, January 1, 2008; 19(1): 115 - 125.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. E. Sillibourne, B. Delaval, S. Redick, M. Sinha, and S. J. Doxsey
Chromatin Remodeling Proteins Interact with Pericentrin to Regulate Centrosome Integrity
Mol. Biol. Cell, September 1, 2007; 18(9): 3667 - 3680.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
E. L. Grishchuk, I. S. Spiridonov, and J. R. McIntosh
Mitotic Chromosome Biorientation in Fission Yeast Is Enhanced by Dynein and a Minus-end-directed, Kinesin-like Protein
Mol. Biol. Cell, June 1, 2007; 18(6): 2216 - 2225.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Wiese and Y. Zheng
Microtubule nucleation: {gamma}-tubulin and beyond
J. Cell Sci., October 15, 2006; 119(20): 4143 - 4153.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. A. Rosenberg, G. C. Tomlin, W. H. McDonald, B. E. Snydsman, E. G. Muller, J. R. Yates III, and K. L. Gould
Ppc89 Links Multiple Proteins, Including the Septation Initiation Network, to the Core of the Fission Yeast Spindle-Pole Body
Mol. Biol. Cell, September 1, 2006; 17(9): 3793 - 3805.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
I. Samejima, P. C. C. Lourenco, H. A. Snaith, and K. E. Sawin
Fission Yeast mto2p Regulates Microtubule Nucleation by the Centrosomin-related Protein mto1p
Mol. Biol. Cell, June 1, 2005; 16(6): 3040 - 3051.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. L. Freeman-Cook, E. B. Gomez, E. J. Spedale, J. Marlett, S. L. Forsburg, L. Pillus, and P. Laurenson
Conserved Locus-Specific Silencing Functions of Schizosaccharomyces pombe sir2+
Genetics, March 1, 2005; 169(3): 1243 - 1260.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
W. C. Zimmerman, J. Sillibourne, J. Rosa, and S. J. Doxsey
Mitosis-specific Anchoring of {gamma} Tubulin Complexes by Pericentrin Controls Spindle Organization and Mitotic Entry
Mol. Biol. Cell, August 1, 2004; 15(8): 3642 - 3657.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Venkatram, J. J. Tasto, A. Feoktistova, J. L. Jennings, A. J. Link, and K. L. Gould
Identification and Characterization of Two Novel Proteins Affecting Fission Yeast {gamma}-tubulin Complex Function
Mol. Biol. Cell, May 1, 2004; 15(5): 2287 - 2301.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. R. Kahl and A. R. Means
Regulation of Cell Cycle Progression by Calcium/Calmodulin-Dependent Pathways
Endocr. Rev., December 1, 2003; 24(6): 719 - 736.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Flory, M. R.
Right arrow Articles by Davis, T. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Flory, M. R.
Right arrow Articles by Davis, T. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation