CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by You, H.
Right arrow Articles by Kline, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by You, H.
Right arrow Articles by Kline, K.
Cell Growth & Differentiation Vol. 12, 471-480, September 2001
© 2001 American Association for Cancer Research

RRR-{alpha}-Tocopheryl Succinate Induces MDA-MB-435 and MCF-7 Human Breast Cancer Cells to Undergo Differentiation1

Huihong You, Weiping Yu, Bob G. Sanders and Kimberly Kline2

Division of Nutrition/A2703 [K. K.] and School of Biological Sciences/C0900 [H. Y., W. Y., B. G. S.], University of Texas at Austin, Austin, Texas 78712


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
RRR-{alpha}-Tocopheryl succinate (vitamin E succinate, VES) is a potent antitumor agent, inducing DNA synthesis arrest, differentiation, and apoptosis. Because little is known about VES-induced differentiation, studies reported here characterize VES effects on the differentiation status of human breast cancer cell lines and investigate possible molecular mechanisms involved. VES-induced differentiation of human MCF-7 and MDA-MB-435 breast cancer cells was characterized by morphological changes, induction of lipid droplets, induction of ß-casein mRNA expression, and down-regulation of Her2/neu protein. In contrast, VES treatment of normal human mammary epithelial cells, MCF-10A cells, and T-47D cells did not induce differentiation. Studies addressing mechanisms showed that neither antibody neutralization of the transforming growth factor-ß signaling pathway nor expression of a dominant-negative mutant of c-Jun N-terminal kinase blocked the ability of VES to induce differentiation; however, treatment of cells with PD 98059, a chemical inhibitor of mitogen-activated protein kinase kinase (MEK1/2), blocked the ability of VES to induce differentiation.


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Despite improvements in hormonal and chemotherapeutic treatments, breast cancer remains the second leading cause of death from cancer in women in the United States There is an urgent need for identification and characterization of novel anticancer agents.

Induction of differentiation is one potent mechanism by which some cancer therapeutic and chemopreventive agents work (1) . For example, all-trans retinoic acid induces terminal differentiation of acute promyelocytic leukemia cells and represents the best studied differentiation-based therapy in cancer (2, 3, 4) . The active form of vitamin D, 1{alpha},25-dihydroxyvitamin D3, has also been shown to be a potent antiproliferative and differentiating agent (3) . VES,3 a derivative of vitamin E (RRR-{alpha}-tocopherol), is a small lipophilic molecule that shares with retinoids and deltanoids the ability to affect cell growth and differentiation (5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22) . Regarding the ability of VES to induce differentiation, VES treatment of murine B16 melanoma cells induces morphological differentiation and growth inhibition (22) , and VES treatment of HL-60 human promyelocytic cells induces DNA synthesis arrest and differentiation toward a macrophage-like cell type (14) .

Breast cancer cells that have been induced to differentiate exhibit growth arrest, altered cytoplasm and nuclear morphology, expression of milk components (lipids and casein), and regulation of Her2/neu protein expression (23, 24, 25, 26) . Mature mammary epithelium synthesizes and secretes milk proteins and lipids (27 , 28) . {alpha}-, ß-, and {gamma}-caseins together constitute ~80% of total milk protein. Casein expression has been used as a specific biochemical marker of mammary gland-differentiated function (29) . Among caseins, ß-casein is the most highly expressed in normal mammary epithelium (30) , but casein production is not a common characteristic of most human breast cancers (31, 32, 33) . However, several studies have shown that differentiated human breast cancer cells can produce milk components (25 , 26 , 34, 35, 36, 37, 38) .

Several proteins have been reported to be associated with differentiation of human breast cancer cells. One is decreased expression of Her-2/neu. Her-2/neu is a Mr 185,000 molecular weight transmembrane phosphoglycoprotein and is a member of the EGFR (EGFR/erbB-1) family (39 , 40) . Overexpression of Her2/neu is found in 25–30% of primary, invasive human breast cancers and is associated with increased progression and metastasis and decreased survival (41, 42, 43, 44, 45, 46) . Her-2/neu does not bind any known ligand with high affinity [reviewed by Harari and Yarden (46) ]. Although no known ligand can activate Her-2/neu homodimers, Her-2/neu can function as a coreceptor with EGFR members (46) . The major heterodimerization partners of Her-2/neu in carcinomas are EGFR/erbB-1 and ErbB3 (46) . Several studies have shown that activation of Her-2/neu containing complexes with certain ligands or with a Her-2/neu receptor-specific neutralizing antibody can induce differentiation of human breast cancer cells (34 , 35 , 47, 48, 49) . These reagents caused partial disappearance and translocation of the Her-2/neu protein from the plasma membrane to the cytoplasm (25 , 34 , 49) . A second is D-type cyclins, which play a critical role in the regulation of retinoblastoma phosphorylation and are important for the switch from cellular proliferation to differentiation (50, 51, 52, 53) . One study showed that normal HMECs treated with 1.0 µM all-trans retinoic acid undergo irreversible growth inhibition starting at 24 h and complete G0-G1-phase arrest by day 3 (54) . Furthermore, cyclin D1 protein levels were observed to decrease in association with the initiation of growth arrest and then increase by ~35% on day 3 concomitant with morphological changes indicative of progression to a more differentiated phenotype (54) . Cytokeratins, ICAM-1, and ß-catenin are proteins associated with differentiation. Cytokeratins 8, 18, and 19 have been used as markers of well-differentiated mammary luminal cells and luminal breast cancer cells (55, 56, 57, 58) . A recent study by Buehler et al. (59) suggests that loss of cytokeratin 18 is associated with loss of differentiation during malignant transformation and that enhanced cytokeratin 18 expression is associated with reversal of tumorigenic and metastatic phenotypes. ICAM-1 has been identified and used as a marker of differentiation for human mammary epithelial cells and human breast cancer cells in several studies (37 , 60, 61, 62, 63, 64, 65) . ß-catenin, which is involved in linking the cytoplasmic tail of cadherins to actin in the cytoskeleton, has been shown to increase in expression in human breast cancer SKBR3 cells induced to differentiate with 9-cis or all-trans retinoic acid treatment (66) . The transcription factors, CCAAT/enhancer binding protein {alpha} and PPAR{gamma}, are involved in differentiation and are related to lipid accumulation (67, 68, 69, 70) .

Here we describe VES-induced differentiation of human MDA-MB-435 and MCF-7 breast cancer cells as characterized by morphological changes, induction of lipid droplets, induction of ß-casein mRNA expression, and down-regulation of Her2/neu protein. Studies addressing mechanisms involved in VES-induced differentiation identified the involvement of ERK but not TGF-ß or JNK signaling.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Morphological Changes as Biomarkers of VES-induced Differentiation.
MDA-MB-435 and MCF-7 breast cancer cells exhibit distinctive spindle and cuboidal shapes, respectively. After 24 h of treatment with 5 or 10 µg/ml of VES, MDA-MB-435 (Fig. 1, B and C)Citation and MCF-7 (Fig. 1, E and F)Citation exhibit morphological changes associated with increased cell volume and a more rounded appearance when compared with VEH-treated MDA-MB-435 and MCF-7 cells (Fig. 1, A and DCitation , respectively). HMECs, immortalized but nontumorigenic MCF-10A human breast cells, and T-47D human breast cancer cells did not show morphological changes after VES treatment (data not shown).



View larger version (132K):
[in this window]
[in a new window]
 
Fig. 1. Morphological changes in MDA-MB-435 and MCF-7 cells after 1 day of treatment with VEH or VES. A and D, VEH-treated MDA-MB-435 and MCF-7 cells, respectively. MDA-MB-435 cells were treated with 5 and 10 µg/ml VES, respectively (B and C), as were MCF-7 cells (E and F, respectively). Data are representative of three independent experiments.

 
Lipid Accumulation as a Biomarker of VES-induced Differentiation.
Staining of neutral lipids with Oil Red O showed that MDA-MB-435 and MCF-7 cells treated with 5 and 10 µg/ml of VES for 3 days (Fig. 2A)Citation accumulate numerous fat droplets in the cytoplasm in comparison with cells treated with VEH for 3 days (Fig. 2A)Citation . MDA-MB-435 and MCF-7 cells treated with 5 µg/ml of VES for 1, 2, and 3 days accumulate fat droplets when compared with cells treated with VEH for 3 days (Fig. 2B)Citation . HMECs, MCF-10A, and T-47D cells did not show an increased accumulation of oil droplets after treatment with 5 and 10 µg/ml VES for 1–3 days, respectively (data not shown).



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 2. Staining of neutral lipids with Oil Red O in MDA-MB-435 and MCF-7 cells treated with VEH or VES. A, Oil Red O staining of MDA-MB-435 cells (upper panel) and MCF-7 cells (lower panel) treated with VEH or 5 or 10 µg/ml VES for 3 days. B, Oil Red O staining of MDA-MB-435 cells (upper panel) and MCF-7 cells (lower panel) treated with 5 µg/ml VES or VEH for 1, 2, or 3 days. Data are representative of multiple repeat experiments.

 
The percentage of cells staining positive for lipid droplet accumulation was determined by counting the number of adherent cells containing 10 or more Oil Red O-stained lipid droplets. After treatment with either 5 or 10 µg/ml VES, MDA-MB-435 cells exhibit 47 and 58% Oil Red O-positive cells after 1 day, 70 and 84% Oil Red O-positive cells after 2 days, and 65 and 90% Oil Red O-positive cells after 3 days, respectively. Vehicle control cells exhibited 17, 21, and 23% Oil Red O-positive cells after 1, 2, and 3 days of treatment, respectively (Fig. 3A)Citation . Likewise, the percentage of adherent MCF-7 cells staining positive for oil droplets after treatment with either 5 or 10 µg/ml VES increases with time (Fig. 3B)Citation , i.e., 21 and 32% Oil Red O-positive cells after 1 day, 47 and 50% Oil Red O-positive cells at 2 days, and 59 and 67% Oil Red O-positive after 3 days, respectively. Vehicle control-treated MCF-7 cells exhibited 10, 9, and 17% Oil Red O-positive cells after 1, 2, and 3 days, respectively (Fig. 3B)Citation .



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3. Percentage of Oil Red O-stained MDA-MB-435 (A) and MCF-7 cells (B) at 1, 2, and 3 days after treatment with VEH ({square}), 5 µg/ml VES ({blacksquare}), or 10 µg/ml VES (). Data are depicted as the means of three independent experiments; bars, SD.

 
Increase in ß-Casein mRNA as a Biomarker of VES-induced Differentiation.
Semiquantitative RT-PCR of ß-casein message showed that treatment of MDA-MB-435 and MCF-7 breast cancer cells with 10 µg/ml of VES for 3 days induced the expression of ß-casein message. HPRT mRNA levels were monitored as a control (Fig. 4A)Citation . ß-Casein message was not detectable in VEH control-treated MDA-MB-435 or MCF-7 cells (Fig. 4A)Citation .



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 4. Induction of ß-casein mRNA after VES treatment (A) and Western immunoblot analyses of various biomarkers correlated with differentiation (B). A, levels of ß-casein mRNA (top) or HPRT (used as a control to help quantify PCR reactions; bottom) generated by RT-PCR in MDA-MB-435 and MCF-7 cells after treatment for 3 days with either VEH or 10 µg/ml VES. Data are representative of three independent experiments. B, Western immunoblot analyses of various biomarkers correlated with differentiation were measured in MDA-MB-435 cells (B, left panel) and MCF-7 cells (B, right panel) after treatment with VEH or 10 µg/ml VES for 1 or 2 days unless otherwise designated. Expression of GAPDH protein was used as a control for verifying equal lane loads. Protein levels of PPAR{gamma}, ICAM-1, ß-catenin, cyclin D1, cytokeratin 18, and Her-2/neu/ErbB2 were measured using Western immunoblotting of total cell lysates. Data are representative of three independent experiments.

 
Expression of PPAR{gamma}, ICAM-1, ß-Catenin, Cyclin D1, Cytokeratin 18, and Her-2/neu Proteins in VES-induced Differentiation.
Western immunoblotting analyses of various proteins reported to be potential differentiation markers were conducted using total cell extracts obtained from MDA-MB-435 cells (Fig. 4BCitation , left panel) and MCF-7 cells (Fig. 4BCitation , right panel) after treatment with VEH or VES (10 µg/ml) for 1 or 2 days. Densitometric analyses of PPAR{gamma}, ICAM-1, ß-catenin, cyclin D1, and cytokeratin 18 from VES-treated MDA-MB-435 cells in comparison with VEH controls showed that after 1 and 2 days of treatment, PPAR{gamma} was increased 5.4% and decreased 21%; ICAM-1 was decreased 10.5 and increased 21%; ß-catenin was increased 33 and 16%; cyclin D1 was increased 75 and 98%; and cytokeratin 18 was increased 15 and 41%. Densitometric analyses of proteins from MCF-7 cells showed no major changes in any of these proteins. Analyses of CCAAT/enhancer binding protein {alpha}, maspin, and ß-casein proteins showed these proteins to be undetectable in both MDA-MB-435 cells and MCF-7 cells.

A faster migrating ICAM-1 band was observed in whole-cell lysates from MDA-MB-435 cells treated with VES in comparison to VEH-treated controls. The antibody used in the detection of ICAM-1 was a mouse monoclonal IgG2a antibody purchased from Santa Cruz Biotechnology, produced to an epitope corresponding to amino acids 258–365, which maps within the extracellular domain of ICAM-1 of human origin. Because ICAM-1/CD54 is a Mr 90,000 integral membrane glycoprotein, possible explanations for the faster migrating molecule are that it represents a non-ICAM-1-related molecule that is recognized by the antipeptide reagent, a breakdown product of ICAM-1, or because whole-cell extracts were analyzed, it could represent an intracellular precursor that has not been fully glycosylated.

Western immunoblot/enhanced chemiluminescence analyses of Her2/neu protein levels in whole-cell lysates obtained from MDA-MB-435 cells and MCF-7 cells showed reduced levels of Her-2/neu protein after treatment with 10 µg/ml of VES for 1 and 2 days (Fig. 4B)Citation . Equivalency of lane loads was established using GAPDH (Fig. 4B)Citation . Densitometric analyses of Her-2/neu from VES-treated MDA-MB-435, in comparison with VEH controls, showed that Her-2/neu on MDA-435 cells was reduced 5 and 61%, after 1 and 2 days of treatment, respectively. Likewise, densitometric analyses of Her-2/neu levels on MCF-7 cells, in comparison with VEH control, showed that Her-2/neu on MCF-7 cells was reduced 44, 69, and 71%, respectively, after 1, 2, and 3 days of treatment.

Inhibition of TGF-ß Signaling with TGF-ß Neutralizing Antibodies Fails to Block VES-induced Differentiation.
VEH or VES-treated MDA-MB-435 cells were cultured in the presence of TGF-ß neutralizing antibody or an irrelevant antibody and then analyzed 24 h later for accumulation of neutral lipid droplets with Oil Red O staining (Fig. 5A)Citation or analyzed for increase in expression of cytokeratin 18, a marker of epithelial cell differentiation by Western immunoblotting (Fig. 5B)Citation . Blockage of the TGF-ß signaling pathway with neutralizing antibody did not inhibit VES-induced lipid accumulation (Fig. 5A)Citation . Cytokeratin 18 expression in cells treated with both the TGF-ß neutralizing antibodies plus VES was reduced only slightly (~7%) when compared with cytokeratin 18 expression in cells treated with irrelevant antibody control plus VES.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. Assessment of VES-induced differentiation after functional knockout of TGF-ß signaling pathways using neutralizing antibodies to TGF-ß1. Differentiation was assessed in MDA-MB-435 cells by determining the percentage of adherent cells containing 10 or more lipid droplets after 24 h treatment with VEH or VES (10 µg/ml) in the absence or presence of either neutralizing antibodies to TGF-ß1 (1 µg/ml) or irrelevant antibodies. B, total cell extracts of MDA-MB-435 cells treated with 10 µg/ml VES, VES + irrelevant antibody, or VES + TGF-ß1 neutralizing antibody were analyzed by immunoblotting using monoclonal antibody to human cytokeratin 18 (K18; upper panel) or polyclonal antibody to GAPDH (lower panel). Data in A are presented as the means of three independent experiments (bars, SD), and data in B are representative of three independent experiments.

 
JNK Is Not Involved in VES-induced Differentiation.
To evaluate the role JNK might be playing in VES-induced differentiation, MDA-MB-435 cells stably transfected with an inducible (Tet-on), Flag-tagged, dominant-negative-acting mutant of JNK were used. VES (10 µg/ml) treatment of cells induced previously with doxycycline (2 µg/ml) or uninduced produced comparable amounts of differentiation, as judged by accumulation of lipid droplets (Fig. 6A)Citation . Expression of DN-JNK did not interfere with the ability of VES to induce cytokeratin 18 expression (Fig. 6BCitation , top panel), suggesting that JNK is not involved in VES-induced differentiation. Verification that doxycycline-treated cells were expressing DN-JNK comes from Western immunoblotting analyses showing two bands, one band corresponding to endogenous JNK1 and a slower migrating, Flag-tagged band, DN-JNK1 (Fig. 6BCitation , middle panel). GAPDH was used to determine equality of lane loads (Fig. 6BCitation , bottom panel).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 6. Assessment of VES-induced differentiation after blockage of JNK signaling by induction of DN-Flag-JNK(APF) with doxycycline. MDA-MB-435 cells stably transfected with DN-Flag-JNK(APF) were grown in the presence (+) or absence (-) of doxycycline (2 µg/ml) for 2 days prior to 24 h of treatment with VEH or VES (10 µg/ml). A, assessment of differentiation status by determining the percentage of adherent cells containing 10 or more lipid droplets. B, analyses of total cell extracts by Western immunoblotting using monoclonal antibody to human cytokeratin 18 (K18; upper panel), polyclonal antibody to endogenous or Flag-tagged JNK1 (middle panel), or polyclonal antibody to GAPDH as a loading control (bottom panel). Data in A are presented as the means of three independent experiments (bars, SD), and data in B are representative of three independent experiments.

 
ERK Is Involved in VES-induced Differentiation.
To evaluate the role ERK might be playing in VES-induced differentiation, MDA-MB-435 cells were treated with a chemical inhibitor of MEK1/2, PD98059, which blocks the activation, i.e., phosphorylation, of ERK1/2. When MDA-MB-435 cells cotreated with 10 µg/ml VES or VEH plus 12.5 µM PD98059 were analyzed for accumulation of lipid droplets, data show that PD98059 inhibited lipid accumulation in VES-treated cells (Fig. 7A)Citation . Combination treatments of VES and PD98059 were effective at inhibiting ERK1/2 phosphorylation (Fig. 7BCitation , second panel) but had no effect on ERK1/2 protein expression (Fig. 7BCitation , third panel). Evidence that PD98059 at 12.5, 25, and 50 µM produced a decrease of VES-induced differentiation as measured by cytokeratin 18 protein expression is depicted in Fig. 7BCitation , top panel.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 7. Assessment of VES-induced differentiation after blockage of ERK1/2 activation by MEK1 using the chemical inhibitor PD 98059. MDA-MB-435 cells were treated with 12.5 µM PD 98059 for 2 h before treatment with VEH or VES (10 µg/ml) for 24 h, and then cells were analyzed for lipid droplet accumulation using Oil Red O staining (A) or total cell extracts were analyzed by Western immunoblotting (B) for levels of cytokeratin 18 (K18; B, first panel); active dually phosphorylated ERK (pERK; B, second panel), ERK1/2 (B, third panel), or GAPDH (B, fourth panel). Data in A are presented as the means of three independent experiments (bars, SD), and data in B are representative of three independent experiments.

 

    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Studies reported here demonstrate that: (a) VES is a potent cellular differentiating agent for human MDA-MB-435 and MCF-7 breast cancer cells but not for HMECs, immortalized but nontumorigenic MCF-10A cells, or T-47D breast cancer cells; and (b) the ability of VES to induce differentiation does not appear to involve TGF-ß or JNK signaling but does depend on ERK signaling.

VES, a derivative of vitamin E, is currently being characterized for its chemotherapeutic and chemopreventive potential (5 , 71, 72, 73, 74) . VES has been shown to inhibit the proliferation of several transformed cell types, including human breast cancer cells (7, 8, 9, 10, 11, 12 , 20 , 71 , 74 , 75) . Previous studies have shown VES to inhibit tumor cell growth by a variety of mechanisms, including induction of apoptosis, cell cycle blockage, induced cellular differentiation, and DNA synthesis arrest (9 , 17 , 19 , 71 , 74, 75, 76) . VES is a potent inducer of apoptosis in human breast cancer cells, and it appears that several signaling events may be involved: TGF-ß, JNK, and Fas (CD95) signaling pathways (19 , 20 , 77 , 78) and inhibition of protein kinase C (75) . Because VES exhibits some biological properties in common with retinoids and deltanoids and because retinoids and 1{alpha},25-dihydroxyvitamin D3 have been reported to inhibit proliferation and induce differentiation of breast cancer cells, it was of interest to see whether VES could induce differentiation in human breast cancer cells (35 , 54 , 79 , 80) . VES induction of differentiation was verified by increased cell size, induction of neutral lipid droplets, induction of ß-casein message, and down-regulation of Her2/neu protein, characteristics that have been reported in the literature to be associated with differentiation of human breast cancer cells (23, 24, 25) .

This study suggests some interesting aspects of VES-induced differentiation: (a) estrogen responsive status does not appear to be important to VES-induced differentiation because VES was capable of inducing estrogen-responsive MCF-7 as well as estrogen nonresponsive MDA-MB-435 cells to undergo differentiation; and (b) VES is capable of inducing differentiation in cell lines where it is also a potent inducer of apoptosis (i.e., MCF-7 and MDA-MB-435 cells) but not in cell lines where it can induce DNA synthesis arrest but not apoptosis (i.e., HMECs, MCF-10A cells, and T-47D cells; Ref. 21 ).

Because VES produces pleiotrophic responses in human breast cancer cells leading to DNA synthesis arrest as well as apoptosis (reviewed in Ref. 71 ) and, as described here, cellular differentiation, it is important to consider the possible relationships between VES-induced differentiation and these other VES-mediated effects, i.e., DNA synthesis arrest and apoptosis. Under cell culture conditions similar to those used in the studies reported here (i.e., low serum: 2% FBS for MDA-MB-435 cells and 5% for MCF-7 cells in the studies reported here), VES inhibition of DNA synthesis as determined by [3H]thymidine uptake occurs within 24 h (11) . The possibility that VES may induce differentiation prior to apoptosis is supported by the following observations: (a) VES at 5 µg/ml, which induces differentiation within 1 day after treatment, does not induce apoptosis until after 3 days of treatment, and VES at 10 µg/ml, which induces differentiation within 1 day of treatment, does not induce apoptosis until 2 days after treatment, and then only approximately 20–35% of the total (adherent plus floating) cell population exhibit apoptotic morphology (21) ; (b) analyses of cellular differentiation by morphology and Oil Red O staining in the studies reported here analyzed adherent cells only (i.e., cells attached to glass coverslips). Because human breast cancer cells are adherent cells and because an early event in apoptosis of these cells is detachment (i.e., they float), we conclude that the cells analyzed for differentiation were either not undergoing apoptosis or were in very early stages of apoptosis prior to detachment; and (c) studies of signaling pathways involved in VES-induced events suggest that there is a clear distinction between molecular events important to VES-induced apoptosis and VES-induced differentiation because expression of a dominant-negative mutant to JNK1, which inhibits VES-induced apoptosis, has no effect on VES-induced differentiation (Fig. 6)Citation . Additionally, VES induction of the cyclin-dependent kinase inhibitor p21 (Waf1/Cip 1) contributes to VES-induced growth arrest and differentiation but not VES-induced apoptosis.4 Taken together, data suggest that VES induces MDA-MB-435 cells to undergo apoptosis either directly or after induction of DNA synthesis arrest and differentiation. At this time, we cannot distinguish between VES-induced DNA synthesis arrest and differentiation.

Mechanisms for how VES induces differentiation are not understood. Because TGF-ßs are multifunctional growth and differentiation factors (81 , 82) and because previous studies in our laboratory have demonstrated that VES increases the conversion of latent TGF-ß to biologically active TGF-ß, increases the expression of the type II TGF-ß cell surface receptors in human breast cancer cells (10 , 11) , and that TGF-ß signaling is critical to VES-induced apoptosis (19) , we wanted to see whether a functional knockout of TGF-ß using a neutralizing antibody would block VES-induced differentiation. No major effects on biomarkers of differentiation were observed after treatment of the cells with neutralizing antibody to TGF-ß. Although there was a slight decrease (~7%) in cytokeratin 18 protein expression after treatment of the cells with neutralizing antibody to TGF-ß, this slight decrease was not considered to be indicative of blockage of differentiation because there was no accompanying decrease in the other biomarker of differentiation monitored (i.e., lipid droplet expression) and because the 7% decrease in cytokeratin 18 protein expression was so much less that than observed when differentiation was blocked by the chemical inhibitor of MEK1/2 (PD98059), i.e., a 66–79% reduction.

Furthermore, previous studies in our laboratory have documented a critical role for JNK in VES-induced apoptosis (78) . Again, there appears to be a clear distinction between molecular events important to VES-induced apoptosis and VES-induced differentiation because expression of a dominant-negative mutant that inhibits VES-induced apoptosis has no effect on VES-induced differentiation. Although TGF-ß and JNK do not appear to be involved in VES-induced differentiation, ERK does appear to be involved. Inhibition of ERK1/2 phosphorylation by the chemical inhibitor PD 98059 was very effective in blocking VES-induced differentiation. We are currently studying ERK involvement in VES-mediated signaling. Studies by W. Yu et al. 5 show that VES treatment of MDA-MB-435 cells results in the activation of ERK1/2, as documented by detection of the active (phosphorylated) forms of these kinases using active ERK1/2-specific antibodies. VES induces early and sustained activation of ERK1/2 starting at 1 h, peaking at 2 h, and returning to barely detectable levels by 6 h after treatment.5 Furthermore, preliminary data show that transient transfection of MDA-MB-435 cells with a dominant-negative-acting ERK1 mutant will block VES-induced differentiation.6 Clarification of the contributions of ERK signaling to VES-induced differentiation will require further study.

In summary, VES, a derivative of vitamin E, was demonstrated to be a potent inducer of differentiation of human MDA-MB-435 and MCF-7 breast cancer cells. Normal HMECs, immortalized but nontumorigenic MCF-10A cells, and T-47D cancer cells were insensitive to VES-induced differentiation. The ability of VES to induce differentiation was not affected by blockage of TGF-ß or JNK signaling but was inhibited by blockage of ERK activation. Further investigations into the role ERK pathways play in VES-induced differentiation of human breast cancer cells are in progress.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Cell Culture and VES Treatments.
The MDA-MB-435 cell line (provided by Dr. Janet E. Price, Department of Cell Biology, University of Texas M. D. Anderson Cancer Center, Houston, TX) is a non-estrogen-responsive human breast cancer cell line. The MCF-7 cell line (provided by Dr. Suzanne Fuqua, University of Texas Health Sciences Center, San Antonio, TX) is an estrogen-responsive human breast cancer cell line. The T-47D cell line is an estrogen-responsive cell line derived from a pleural effusion of human mammary adenocarcinoma (American Type Culture Collection, Rockville, MD). MCF-10A is an immortalized, nontumorigenic breast cell line (American Type Culture Collection). HMECs were primary cultures of mammary cells derived from normal mammoplasty specimens (Cooperative Human Tissue Network Southern Division, Birmingham, AL). Cells were cultured as described previously (21) . For experiments, the percentage of fetal bovine serum was reduced to 2% for MDA-MB-435 cells and 5% for MCF-7 and T-47D cells. Cells in log phase were plated at 5 x 106 cells per T-75 flask for Western immunoblotting analyses and RNA isolation and at 3 x 105 cells/well in six-well plates (where a glass coverslip had been placed in each well) for Oil Red O staining and confocal microscopy analyses of cell morphology. Treatments were conducted at 5 or 10 µg/ml VES in 0.2% ethanol (final concentration, v/v) or VEH, which consisted of an equivalent amount of succinic acid in 0.2% ethanol. RRR-{alpha}-tocopheryl succinate and succinic acid were purchased from Sigma Chemical Co. (St. Louis, MO).

Evaluation of Differentiation: Morphological Evaluation of Unstained Cells and Oil Red O-stained Cells.
Cells grown on glass coverslips were treated with VES (5 or 10 µg/ml) or VEH (10 µg/ml) for 1, 2, or 3 days. Cells were fixed with 4% paraformaldehyde at 4°C overnight. After washing three times with PBS (137 mM NaCl, 3 mM KCl, and 5 mM Na2HPO4, pH 7.4), cells were stained with Oil Red O (Sigma Chemical Co.) for 10 min according to published procedures (81) . Cells were then counterstained with Mayer’s hematoxylin solution (Sigma Chemical Co.) for 5 min, and each coverslip was mounted onto a glass slide. Specimens were examined and photographed at x1000 using a Zeiss microscope. By counting the number of adherent cells containing 10 or more Oil Red O-stained lipid droplets, the percentage of cells staining positive for lipid droplet accumulation after treatment was determined.

Semiquantitative RT-PCR Analyses of ß-Casein mRNA.
RNA was isolated using the RNeasy Mini RNA isolation kit (Qiagen USA, Valencia, CA) according to the manufacturer’s instructions. Approximately 5 µg of total RNA were converted to first-strand cDNA using an oligo(dT)12–18 primer and the SuperScript II preamplification system (Life Technologies, Inc., Grand Island, NY) per the manufacturer’s instructions. An assay without addition of reverse transcriptase was conducted to verify that genomic DNA was not being amplified. After inactivation, samples were stored at -20°C. Semiquantitative RT-PCR was performed by mixing 10% of each cDNA reaction (from RT-PCR) into a final volume of 50 µl of PCR reaction mixture containing a final concentration of 200 µM deoxynucleotide triphosphates, 1x Expand High Fidelity buffer (Boehringer Mannheim, Indianapolis, IN), with 1.5 mM MgCl2, 300 nM ß-casein forward amplification primer (5'-CTGCCTGGTGGCTCTTGCTCTT-3'), 300 nM reverse amplification primer (5'-TGGGGGATAGGCAGGACTTTGG-3'), HPRT sense TATGGACAGGACTGAACGTCTTGC, or HPRT antisense GACACAAACATGATTCAAATCCCTGA (Operon Technologies, Alameda, CA), 2.6 units of Expand High Fidelity PCR System enzyme mix, and two drops of silicone oil. Reactions were heated to 94°C for 3 min and then subjected to 30 cycles of denaturation for 30 s at 94°C, annealing for 60 s at 60° C, and extension for 60 s at 72°C. Amplification products were electrophoresed on a 1% agarose gel and visualized by ethidium bromide staining. The ß-casein is represented by a 522-bp band, and the HPRT message is represented by a 496-bp band.

Western Blot Analyses.
HER-2/neu, PPAR{gamma}, ICAM-1, ß-catenin, cyclin D1, cytokeratin 18, active/phosphorylated ERK, ERK1/2, JNK1, and GAPDH were detected in total cell extracts by Western immunoblotting analyses performed as described previously (21) . Total cell protein extracts were prepared as described previously (11) . After washing twice with PBS, the cells were lysed with lysis buffer (1x PBS, 1% NP40, 0.5% sodium deoxycholate, and 0.1% SDS) plus 1 µg/ml of aprotinin and leupeptin, 1 mM DTT, and 2 mM sodium orthovanadate, and incubated on ice for 30 min. Lysates were then centrifuged at 15,000 x g for 15 min at 4°C. Protein concentrations were determined using the Bio-Rad Dye Binding protein assay (Bio-Rad Laboratories, Hercules, CA). Fifty to 150 µg of protein was loaded per well, separated on a SDS-PAGE gradient gel (6, 10, and 15%) for HER-2/neu and 10 or 12% SDS-PAGE for other proteins, electrophoresed under reducing conditions and electroblotted onto a nitrocellulose membrane (Optitran BA-S supported nitrocellulose for 0.2 µm pore; Schleicher and Schuell, Keene, NH). Equal loading was verified using a rabbit GAPDH antibody (produced in our laboratory). Immunoblotting was performed using antibodies specific for the various proteins: rabbit-antihuman HER-2/neu receptor antibody; rabbit-anti-PPAR{gamma}; mouse monoclonal antibody to ICAM-1; rabbit anti-cyclin D1; rabbit anti-ERK1/2; and rabbit anti-JNK1 (all purchased from Santa Cruz Biotechnology, Inc., Santa Cruz Biotechnology, CA); mouse monoclonal antibody to ß-catenin (BD Transduction Laboratories, Lexington, KY); mouse monoclonal antihuman cytokeratin peptide 18 (Sigma Chemical Co.); and rabbit antibodies for active ERK (Santa Cruz Biotechnology). Peroxidase-conjugated goat antirabbit antibody or peroxidase-conjugated rabbit-antimouse was used as secondary antibodies (Jackson Immunoresearch Laboratory, West Grove, PA), followed by detection with enhanced chemiluminescence (ECL; Pierce, Rockford, IL). Protein levels were quantified by densitometric analyses and normalized for loading differences using GAPDH control levels.

Blockage of VES-induced Differentiation with Neutralizing Antibodies to TGF-ß1.
MDA-MB-435 at 1.5 x 105 cells/ml in culture media containing 2% FCS were treated with 5 and 10 µg/ml of VES or VEH and cultured for 1 or 2 days with 1 µg/ml TGF-ß1 neutralizing antibody (R&D Systems, Minneapolis, MN). Equal amounts of irrelevant chicken immunoglobulins (chicken IgY) served as controls (R&D Systems). Cells were harvested after 24 h and evaluated for inhibition of lipid droplet accumulation or reduction in induction of cytokeratin 18 expression as evidence of blockage of VES-induced differentiation.

Stable Transfection of Cells with DN-JNK1 Inducible (TET-on) Construct.
MDA-MB-435 cells were stably transfected with a TET-on inducible expression plasmid (Clontech) and TRE-Flag-JNK1(APF) plasmid, encoding DN-JNK1(APF) [produced in-house using the Clontech system (#K1620-1)]. The DN-JNK1 construct [pcDNA3-Flag-JNK1(APF)], which has the tyrosine-185 and threonine-183 amino acids that require phosphorylation for activity replaced with alanine and phenylalanine, respectively, was the kind gift of Dr. Roger J. Davis, Howard Hughes Medical Institute, University of Massachusetts Medical School, Worcester, MA (82) . To generate inducible clones, MDA-MB-435 cells were first transfected with the pTet-On vector, and stable clones were selected by growing the cells in the presence of 0.5 mg/ml of G418 (Sigma Chemical Co.) as selective antibiotic, followed by transfection with pTRE-DN-JNK1(APF) and selection of stably transfected clones using 0.5 mg/ml of G418 and 0.2 mg/ml of hygromycin B (Clontech) as selective antibiotics. Transfections were performed using LipofectAMINE and PlusTM Reagent (Life Technologies, Inc., Grand Island, NY), following the manufacturer’s instructions. Inducible clones were screened by Western immunoblot analyses to determine levels of endogenous JNK1 and Flag-tagged-DN-JNK1 expression after 2 µg/ml of doxycycline (Clontech, Palo Alto, CA) treatment for 2 days.

Inhibition of ERK1/2 Activation (Phosphorylation) with PD 98059.
MEK1 inhibitor PD98059 (2'-amino-3'methoxyflavone; Calbiochem-Novabiochem International, La Jolla, CA) was used to selectively block the activity of MEK by inhibiting the activation of ERK1/2. MDA-MB-435 cells were plated at 3 x 105 cells/well of six-well plates containing one coverslip/well or 1.67 x 106 cells/T-25 flask for Western immunoblotting overnight and then treated with VEH or 6.25, 12.5, 25, or 50 µM PD 98059 in the dark and incubated at normal culture conditions for 2 h. After the 2-h incubation with the chemical inhibitor, VES (10 µg/ml) or VEH treatments were added. For assessment of active, dually phosphorylated ERK by Western immunoblotting, samples were collected 2 h after VES or VEH treatment. For cytokeratin 18 Western immunoblotting analyses and Oil Red O staining, samples were collected or fixed after 24 h of treatment.


    Acknowledgments
 
We thank Dr. Janet Price, Department of Cell Biology, University of Texas M. D. Anderson Cancer Center, Houston Texas, for giving us the MDA-MB-435 cells; Dr. Suzanne Fuqua, University of Texas Health Sciences Center, San Antonio, TX, for giving us the MCF-7 (McGuire) cells; and Dr. J. Roger Davis, Howard Hughes Medical Institute, University of Massachusetts Medical School, Worcester, MA, for giving us Flag-tagged DN-JNK(APF).


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by USPHS Grant CA59739 from the National Cancer Institute and a grant from the Foundation for Research. Back

2 To whom requests for reprints should addressed, at Division of Nutrition/A2703, University of Texas at Austin, Austin, TX 78712-1097. Phone: (512) 471-8911; Fax: (512) 232-7040; E-mail: k.kline{at}mail.utexas.edu Back

3 The abbreviations used are: VES, vitamin E succinate (RRR-{alpha}-tocopheryl succinate); EGFR, epidermal growth factor receptor; HMEC, human mammary epithelial cell; ICAM-1, intercellular adhesion molecule-1; PPAR{gamma}, peroxisome proliferator-activated receptor {gamma}; ERK, extracellular signal-regulated kinase; TGF, transforming growth factor; JNK, c-Jun NH2-terminal kinase; RT-PCR, reverse transcription-PCR; HPRT, hypoxanthine phosphoribosyl transferase; VEH, vehicle; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MEK, mitogen-activated protein kinase kinase. Back

4 W. Yu, B. G. Sanders, and K. Kline and H. You, Q. Yu, P. H. Brown, B. G. Sanders, and K. Kline, unpublished data. Back

5 W. Yu, Q. Y. Liao, F. M. Hantash, B. G. Sanders, and K. Kline. Activation of extracellular signal-regulated kinase and c-Jun-NH2-terminal kinase but not p38 mitogen-activated protein kinases is required for RRR-{alpha}-tocopheryl succinate-induced apoptosis of human breast cancer cells, submitted for publication. Back

6 H. You, Q. Yu, P. H. Brown, B. G. Sanders, and K. Kline, unpublished data. Back

Received for publication 4/11/01. Revision received 6/ 8/01. Accepted for publication 6/14/01.


    References
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Sartorelli A. C. Malignant cell differentiation as a potential therapeutic approach. Br. J. Cancer, 52: 293-302, 1985.[Medline]
  2. Degos L., Dombret H., Chomienne C., Daniel M. T., Miclea J. M., Chastang C., Castaigne S., Fenaux P. All-trans-retinoic acid as a differentiating agent in the treatment of acute promyelocytic leukemia. Blood, 85: 2643-2653, 1995.[Free Full Text]
  3. James S. Y., Williams M. A., Newland A. C., Colston K. W. Leukemia cell differentiation: cellular and molecular interactions of retinoids and vitamin D. Gen. Pharmacol., 32: 143-154, 1999.[Medline]
  4. Jansen J. H., de Ridder M. C., Geertsma W. M., Erpelinck C. A., van Lom K., Smit E. M., Slater R., de Reijden B. A., de Greef G. E., Sonneveld P., Lowenberg B. Complete remission of t(11;17) positive acute promyelocytic leukemia induced by all-trans retinoic acid and granulocyte colony-stimulating factor. Blood, 94: 39-45, 1999.[Abstract/Free Full Text]
  5. Kelloff G. J., Crowell J. A., Boone C. W., Steele V. E., Lubet R. A., Greenwald P., Alberts D. S., Covey J. M., Doody L. A., Knapp G. G., Nayfield S., Parkinson D. R., Prasad V. K., Prorok P. C., Sausville E. A., Sigman C. C. Clinical development plan: vitamin E. J. Cell Biochem. Suppl., 20: 282-299, 1994.[Medline]
  6. Israel K., Sanders B. G., Kline K. RRR-{alpha}-Tocopheryl succinate inhibits the proliferation of human prostatic tumor cells with defective cell cycle/differentiation pathways. Nutr. Cancer, 24: 161-169, 1995.[Medline]
  7. Kline K., Yu W., Sanders B. G. Vitamin E: mechanisms of action as tumor cell growth inhibitors Prasad K. N. Cole W. C. eds. . Cancer and Nutrition, : 37-53, 105 Press Amsterdam 1998.
  8. Kline K., Yu W., Zhao B., Israel K., Charpentier A., Simmons-Menchaca M., Sanders B. G. . Vitamin E succinate: mechanisms of action as tumor cell growth inhibitor, : 39-56, Humana Press, Inc., NY Totowa, NY 1995.
  9. Prasad K. N., Edwards-Prasad J. Vitamin E and cancer prevention: recent advances and future potentials. J. Am. Coll. Nutr., 11: 487-500, 1992.[Abstract]
  10. Charpentier A., Groves S., Simmons-Menchaca M., Turley J., Zhao B., Sanders B. G., Kline K. RRR-{alpha}-Tocopheryl succinate inhibits proliferation and enhances secretion of transforming growth factor-ß (TGF-ß) by human breast cancer cells. Nutr. Cancer, 19: 225-239, 1993.[Medline]
  11. Charpentier A., Simmons-Menchaca M., Yu W., Zhao B., Qian M., Heim K., Sanders B. G., Kline K. RRR-{alpha}-Tocopheryl succinate enhances TGF-ß1, -ß2, and -ß3 and TGF-ß R-II expression by human MDA-MB-435 breast cancer cells. Nutr. Cancer, 26: 237-250, 1996.[Medline]
  12. Schwartz J., Shklar G. The selective cytotoxic effect of carotenoids and {alpha}-tocopherol on human cancer cell lines in vitro. J. Oral Maxillofac. Surg., 50: 367-373, 1992.[Medline]
  13. Kline K., Cochran G. S., Sanders B. G. Growth-inhibitory effects of vitamin E succinate on retrovirus-transformed tumor cells in vitro. Nutr. Cancer, 14: 27-41, 1990.[Medline]
  14. Turley J. M., Sanders B. G., Kline K. RRR-{alpha}-Tocopheryl succinate modulation of human promyelocytic leukemia (HL-60) cell proliferation and differentiation. Nutr. Cancer, 18: 201-213, 1992.[Medline]
  15. Simmons-Menchaca M., Qian M., Yu W., Sanders B. G., Kline K. RRR-{alpha}-Tocopheryl succinate inhibits DNA synthesis and enhances the production and secretion of biologically active transforming growth factor-ß by avian retrovirus-transformed lymphoid cells. Nutr. Cancer, 24: 171-185, 1995.[Medline]
  16. Prasad K. N., Cohrs R. J., Sharma O. K. Decreased expressions of c-myc and H-ras oncogenes in vitamin E succinate induced morphologically differentiated murine B-16 melanoma cells in culture. Biochem. Cell Biol., 68: 1250-1255, 1990.[Medline]
  17. Turley J. M., Funakoshi S., Ruscetti F. W., Kasper J., Murphy W. J., Longo D. L., Birchenall-Roberts M. C. Growth inhibition and apoptosis of RL human B lymphoma cells by vitamin E succinate and retinoic acid: role for transforming growth factor ß. Cell Growth Differ., 6: 655-663, 1995.[Abstract]
  18. Qian M., Sanders B. G., Kline K. RRR-{alpha}-Tocopheryl succinate induces apoptosis in avian retrovirus-transformed lymphoid cells. Nutr. Cancer, 25: 9-26, 1996.[Medline]
  19. Yu W., Heim K., Qian M., Simmons-Menchaca M., Sanders B. G., Kline K. Evidence for role of transforming growth factor-ß in RRR-{alpha}-tocopheryl succinate-induced apoptosis of human MDA-MB-435 breast cancer cells. Nutr. Cancer, 27: 267-278, 1997.[Medline]
  20. Turley J. M., Fu T., Ruscetti F. W., Mikovits J. A., Bertolette D. C., Birchenall-Roberts M. C. Vitamin E succinate induces Fas-mediated apoptosis in estrogen receptor-negative human breast cancer cells. Cancer Res., 57: 881-890, 1997.[Abstract/Free Full Text]
  21. Yu W., Israel K., Liao Q. Y., Aldaz C. M., Sanders B. G., Kline K. Vitamin E succinate (VES) induces Fas sensitivity in human breast cancer cells: role for Mr 43,000 Fas in VES-triggered apoptosis. Cancer Res., 59: 953-961, 1999.[Abstract/Free Full Text]
  22. Prasad K. N., Edwards-Prasad J. Effects of tocopherol (vitamin E) acid succinate on morphological alterations and growth inhibition in melanoma cells in culture. Cancer Res., 42: 550-555, 1982.[Abstract/Free Full Text]
  23. Guilbaud N. F., Gas N., Dupont M. A., Valette A. Effects of differentiation-inducing agents on maturation of human MCF-7 breast cancer cells. J. Cell. Physiol., 145: 162-172, 1990.[Medline]
  24. Kiguchi K., Giometti C., Chubb C. H., Fujiki H., Huberman E. Differentiation induction in human breast tumor cells by okadaic acid and related inhibitors of protein phosphatases 1 and 2A. Biochem. Biophys. Res. Commun., 189: 1261-1267, 1992.[Medline]
  25. Bacus S. S., Kiguchi K., Chin D., King C. R., Huberman E. Differentiation of cultured human breast cancer cells (AU-565 and MCF-7) associated with loss of cell surface HER-2/neu antigen. Mol. Carcinog., 3: 350-362, 1990.[Medline]
  26. Munster P. N., Srethapakdi M., Moasser M. M., Rosen N. Inhibition of heat shock protein 90 function by ansamycins causes the morphological and functional differentiation of breast cancer cells. Cancer Res., 61: 2945-2952, 2001.[Abstract/Free Full Text]
  27. Li M., Spitzer E., Zschiesche W., Binas B., Parczyk K., Grosse R. Antiprogestins inhibit growth and stimulate differentiation in the normal mammary gland. J. Cell. Physiol., 164: 1-8, 1995.[Medline]
  28. Lee P. P., Lee M. T., Darcy K. M., Shudo K., Ip M. M. Modulation of normal mammary epithelial cell proliferation, morphogenesis, and functional differentiation by retinoids: a comparison of the retinobenzoic acid derivative RE80 with retinoic acid. Endocrinology, 136: 1707-1717, 1995.[Abstract]
  29. Guyette W. A., Matusik R. J., Rosen R. M. Prolactin-mediated transcriptional and posttranscriptional control of casein gene expression. Cell, 17: 1013-1023, 1979.[Medline]
  30. Blackburn D. E., Hobbs A. A., Rosen J. M. Rat ß-casein cDNA: sequence analysis and evolutionary comparisons. Nucleic Acids Res., 10: 2295-2307, 1982.[Abstract/Free Full Text]
  31. Monaco M. E., Bronzert D. A., Tormey D. C., Waalkes P., Lippman M. E. Casein production by human breast cancer. Cancer Res., 37: 749-754, 1977.[Abstract/Free Full Text]
  32. Earl H. M., McIlhinney R. A., Wilson P., Gusterson B. A., Coombes R. C. Immunohistochemical study of ß- and {kappa}-casein in the human breast and breast carcinomas, using monoclonal antibodies. Cancer Res., 49: 6070-6076, 1989.[Abstract/Free Full Text]
  33. Bartkova J., Burchell J., Bartek J., Vojtesek B., Taylor-Papadimitriou J., Rejthar A., Staskova Z., Kovarik J. Lack of ß-casein production by human breast tumours revealed by monoclonal antibodies. Eur. J. Cancer Clin. Oncol., 23: 1557-1563, 1987.[Medline]
  34. Bacus S. S., Stancovski I., Huberman E., Chin D., Hurwitz E., Mills G. B., Ullrich A., Sela M., Yarden Y. Tumor-inhibitory monoclonal antibodies to the HER-2/Neu receptor induce differentiation of human breast cancer cells. Cancer Res., 52: 2580-2589, 1992.[Abstract/Free Full Text]
  35. Bacus S. S., Huberman E., Chin D., Kiguchi K., Simpson S., Lippman M., Lupu R. A ligand for the erbB-2 oncogene product (gp30) induces differentiation of human breast cancer cells. Cell Growth Differ., 3: 401-411, 1992.[Abstract]
  36. Elstner E., Linker-Israeli M., Said J., Umiel T., de Vos S., Shintaku I. P., Heber D., Binderup L., Uskokovic M., Koeffler H. P. 20-epi-vitamin D3 analogues: a novel class of potent inhibitors of proliferation and inducers of differentiation of human breast cancer cell lines. Cancer Res., 55: 2822-2830, 1995.[Abstract/Free Full Text]
  37. Constantinou A. I., Krygier A. E., Mehta R. R. Genistein induces maturation of cultured human breast cancer cells and prevents tumor growth in nude mice. Am. J. Clin. Nutr., 68: 1426S-1430S, 1998.[Abstract]
  38. Lopez-Boado Y. S., Tolivia J., Lopez-Otin C. Apolipoprotein D gene induction by retinoic acid is concomitant with growth arrest and cell differentiation in human breast cancer cells. J. Biol. Chem., 269: 26871-26878, 1994.[Abstract/Free Full Text]
  39. Coussens L., Yang-Feng T. L., Liao Y. C., Chen E., Gray A., McGrath J., Seeburg P. H., Libermann T. A., Schlessinger J., Francke U., Levinson A., Ullrich A. Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene. Science (Wash. DC), 230: 1132-1139, 1985.[Abstract/Free Full Text]
  40. Tzahar E., Yarden Y. The ErbB-2/HER2 oncogenic receptor of adenocarcinomas: from orphanhood to multiple stromal ligands. Biochem. Biophys. Acta, 1377: M25-M37, 1998.[Medline]
  41. Slamon D. J., Godolphin W., Jones L. A., Holt J. A., Wong S. G., Keith D. E., Levin W. J., Stuart S. G., Udove J., Ullrich A., Press M. F. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science (Wash. DC), 244: 707-712, 1989.[Abstract/Free Full Text]
  42. Kraus M. H., Popescu N. C., Amsbaugh S. C., King C. R. Overexpression of the EGF receptor-related proto-oncogene erbB-2 in human mammary tumor cell lines by different molecular mechanisms. EMBO J., 6: 605-610, 1987.[Medline]
  43. Slamon D. J., Clark G. M., Wong S. G., Levin W. J., Ullrich A., McGuire W. L. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science (Wash. DC), 235: 177-182, 1987.[Abstract/Free Full Text]
  44. Brandt-Rauf P. W. Biomarkers of gene expression: growth factors and oncoproteins. Environ. Health Perspect., 105 (Suppl. 4): 807-816, 1997.
  45. Dickson R. B., Lippman M. E. Growth factors in breast cancer. Endocr. Rev., 16: 559-589, 1995.[Medline]
  46. Harari D., Yarden Y. Molecular mechanisms underlying ErbB2/HER2 action in breast cancer. Oncogene, 19: 6102-6114, 2000.[Medline]
  47. Staebler A., Sommers C., Mueller S. C., Byers S., Thompson E. W., Lupu R. Modulation of breast cancer progression and differentiation by the gp30/heregulin[correction of neuregulin]. Breast Cancer Res. Treat., 31: 175-182, 1994.[Medline]
  48. Wen D., Peles E., Cupples R., Suggs S. V., Bacus S. S., Luo Y., Trail G., Hu S., Silbiger S. M., Levy R. B., Koski R. A., Lu H. S., Yarden Y. Neu differentiation factor: a transmembrane glycoprotein containing an EGF domain and an immunoglobulin homology unit. Cell, 69: 559-572, 1992.[Medline]
  49. Peles E., Bacus S. S., Koski R. A., Lu H. S., Wen D., Ogden S. G., Levy R. B., Yarden Y. Isolation of the neu/HER-2 stimulatory ligand: a 44 kd glycoprotein that induces differentiation of mammary tumor cells. Cell, 69: 205-216, 1992.[Medline]
  50. Han E. K., Begemann M., Sgambato A., Soh J. W., Doki Y., Xing W. Q., Liu W., Weinstein I. B. Increased expression of cyclin D1 in a murine mammary epithelial cell line induces p27kip1, inhibits growth, and enhances apoptosis. Cell Growth Differ., 7: 699-710, 1996.[Abstract]
  51. Wang T. C., Cardiff R. D., Zukerberg L., Lees E., Arnold A., Schmidt E. V. Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature (Lond.), 369: 669-671, 1994.[Medline]
  52. Sicinski P., Donaher J. L., Parker S. B., Li T., Fazeli A., Gardner H., Haslam S. Z., Bronson R. T., Elledge S. J., Weinberg R. A. Cyclin D1 provides a link between development and oncogenesis in the retina and breast. Cell, 82: 621-630, 1995.[Medline]
  53. Fantl V., Stamp G., Andrews A., Rosewell I., Dickson C. Mice lacking cyclin D1 are small and show defects in eye and mammary gland development. Genes Dev., 9: 2364-2372, 1995.[Abstract/Free Full Text]
  54. Seewaldt V. L., Kim J. H., Parker M. B., Dietze E. C., Srinivasan K. V., Caldwell L. E. Dysregulated expression of cyclin D1 in normal human mammary epithelial cells inhibits all-trans-retinoic acid-mediated G0/G1-phase arrest and differentiation in vitro. Exp. Cell Res., 249: 70-85, 1999.[Medline]
  55. Jing J., Zhang J., Waxman S., Mira-y-Lopez R. Upregulation of cytokeratin 8 and 18 in human breast cancer T47D cells is retinoid-specific and retinoic acid receptor-dependent. Differentiation, 60: 109-117, 1996.[Medline]
  56. Sommers C. L., Heckford S. E., Skerker J. M., Worland P., Torri J. A., Thompson E. W., Byers S. W., Gelmann E. P. Loss of epithelial markers and acquisition of vimentin expression in Adriamycin- and vinblastine-resistant human breast cancer cell lines. Cancer Res., 52: 5190-5197, 1992.[Abstract/Free Full Text]
  57. Spancake K. M., Anderson C. B., Weaver V. M., Matsunami N., Bissell M. J., White R. L. E7-transduced human breast epithelial cells show partial differentiation in three-dimensional culture. Cancer Res., 59: 6042-6045, 1999.[Abstract/Free Full Text]
  58. Schaller G., Fuchs I., Pritze W., Ebert A., Herbst H., Pantel K., Weitzel H., Lengyel E. Elevated keratin 18 protein expression indicates a favorable prognosis in patients with breast cancer. Clin. Cancer Res., 2: 1879-1885, 1996.[Abstract]
  59. Buehler H., Becker C., Fuchs I., Schaller G. A subclone of the aggressive breast cancer cell line MDA-MB-231 with strongly increased expression of the cytoskeletal protein keratin 18 shows dramatically reduced tumorigenicity and invasiveness. Proc. Am. Assoc. Cancer Res., 41: 366 2000.
  60. Chen X., Levkowitz G., Tzahar E., Karunagaran D., Lavi S., Ben-Baruch N., Leitner O., Ratzkin B. J., Bacus S. S., Yarden Y. An immunological approach reveals biological differences between the two NDF/heregulin receptors, ErbB-3 and ErbB-4. J. Biol. Chem., 271: 7620-7629, 1996.[Abstract/Free Full Text]
  61. Bacus S. S., Gudkov A. V., Zelnick C. R., Chin D., Stern R., Stancovski I., Peles E., Ben-Baruch N., Farbstein H., Lupu R., Wen D., Sela M., Yarden Y. Neu differentiation factor (heregulin) induces expression of intercellular adhesion molecule 1: implications for mammary tumors. Cancer Res., 53: 5251-5261, 1993.[Abstract/Free Full Text]
  62. Grunberg E., Eckert K., Karsten U., Maurer H. R. Effects of differentiation inducers on cell phenotypes of cultured nontransformed and immortalized mammary epithelial cells: a comparative immunocytochemical analysis. Tumour Biol., 21: 211-223, 2000.[Medline]
  63. Baj G., Arnulfo A., Deaglio S., Tibaldi E., Surico N., Malavasi F. All-trans retinoic acid inhibits the growth of breast cancer cells by up-regulating ICAM-1 expression. J. Biol. Regul. Homeostatic Agents, 13: 115-122, 1999.
  64. Ogawa Y., Hirakawa K., Nakata B., Fujihara T., Sawada T., Kato Y., Yoshikawa K., Sowa M. Expression of intercellular adhesion molecule-1 in invasive breast cancer reflects low growth potential, negative lymph node involvement, and good prognosis. Clin. Cancer Res., 4: 31-36, 1998.[Abstract]
  65. Mehta R. R., Bratescu L., Graves J. M., Green A., Mehta R. G. Differentiation of human breast carcinoma cells by a novel vitamin D analog: 1{alpha}-hydroxyvitamin D5. Int. J. Oncol., 16: 65-73, 2000.[Medline]
  66. Byers S., Pishvaian M., Crockett C., Peer C., Tozeren A., Sporn M., Anzano M., Lechleider R. Retinoids increase cell-cell adhesion strength, ß-catenin protein stability, and localization to the cell membrane in a breast cancer cell line: a role for serine kinase activity. Endocrinology, 137: 3265-3273, 1996.[Abstract]
  67. Rosen J. M., Wyszomierski S. L., Hadsell D. Regulation of milk protein gene expression. Annu. Rev. Nutr., 19: 407-436, 1999.[Medline]
  68. Rosen J. M., Zahnow C., Kazansky A., Raught B. Composite response elements mediate hormonal and developmental regulation of milk protein gene expression. Biochem. Soc. Symp., 63: 101-113, 1998.[Medline]
  69. Mueller E., Sarraf P., Tontonoz P., Evans R. M., Martin K. J., Zhang M., Fletcher C., Singer S., Spiegelman B. M. Terminal differentiation of human breast cancer through PPAR{gamma}. Mol. Cell, 1: 465-470, 1998.[Medline]
  70. Elstner E., Muller C., Koshizuka K., Williamson E. A., Park D., Asou H., Shintaku P., Said J. W., Heber D., Koeffler H. P. Ligands for peroxisome proliferator-activated receptor {gamma} and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and in BNX mice. Proc. Natl. Acad. Sci. USA, 95: 8806-8811, 1998.[Abstract/Free Full Text]
  71. Kline K., Yu W., Sanders B. G. Vitamin E: mechanisms of action as tumor cell growth inhibitors. J. Nutr., 131: 161S-163S, 2001.[Free Full Text]
  72. Malafa M. P., Neitzel L. T. Vitamin E succinate promotes breast cancer tumor dormancy. J. Surg. Res., 93: 163-170, 2000.[Medline]
  73. Djuric Z., Heilbrun L. K., Lababidi S., Everett-Bauer C. K., Fariss M. W. Growth inhibition of MCF-7 and MCF-10A human breast cells by {alpha}-tocopheryl hemisuccinate, cholesteryl hemisuccinate and their ether analogs. Cancer Lett., 111: 133-139, 1997.[Medline]
  74. Neuzil J., Weber T., Gellert N., Weber C. Selective cancer cell killing by {alpha}-tocopheryl succinate. B. J. Cancer, 84: 87-89, 2000.
  75. Neuzil J., Weber T., Schroder A., Lu M., Ostermann G., Gellert N., Mayne G. C., Olejnicka B., Negre-Salvayre A., Sticha M., Coffey R. J., Weber C. Induction of cancer cell apoptosis by {alpha}-tocopheryl succinate: molecular pathways and structural requirements. FASEB J., 15: 403-415, 2001.[Abstract/Free Full Text]
  76. Cohrs R. J., Torelli S., Prasad K. N., Edwards-Prasad J., Sharma O. K. Effect of vitamin E succinate and a cAMP-stimulating agent on the expression of c-myc and N-myc and H-ras in murine neuroblastoma cells. Int. J. Dev. Neurosci., 9: 187-194, 1991.[Medline]
  77. Zhao B., Yu W., Qian M., Simmons-Menchaca M., Brown P., Birrer M. J., Sanders B. G., Kline K. Involvement of activator protein-1 (AP-1) in induction of apoptosis by vitamin E succinate in human breast cancer cells. Mol. Carcinog., 19: 180-190, 1997.[Medline]
  78. Yu W., Simmons-Menchaca M., You H., Brown P., Birrer M. J., Sanders B. G., Kline K. RRR-{alpha}-Tocopheryl succinate induction of prolonged activation of c-jun amino-terminal kinase and c-jun during induction of apoptosis in human MDA-MB-435 breast cancer cells. Mol. Carcinog., 22: 247-257, 1998.[Medline]
  79. Colson K., Berger U., Coombes R. Possible role for vitamin D in controlling breast cancer cells proliferation. Lancet, 28: 188-191, 1989.
  80. Frappart L., Falette N., Lefebvre M. F., Bremond A., Vauzelle J. L., Saez S. In vitro study of effects of 1,25-dihydroxyvitamin D3 on the morphology of human breast cancer cell line BT.20. Differentiation, 40: 63-69, 1989.[Medline]
  81. Massagué J. The transforming growth factor-ß family. Annu. Rev. Cell Biol., 6: 597-641, 1990.
  82. Roberts A. Molecular and cell biology of TGF-ß. Miner. Electrolyte Metab., 24: 111-119, 1990.
  83. Lillie R. D. . Histopathologic Technique and Practical Histochemistry, McGraw-Hill Book Co. New York 1965.
  84. Derijard B., Hibi M., Wu I. H., Barrett T., Su B., Deng T., Karin M., Davis R. J. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 76: 1025-1037, 1994.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
C. E. Horak, J. H. Lee, A. G. Elkahloun, M. Boissan, S. Dumont, T. K. Maga, S. Arnaud-Dabernat, D. Palmieri, W. G. Stetler-Stevenson, M.-L. Lacombe, et al.
Nm23-H1 Suppresses Tumor Cell Motility by Down-regulating the Lysophosphatidic Acid Receptor EDG2
Cancer Res., August 1, 2007; 67(15): 7238 - 7246.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. Neuzil, M. Tomasetti, Y. Zhao, L.-F. Dong, M. Birringer, X.-F. Wang, P. Low, K. Wu, B. A. Salvatore, and S. J. Ralph
Vitamin E Analogs, a Novel Group of "Mitocans," as Anticancer Agents: The Importance of Being Redox-Silent
Mol. Pharmacol., May 1, 2007; 71(5): 1185 - 1199.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Bandyopadhyay, J. K. Agyin, L. Wang, Y. Tang, X. Lei, B. M. Story, J. E. Cornell, B. H. Pollock, G. R. Mundy, and L.-Z. Sun
Inhibition of Pulmonary and Skeletal Metastasis by a Transforming Growth Factor-{beta} Type I Receptor Kinase Inhibitor.
Cancer Res., July 1, 2006; 66(13): 6714 - 6721.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Donapaty, S. Louis, E. Horvath, J. Kun, S. M. Sebti, and M. P. Malafa
RRR-{alpha}-Tocopherol succinate down-regulates oncogenic Ras signaling.
Mol. Cancer Ther., February 1, 2006; 5(2): 309 - 316.
[Abstract] [Full Text]