CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rothblum-Oviatt, C. J.
Right arrow Articles by Piwnica-Worms, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rothblum-Oviatt, C. J.
Right arrow Articles by Piwnica-Worms, H.
Cell Growth & Differentiation Vol. 12, 581-589, December 2001
© 2001 American Association for Cancer Research

14-3-3 Binding Regulates Catalytic Activity of Human Wee1 Kinase1

Cynthia J. Rothblum-Oviatt, Christine E. Ryan and Helen Piwnica-Worms2

Department of Cell Biology and Physiology [C. J. R-O., C. E. R., H. P-W.], Department of Internal Medicine [H. P-W.], Howard Hughes Medical Institute [C. E. R., H. P-W.], Washington University School of Medicine, St. Louis, Missouri 63110


    Abstract
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 
The mitotic inducer Cdc2 is negatively regulated, in part, by phosphorylation on tyrosine 15. Human Wee1 is a tyrosine-specific protein kinase that phosphorylates Cdc2 on tyrosine 15. Human Wee1 is subject to multiple levels of regulation including reversible phosphorylation, proteolysis, and protein-protein interactions. Here we have investigated the contributions made by 14-3-3 binding to human Wee1 regulation and function. We report that the interactions of 14-3-3 proteins with human Wee1 are reduced during mitosis and are stable in the presence of the protein kinase inhibitor UCN-01. A mutant of Wee1 that is incapable of binding to 14-3-3 proteins has lower enzymatic activity, and this likely accounts for its reduced potency relative to wild-type Wee1 in inducing a G2 cell cycle delay when overproduced in vivo. These findings indicate that 14-3-3 proteins function as positive regulators of the human Wee1 protein kinase.


    Introduction
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 
Activation of the Cdc2 protein kinase is an obligate step for entry into mitosis. Cdc2 is regulated by its association with the B-type cyclins and by reversible phosphorylation (1) . Throughout the early phases of the cell cycle, Cdc2 exists as an underphosphorylated monomer and is inactive as a protein kinase. During S-phase, the B-type cyclins accumulate, bind to Cdc2, and promote its phosphorylation (2, 3, 4, 5, 6, 7, 8, 9, 10, 11) . In higher eukaryotic organisms, Cdc2 phosphorylation occurs on three regulatory sites, Thr-14, Tyr-15, and Thr-161 (12, 13, 14, 15) , whereas in the fission yeast Schizosaccharomyces pombe (Sp), Cdc2 is not detectably phosphorylated on Thr-14 except when the Wee1 protein kinase is overproduced (16) . Phosphorylation of Cdc2 on either Tyr-15 or Thr-14 inhibits the enzymatic activity of Cdc2, whereas Thr-161 phosphorylation is required for maximal kinase activity (15 , 17, 18, 19, 20, 21, 22, 23) . Dephosphorylation of both Thr-14 and Tyr-15 by the Cdc25C phosphatase in late G2 activates Cdc2 and is required for the G2-M transition (24, 25, 26, 27) .

In fission yeast, Tyr-15 phosphorylation is catalyzed by the Wee1 and Mik1 protein kinases (10 , 21 , 28 , 29) . In Xenopus and humans, the Myt1 protein kinase phosphorylates Cdc2 on both Thr-14 and Tyr-15 (22 , 30 , 31) . In lysates prepared from Xenopus eggs, Myt1 accounts for the majority of the Thr-14 kinase activity (30) . Human Wee1 was originally cloned based on its ability to rescue wee1+ mutants in fission yeast (32) . Human Wee1 encodes a tyrosine-specific protein kinase that phosphorylates Cdc2 on Tyr-15 (32, 33, 34, 35, 36, 37, 38) . Although Myt1 and Wee1 share sequence similarities, the two kinases differ in several important ways. Wee1 but not Myt1 is capable of phosphorylating Cdk2 complexed with either cyclin A or E in vitro (38 , 39) . Furthermore, human Myt1 is localized to the endoplasmic reticulum and Golgi complex (22) , whereas Wee1 is reportedly nuclear (35 , 40 , 41) . These differences suggest that Wee1 and Myt1 may serve distinct functions in regulating the cell division cycle. Recently, a second Wee1-like kinase (Wee1B) has been identified and characterized (42) . Wee1B is capable of phosphorylating Cdc2 on Tyr-15 in vitro and is highly abundant in testis.

The Wee1 protein kinase is regulated at multiple levels. In fission yeast, Wee1 is phosphorylated and inactivated by the Cdr1/Nim1 protein kinase (43, 44, 45) . SpWee1 can also be phosphorylated by the Chk1 and Cds1 checkpoint kinases (46 , 47) . The human and Xenopus Wee1 kinases are negatively regulated by phosphorylation in a cell cycle-specific manner (35 , 36 , 38 , 48 , 49) . In addition to phosphorylation, human Wee1 is also regulated at the level of protein synthesis and stability (38) . Wee1 levels rise during the S and G2 phases of the cell cycle because of increased synthesis, and Wee1 levels fall during M-phase because of decreased synthesis combined with proteolysis. The NH2 terminus of human Wee1 is phosphorylated in a cell cycle-specific manner. NH2 terminal phosphorylation correlates with reduced activity and reduced stability of Wee1 during mitosis. In addition, the NH2 terminus of human Wee1 is important in conferring substrate specificity (36 , 37) . The COOH terminus of Wee1 contains a 14-3-3 binding site (50 , 51) . In this study, we have investigated the contribution made by 14-3-3 binding to human Wee1 by characterizing a mutant of Wee1 that cannot bind to 14-3-3.


    Results and Discussion
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 
Overproduction of Kinase-active but not Kinase-inactive Wee1 Causes a G2 Cell Cycle Delay.
Recombinant adenoviruses encoding human Wee1 were used to infect a population of HeLa cells that were synchronized at the G1-S border by a double thymidine block and release protocol (52) . Flow cytometry was used to monitor the ability of cells to traverse the cell cycle after release from the block (Fig. 1)Citation . Cells infected with a control adenovirus encoding GFP3 proceeded through the S, G2, and M phases of the cell cycle normally (Fig. 1A)Citation . By 10 h after the release, 48% of the cells were already in the G1 phase of the cell cycle. In contrast, a G2-M cell cycle delay was observed in cells infected with recombinant adenovirus expressing Wee1. Depending on the multiplicity of infection used, only 23% (Fig. 1C)Citation or 17% (Fig. 1D)Citation of Wee1-expressing cells were in the G1 phase of the cell cycle by the 10-h time point. Thus, the extent of the G2-M delay correlated with Wee1 expression levels (Fig. 1E)Citation .



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1. Overexpression of kinase-active Wee1 causes a cell cycle delay. HeLa cells synchronized at the G1-S border by a double thymidine block protocol were infected with recombinant adenoviruses encoding either GFP or with viruses encoding kinase-active (Wee1) or kinase-inactive (Wee1K328R) forms of Wee1 tagged with a myc-epitope. Cells were infected at a multiplicity of infection (m.o.i.) of 75 for GFP and Wee1(K328R) and either 30 or 50 for Wee1. Cells were harvested at various times after release from the block (hours). Cellular DNA content was analyzed by flow cytometry (A–D), or lysates were prepared and analyzed for Wee1 protein levels by immunoblotting (E). Kinase-active Wee1 (GST-Wee1) or kinase-inactive Wee1 (GST-Wee1K328R) were purified from bacteria as glutathione S-transferase-fusion proteins. F, kinase reactions were performed in vitro in the presence of purified cyclin B1/Cdc2 (K33R) substrate alone (Lane 1) or substrate in the presence of either kinase-active (Lane 2) or kinase-inactive (Lane 3) Wee1. Reactions were resolved by SDS-PAGE and subjected to autoradiography (bottom panel). Levels of kinase-active (top panel, Lane 2) and kinase-inactive (top panel, Lane 3) Wee1 in the reactions were assessed by Ponceau S staining.

 
Similar experiments were performed using a recombinant adenovirus encoding a kinase-inactive form of Wee1. Replacement of lysine at position 328 with arginine generated a kinase-inactive form of Wee1, as evidenced by the inability of this mutant to phosphorylate Cdc2 in vitro (Fig. 1F)Citation . Cells expressing kinase-inactive Wee1 did not experience a G2-M cell cycle delay (Fig. 1B)Citation , indicating that the delay required the kinase activity of Wee1. Western blotting indicated that the kinase-active and kinase-inactive forms of Wee1 were expressed to similar levels in infected cells (Fig. 1E)Citation . Levels of ectopically expressed proteins declined throughout the time course, most dramatically as cells progressed through mitosis, which was 8–10 h for cells expressing kinase-inactive Wee1 and 10–12 h for cells expressing wild-type Wee1.

Mitotic index measurements were made to determine whether cells overproducing Wee1 were arresting in the G2 or M phases of the cell cycle (Fig. 2A)Citation . The microtubule-disrupting agent nocodazole was used to stabilize any mitosis that may have occurred. There was little evidence of chromosome condensation or nuclear membrane disruption in Wee1-overproducing cells at the 6–12-h time points. These results demonstrate that overproduction of kinase-active Wee1 delayed cells in the G2 phase of the cell cycle with a nuclear DNA content of 4N. In addition, the G2 cell cycle delay required the kinase activity of Wee1 because kinase-inactive Wee1 did not induce a delay. These observations are in contrast to what is observed with the Cdc2 inhibitory kinase Myt1. In this case, overproduction of either kinase-active or kinase-inactive Myt1 induces a G2 cell cycle delay (31 , 53) . This is attributable to the fact that both kinase-active and kinase-inactive forms of Myt1 bind Cdc2/cyclin B1 and interfere with the nuclear-cytoplasmic shuttling of Cdc2/cyclin B1 complexes (31) .



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. Overexpression of kinase-active but not kinase-inactive Wee1 causes a G2 cell cycle delay. A, mitotic index measurements were made to assess whether cells expressing Wee1 were delaying in the G2 or M phases of the cell cycle. Cells were synchronized and infected with adenoviruses as described in Fig. 1Citation . Nocodazole was added to trap cells in mitosis. At various times after release from the block, mitotic chromosome spreads were prepared and scored. At least 500 nuclei were counted in each experiment. B, cellular lysates described in Fig. 1Citation were resolved by SDS-PAGE, and Cdc2 phosphorylation status was monitored by Western blotting. Species a, b, and c represent different electrophoretic forms of Cdc2 (see text for details). m.o.i., multiplicity of infection.

 
The electrophoretic mobility of Cdc2 can be used as an indicator of cell cycle position and to assess the phosphorylation status of Cdc2 (22 , 52) . The slowest electrophoretic form of Cdc2 (species a in Fig. 2BCitation ) is phosphorylated on both Thr-14 and Tyr-15, whereas the intermediate form (species b) is phosphorylated on Thr-14 or Tyr-15, but not both (52) . These two forms of Cdc2 have reduced kinase activity compared with Cdc2 that is not phosphorylated on Thr-14 and Tyr-15 (22) . The fastest electrophoretic form of Cdc2 (species c) is not phosphorylated on either Thr-14 or Tyr-15 and represents either the active form of the kinase (phosphorylated on Thr-161 and bound to cyclin B) or Cdc2 that is not bound to cyclin (monomeric, inactive Cdc2). Species c predominates during G1, early S, and in mitosis, whereas species b and c predominate during mid to late S and throughout G2. As seen in Fig. 2BCitation , species c was the predominant form of Cdc2 at the 0-h time point when cells were arrested at the G1-S border. As cells progressed through S and G2 (6- and 8-h time points) species, a and b became more prominent. Cells infected with control virus and kinase-inactive Wee1 proceeded through mitosis and into G1 by 10 h, and in these cells a decrease in levels of species a and b accompanied an increase in species c (the fastest electrophoretic form). The majority of cells expressing kinase-active Wee1 were still in G2 at the 10-h time point, and a decrease in species a and b with a concomitant increase in species c was not evident until the 12-h time point. Also evident in cells expressing kinase-active Wee1 is a higher level of species b, which is likely the Tyr-15-phosphorylated form of Cdc2. These observations are consistent with the conclusion that overproduction of Wee1 induces a G2 cell cycle delay by maintaining Cdc2 in an inactive state through Tyr-15 phosphorylation.

14-3-3 Binding Mutant of Wee1 Is Not as Effective as Wild-Type Wee1 in Inducing a G2 Cell Cycle Delay.
Human Wee1 binds to 14-3-3 proteins, and phosphorylation of Wee1 on Ser-642 has been shown to be essential for the binding of 14-3-3 proteins to Wee1 (50 , 51) . We generated a recombinant adenovirus encoding a 14-3-3 binding mutant of Wee1 by substituting alanine for serine at position 642. Wee1(S642A) was assessed for its ability to induce a G2 cell cycle delay as described in Fig. 1Citation . Cells infected with the control adenovirus proceeded through the S, G2, and M phases of the cell cycle normally. By 8 h after the release, 91% of the cells were in the G2-M phase of the cell cycle, and by 10 h, 21% were in G1 (Fig. 3A)Citation . Expression of wild-type Wee1 induced a G2 delay, because only 3% of cells had reached G1 by the 10-h time point (Fig. 3B)Citation . Cells expressing the 14-3-3 binding mutant experienced a G2 cell cycle delay but not to the same extent as cells expressing wild-type Wee1 (Fig. 3C)Citation . By 12 h, 68% of GFP-expressing cells, 18% of Wee1-expressing cells, and 43% of Wee1(S642A)-expressing cells were in the G1 phase of the cell cycle. Thus, 14-3-3 binding enhances the ability of Wee1 to induce a G2 cell cycle delay, suggesting that 14-3-3 proteins are positive effectors of Wee1 function in vivo.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3. 14-3-3 binding mutant of Wee1 is impaired in its ability to induce a G2 cell cycle delay. HeLa cells synchronized by a double thymidine block protocol were infected with recombinant adenoviruses encoding either GFP (A) or with viruses encoding myc-epitope tagged wild-type Wee1 (B) or a mutant of Wee1 containing alanine in place of serine at position 642 (Wee1S642A; C). Cells were harvested at various times (hours) after release from the block, and cellular DNA content was analyzed by flow cytometry. Levels of Wee1 and Wee1(S642A) were determined by immunoblotting (D).

 
Interactions between Wee1 and 14-3-3 Are Resistant to UCN-01 Treatment.
We reported previously that treatment of cells with the protein kinase inhibitor UCN-01 results in the rapid dephosphorylation of Cdc25C on Ser-216 and subsequent loss of 14-3-3 binding (54 , 55) . Chk1 and C-TAK1, protein kinases that phosphorylate Cdc25C on Ser-216 in vitro, are directly inhibited by UCN-01 (55 , 56) . Although the kinase activity of Wee1 is diminished in UCN-01-treated cells, UCN-01 does not directly inhibit Wee1 in vitro (57) . These findings suggest that UCN-01 effects kinases that function upstream of Wee1 (57) . To determine whether UCN-01 would perturb interactions between Wee1 and 14-3-3 in a manner similar to that of Cdc25C and 14-3-3, cells expressing myc-tagged Wee1 were treated with various concentrations of UCN-01 (Fig. 4)Citation . Myc-Wee1 was isolated from UCN-01-treated cells, and coprecipitation of 14-3-3 proteins was examined by Western blotting. The electrophoretic mobility of Cdc25C was examined in the same cellular lysate to determine the efficiency of UCN-01 treatment. We demonstrated previously that Ser-216 phosphorylation causes Cdc25C to migrate more slowly on SDS gels (54 , 58 , 59) . Thus, the electrophoretic mobility of Cdc25C can be used as an indirect measure of Ser-216 phosphorylation and 14-3-3 binding. As seen in Fig. 4Citation (Lane 3) treatment of cells with 300 nM UCN-01 for 2 h caused significant reduction in Ser-216 phosphorylation as indicated by loss of the slower migrating form of Cdc25C. However, Wee1/14-3-3 interactions were stable even under conditions that resulted in the complete loss of Ser-216 phosphorylation and 14-3-3 binding to Cdc25C (Fig. 4Citation , Lanes 4 and 5). These findings demonstrate that UCN-01 does not mediate its negative effects on Wee1 by interfering with 14-3-3 binding. In addition, these findings demonstrate that the interactions between Wee1 and 14-3-3 are regulated by UCN-01-resistant protein kinases. Chk1, a UCN-01-sensitive protein kinase, has been shown to phosphorylate Xenopus Wee1 on its 14-3-3 binding site (60) . Our findings indicate that in human cells there are kinases other than, or in addition to, Chk1 that regulate the interactions between Wee1 and 14-3-3. Finally, these results indicate that some of the kinases that regulate interactions between 14-3-3 and Wee1 must be distinct from those regulating interactions between 14-3-3 and Cdc25C.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4. Wee1/14-3-3 interactions are stable in the presence of UCN-01. HeLa cells were transfected with vector alone (Lane 1) or with plasmid encoding myc-tagged Wee1 (Lanes 2–5). Twenty h later, UCN-01 was added to a final concentration of 300 nM (Lane 3), 600 nM (Lane 4), or 1 µM (Lane 5) for 2 h. Cell lysates were prepared and either resolved directly by SDS-PAGE on an 8% gel to monitor Cdc25C phosphorylation status or were first incubated with anti-c-Myc agarose to isolate myc-tagged Wee1. Precipitates were resolved on a 12% SDS gel. Precipitates were monitored for the presence of Wee1 and 14-3-3 by immunoblotting with anti-Wee1 polyclonal antibody from UBI and K19 antibody from Santa Cruz Biotechnology, respectively. Cdc25C was detected with monoclonal antibody 174E10-3.

 
Reduced Binding of 14-3-3 to Wee1 during Mitosis.
Full-length Wee1 and the catalytic domain of Wee1 (p49Wee1) were examined for their ability to bind to 14-3-3 proteins during mitosis. HeLa cells expressing Wee1 (Fig. 5A)Citation and wild-type and mutant forms of p49Wee1 (Fig. 5B)Citation were cultured in the absence or in the presence of nocodazole. The association of 14-3-3 with Wee1 was determined by immunoprecipitating Wee1 and examining these precipitates for the presence of 14-3-3 proteins. As seen in Fig. 5ACitation , interactions between 14-3-3 and Wee1 were markedly decreased in nocodazole-treated cells (Lane 3). This was also seen for both kinase-active and kinase-inactive forms of p49Wee1 (Fig. 5BCitation , Lanes 2 and 4). These results indicate that the interactions between 14-3-3 and Wee1 are cell cycle regulated. Decreased binding of 14-3-3 proteins to Wee1 during mitosis suggests that 14-3-3 proteins might function to positively regulate human Wee1 throughout interphase.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5. Reduced 14-3-3 binding to Wee1 during mitosis. HeLa cells were transfected with vector alone (A, Lane 1) or with vectors encoding myc-Wee1 (A, Lanes 2 and 3), myc-p49Wee1 (B, Lanes 1 and 2), myc-p49Wee1(K328R) (B, Lanes 3 and 4), or myc-p49Wee1(S642A) (B, Lane 5). Five h after transfection, nocodazole was added to the indicated cultures. Cells were harvested and lysed 16 h after nocodazole addition. Lysates were incubated with anti-c-Myc (9E10) agarose, and precipitates were resolved on a 12% gel. Wee1 and 14-3-3 were detected by immunoblotting as described in Fig. 4Citation .

 
14-3-3 Binding Regulates the Enzymatic Activity of Wee1.
Given that the G2 cell cycle delay observed upon Wee1 overproduction requires its kinase activity (Fig. 1)Citation , we carried out experiments to assess whether 14-3-3 binding regulated the enzymatic activity of Wee1 (Fig. 6A)Citation . Wee1 and the 14-3-3 binding mutant [Wee1(S642A)] were tested for their ability to phosphorylate purified Cdc2/cyclin B1 complexes in vitro. As seen in Fig. 6ACitation , wild-type Wee1 was 3-fold more active than the 14-3-3 binding mutant in phosphorylating Cdc2 in vitro. Bacterially produced Wee1 and Wee1S642A had similar kinase activities, demonstrating that mutation of Ser-642 does not reduce the intrinsic kinase activity of Wee1 (data not shown). Taken together, these results demonstrate a direct role for 14-3-3 in regulating the enzymatic activity of human Wee1. 14-3-3 binding to Raf1 at Ser-621 (61) and to Xenopus Wee1 at Ser-549 (60) has been shown to serve similar functions.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 6. 14-3-3 binding regulates the enzymatic activity of Wee1. A, clarified lysates prepared from HeLa cells infected with adenoviruses encoding myc-Wee1 and myc-Wee1(S642A) were incubated with anti-c-Myc (9E10) agarose. Kinase reaction were performed in vitro in the presence of purified cyclin B1/Cdc2(K33R) complexes. Reactions were resolved by SDS-PAGE and proteins were transferred to nitrocellulose. 32P-labeled Cdc2 was visualized by autoradiography. Levels of Wee1 (Lanes 1 and 3) and Wee1(S642A) (Lanes 2 and 4) were assessed by immunoblotting with a c-Myc polyclonal antibody (Santa Cruz Biotechnology; A-14). Results from two experiments are shown, and the numbers under each lane represent cpm of 32P incorporated into Cdc2. B, HeLa cells were mock infected (Lane 1) or were coinfected with recombinant adenoviruses encoding wild-type Wee1 and ß-galactosidase (Lane 2); wild-type Wee1 and HA-tagged 14-3-3{varsigma} (Lane 3); Wee1(S642A) and ß-galactosidase (Lane 4) or Wee1(S642A) and HA-tagged 14-3-3 sigma (Lane 5). Cell lysates prepared 24 h after infection were either resolved directly by SDS-PAGE or were first incubated with anti-c-Myc agarose to isolate myc-tagged Wee1. Lysates and precipitates were monitored for the presence of Wee1 and 14-3-3 by immunoblotting with anti-myc polyclonal antibody and K19 antibody, respectively.

 
A previous study by Wang et al. (50) reported that 14-3-3 binding does not affect the intrinsic kinase activity of Wee1 but rather stabilizes the Wee1 protein. In this study, the half-life of ectopically expressed Wee1 was reported to be ~25 min when transfected alone and ~50 min when cotransfected with 14-3-3ß (50) . We found that ectopically expressed Wee1 and the 14-3-3 binding mutant of Wee1 were both stable for up to 4 h after transfection in pulse-chase experiments (data not shown). These findings are more in accord with Yu et al. (57) , who reported that the half-life of endogenous Wee1 is 4 h (57) . Wang et al. (50) also observed that coexpression of 14-3-3ß with Wee1 results in higher accumulation of Wee1 protein in vivo. We observed higher accumulation of both Wee1 and the 14-3-3 binding mutant of Wee1 when coexpressed with 14-3-3{varsigma} in vivo, suggesting an indirect effect of 14-3-3 proteins on Wee1 accumulation under these experimental conditions (Fig. 6B)Citation . Our results are in accord with those of Lee et al. (60) , who demonstrated that 14-3-3 proteins directly regulate the enzymatic activity of Xenopus Wee1.

In Xenopus, Lee et al. (60) reported that wild-type Wee1 and the 14-3-3 binding mutant of Wee1 form punctate nuclear structures when overproduced in Xenopus tissue culture cells. They conclude that one role of 14-3-3 is to keep Wee1 evenly distributed throughout the nucleus. We have not observed punctate nuclear structures when we express myc-tagged Wee1 or myc-tagged Wee1(S642A) in mammalian tissue culture cells. However, we have observed punctate structures throughout both the nucleus and the cytoplasm when GFP-Wee1 proteins are expressed in mammalian tissue culture cells (data not shown). The difference observed between myc-tagged and GFP-tagged proteins might be attributable to differences in protein expression levels or perhaps to indirect effects of the GFP-tag.

In summary, results reported in this study support a role for 14-3-3 proteins in positively regulating Wee1 function throughout interphase. The observation that 14-3-3 binding to Wee1 is lost during mitosis is consistent with this conclusion. The positive role of 14-3-3 proteins in Wee1 regulation is in contrast to their negative role in Cdc25C regulation (58) . In the case of human Cdc25C, 14-3-3 proteins prevent functional interactions between Cdc25C and Cdc2 by keeping Cdc25C from accumulating in the nucleus throughout interphase (54 , 62) . Thus, loss of 14-3-3 binding to both Wee1 and Cdc25C during mitosis is expected to lead to reduced inhibition of Cdc2 by Wee1 concomitant with enhanced activation of Cdc2 by Cdc25C. The net effect would be to drive cells into mitosis more efficiently.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 
Antibodies Used for Precipitation and Western Blotting.
Anti-c-Myc (9E10) agarose conjugate (Santa Cruz Biotechnology) was used to precipitate myc-tagged proteins. Wee1 was detected with a c-Myc polyclonal antibody (Santa Cruz Biotechnology; A-14) or anti-p49 COOH-terminal peptide antisera (Upstate Biotechnology, Inc.). Cdc25C was detected with a monoclonal antibody (174E10–3). Cdc2 was detected with a monoclonal antibody [Cdc2 p34 (17); Santa Cruz Biotechnology]. K19 antisera (Santa Cruz Biotechnology) was used to detect 14-3-3 proteins. Secondary antibodies included horseradish peroxidase-goat antimouse antibody (ICN/Cappel) and horseradish peroxidase-goat antirabbit antibody (Zymed). Western blots were performed using Amersham’s enhanced chemiluminescence (ECL) protocol.

Bacterial Expression Vectors.
Full-length Wee1 was cloned as a BamHI/EcoRI fragment into pGEX-2T (Pharmacia) to generate pGEX2Tp71Wee1Hu. The sequence comprising the BamHI site and the initiating methionine of Wee1 is GGATCCATG. The EcoNI site of pGEX2Tp71Wee1Hu was changed to HpaI to generate pGEX2THp71. pGEX2THp71 was used as template in a three-part PCR reaction using primers 1 and 2 in the first reaction, primers 3 and 4 in the second reaction, and primers 1 and 4 in the third reaction. The sequence of the primers is as follows: 5'-ACCTTCAGCAATGGCACTGG (primer 1); 5'-GTATATAGTAAGGGCGA CAGAGCG (primer 2); 5'-CGCTCTGTCCGCCCTTACTATATAC (primer 3); and 5'-TAAA CAAATAGGGGTTCCGCG (primer 4). The final 611-bp PCR product was cloned into pCR 2.1 (Invitrogen) and sequenced. pCR 2.1-1/4#10 containing the appropriate Ser-642 to alanine substitution was digested with XbaI and EcoRI, and a 233-bp fragment was cloned into XbaI/EcoRI digested pGEX2THp71 to generate pGEX2THp71(S642A). pGEX2Tp49Wee1 (37) was used as template to substitute alanine for serine at position 642 and arginine for lysine at position 328. A restriction fragment from pGEX2Tp49Wee1(K328R) containing arginine for lysine at position 328 was used to replace an equivalent restriction fragment in pGEX2Tp71Wee1Hu to generate pGEX2Tp71(K328R).

Mammalian Expression Vectors.
pGEX2THp71 was used as template in a PCR reaction with an NH2 terminal primer containing a BamHI site and the myc epitope (5'-CGCGGATCCACCATGGCAGAGCAGAAGCTCATCTCAGAAGAAGA CCTCGATACAGAAAAATCAGG) and a COOH-terminal primer containing an EcoRI site (5'-CCGGAATTCTCAGTATATAGTAAGGCTGACAGAGCG). The PCR product was digested with BamHI and EcoRI and cloned into BamHI/EcoRI-digested pCDNA3 to generate pCDNA3myc-p49Wee1. pGEX2Tp71(K328R) was used a template in a PCR reaction using the primers and strategy described above to generate pCDNA3myc-p49Wee1(K328R)). pGEX2THp71 was used as template in a PCR reaction with the NH2-terminal primer described above and COOH-terminal primer containing an EcoRI site and the S642A mutation (5'-CCGGAATTCTCAGTATATAGTAAGGGCGACAGAGCG). The PCR product was digested with BamHI and EcoRI and cloned into BamHI/EcoRI-digested pCDNA3 to generate pCDNA3mycp49Wee1(S642A). To generate NH2-terminal, myc-fusion proteins with full-length Wee1, a modified pCDNA3 vector (Invitrogen), was created. pCDNA3 digested with HindIII and BamHI was ligated with the following linkers: 5'-AGCTTGGTAACAAACCATGGCAGAGCAGAAGC TCATCTCAGAAGAAGACCTCG (linker 1) and 5'-GATCCGAGGTCTTCTTCTGAGA TGAGCTTCTGCTCTGCCATGGTTTGTTACCA (linker 2). The modified vector, pCDNA3myc, contains a Kozac consensus sequence, an ATG start site, and the myc epitope sequence 5' to the BamHI site and lacks the Asp-718 and KpnI restriction sites found in pCDNA3. pGEX2THp71, pGEX2Tp71(K328R), and pGEX2THp71(S642A) were digested with BamHI and EcoRI, and the 2-kb fragments were subcloned into BamHI/EcoRI-digested pCDNA3myc to generate pCDNA3myc-p71, pCDNA3myc-p71(K328R), and pCDNA3myc-p71(S642A), respectively.

Adenoviral Expression Vectors.
Wild-type and mutant forms of Wee1 were cloned as myc-tagged fusions into the adenovirus shuttle vector pAdTrack-CMV (63) . pCDNA3myc-p71, pCDNA3myc-p71(K328R), and pCDNA3myc-p71(S642A) were digested with HindIII and EcoRI, and sequences encoding the myc-Wee1 fusions were cloned into EcoRV-digested pAdTrack-CMV to generate pAdTrackCMV myc-p71, pAdTrack CMVmyc-p71(K328R), and pAdTrackCMVmyc-p71(S642A), respectively. To make viruses encoding myc-Wee1 but not GFP, HindIII/EcoRI inserts encoding myc-Wee1 and myc-Wee1(S642A) were cloned into the EcoRV site of pAd5CMV to generate pAd5CMV-mycp71 and pAd5CMV-mycp71(S642A).

Generation of Recombinant Adenoviruses.
The pAdTrack-CMV based plasmids encoding wild-type and mutant Wee1 myc-fusion proteins were cotransformed with pAdEasy-1 into Escherichia coli BJ5183 to achieve homologous recombination. Recombinant adenoviruses were generated and propagated using the pAdEasy system as described previously (63) . These viruses encode GFP in addition to the Wee1 proteins. Adenoviruses expressing myc-Wee1 and myc-Wee1(S642A) but not GFP were generated by transfecting pAd5CMV-mycp71 and pAd5CMV-mycp71(S642A) with adenoviral DNA into low-passage 293 cells. Plaquing was performed to isolate non-GFP recombinant viruses. Control viruses encoding GFP and ß-galactosidase were provided by B. Vogelstein (Johns Hopkins University, Baltimore, MD).

Cell Synchronization and Adenovirus Infection.
HeLa cells were routinely grown in DMEM supplemented with 10% heat-inactivated fetal bovine serum, 2 mM L-glutamine, and 1% penicillin-streptomycin. To synchronize HeLa cells at the G1-S border, asynchronously growing cells were treated with 2 mM thymidine for 16 h. Cells were then released from the block by switching to complete growth medium containing 24 µM each of thymidine and deoxycytidine. After 8 h, thymidine was added to the medium to a final concentration of 2 mM, and cells were cultured for an additional 16 h. Cells were then rinsed twice with PBS and cultured in complete growth medium. Samples were harvested at various times after the release.

To study the effects of overexpressing Wee1 on cell cycle progression, HeLa cells were synchronized at the G1-S border by a second block, ~8 x 105 cells were infected for 45–60 min with recombinant adenoviruses at various multiplicities of infection in 0.5 ml of serum-free DMEM. Thymidine (2 mM) was included in the infection medium to maintain the G1-S synchronization. At the end of the infection, 4 ml of complete medium containing 2 mM thymidine were added, and cells were incubated for an additional 2 h. Cells were then washed twice with serum-free DMEM and cultured in complete growth medium. Cells were harvested at the desired times by trypsinization. Approximately one-third of the cells were lysed in MCL buffer [50 mM Tris (pH 8.0), 100 mM NaCl, 5 mM EDTA, 0.5% NP40, 2 mM DTT, 2 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 20 µM leupeptin, 5 µg/ml pepstatin, 1 mM Na3VO4, 1 µM and microcystin]. Lysate (100 µg) was resolved by SDS-PAGE and analyzed by Western blotting. The remaining cells were fixed in 70% ethanol and stained with 30 µg/ml propidium iodide in PBS containing 1% BSA and 0.25 mg/ml RNase A. Cell cycle profiles were determined by flow cytometry using a Becton Dickinson FACScan, and data were analyzed using CELL QUEST software.

To examine effects of 14-3-3 proteins on Wee1 stability, HeLa cells were mock infected or were coinfected with recombinant adenoviruses encoding either wild-type Wee1 or the 14-3-3 binding mutant together with viruses encoding ß-galactosidase (31) or HA-tagged 14-3-3{varsigma} (64) . Cells were lysed in MCL buffer 24 h after infection. Lysates containing 1 mg of total cellular protein were incubated with 40 µl of anti-c-Myc agarose (1:1 slurry) at 4°C for 2 h. Precipitates were washed three times in MCL buffer.

Mitotic Index Measurements.
HeLa cells were subjected to G1-S synchronization and adenoviral infection as described above. Upon releasing cells from the final thymidine block, 0.10 µg/ml nocodazole was added to the medium to trap mitotic cells. Pelleted cells were harvested by trypsinization, washed once with PBS, and then resuspended in 75 mM KCl for 10 min (65) . After centrifugation to remove the KCl, cells were treated with fixative (acetic acid:methanol; 1:3 v/v). Cells were then resuspended in fixative, spread onto slides, and allowed to air dry. Dried cells were then stained with 1 µg/ml 4',6-diamidino-2-phenylindole for 5 min at room temperature and then mounted and observed by fluorescent microscopy. A minimum of 500 nuclei were counted for each sample.

Mammalian Cell Transfections.
Mammalian cell transfections were carried out using plasmid DNA and Lipofectamine reagent (Life Technologies, Inc.) in a ratio of 1:3 or 1:4 according to the manufacturer’s recommended protocols or using a calcium phosphate transfection protocol (Invitrogen).

Treatment of Cells with UCN-01.
HeLa cells were either transfected with empty vector or vector encoding myc-tagged Wee1. Twenty h after transfection, cells were either not treated or were incubated with various concentrations of UCN-01 for 2 h. Cell lysates were prepared, and 150 µg of cellular lysate were resolved by SDS-PAGE to monitor the electrophoretic mobility of human Cdc25C. Five hundred µg of total cellular protein were incubated with anti-c-Myc agarose at 4°C for 2 h. After precipitation, myc-agarose was pelleted and washed three times with MCL buffer. SDS sample loading buffer was added to each pellet, and the reactions were resolved on 12% polyacrylamide SDS gels. Western blot analysis was performed to detect myc-tagged Wee1Hu and coprecipitating 14-3-3 proteins. Myc-Wee1 fusion proteins were detected using anti-p49 COOH-terminal peptide antisera (Upstate Biotechnology, Inc.).

Interactions between Wee1 and 14-3-3 Proteins during Mitosis.
HeLa cells were transfected with plasmids encoding myc-tagged fusions of Wee1 as well as wild-type and mutant forms of p49Wee1. Five h after transfection, 0.15 µg/ml nocodazole was added to some of the cultures. Sixteen h later cells were lysed in MCL buffer at 4°C for 15 min. Lysates were cleared by centrifugation at 4°C and 10,000 rpm for 10 min. Fifty µl of anti-c-Myc agarose (1:1 slurry) were added to the lysate for 2 h at 4°C. Precipitates were washed three times with MCL buffer and then resolved on a 12% polyacrylamide SDS gel. Western blotting was performed to detect myc-tagged Wee1 and coprecipitating 14-3-3 proteins.

Expression and Purification of Proteins Expressed Bacteria for Kinase Assays.
Bacterial cells transformed with pGEX2THp71 and pGEX2Tp71(K328R) encoding GST-Wee1 and GST-Wee1(K328R), respectively, were grown at 37°C to an A600 of 0.6. Isopropyl-1-thio-ß-D-galactopyranoside was added to a final concentration of 0.5 mM. After growing for an additional 3 h at 30°C, cells were pelleted by centrifugation. Cell pellets were washed with PBS buffer and resuspended in STE [100 mM NaCl, 10 mM Tris-HCl (pH 8.0), and 1 mM EDTA] supplemented with 2 mM phenylmethylsulfonyl fluoride, 0.15 unit/ml aprotinin, 20 µM leupeptin, 20 µM pepstatin, and 0.5 mg/ml lysozyme. After rocking at 4°C for 20 min, Sarkosyl was added to a final concentration of 1.5%, and lysis was accomplished by sonication. Lysates were clarified by centrifugation, and Triton X-100 was added to a final concentration of 2%. Proteins were incubated with glutathione agarose beads for 30 min at 4°C. Precipitates were washed twice with NETN [20 mM Tris (pH 8.0), 100 mM NaCl, 1 mM EDTA, and 0.5% NP40] containing 1 M NaCl, twice with NETN, and twice with incomplete kinase buffer [50 mM Tris (pH 7.5), 10 mM MgCl2]. Kinase assays were performed as described below.

Phosphorylation of Cdc2 by Wee1 in Vitro.
HeLa cells were infected with recombinant adenoviruses encoding myc-Wee1 and myc-Wee1(S642A). Cells were lysed in MCL buffer 24 h after infection. Lysates were incubated with 30 µl of anti-c-Myc agarose (1:1 slurry) at 4°C for 2 h. Precipitates were washed three times in MCL buffer and twice in incomplete kinase buffer. Kinase reactions were carried out in the presence of 1–2 µg of GST-cyclin B1/Cdc2(K33R) substrate (22) in 40 µl of incomplete kinase buffer supplemented with 1 mM DTT, 0.5 mM Na3VO4, 10 µM ATP, and 10 µCi of [{gamma}-32P]ATP (>4000 Ci/mmol). Reactions were incubated for 5–20 min at 30°C and terminated by the addition of SDS-sample buffer. Proteins were resolved on a 12.5% SDS-polyacrylamide gel, Wee1 levels were determined by immunoblotting, and 32P-labeled Cdc2 was visualized by autoradiography. 32P incorporation was determined by excising radiolabeled Cdc2 from the gel and counting in a scintillation counter.


    Acknowledgments
 
We thank H. Okayama for providing a cDNA encoding human Wee1 and B. Vogelstein for providing recombinant adenovirus encoding HA-tagged 14-3-3 sigma and ß-galactosidase.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by NIH Grant GM47017 (to H. P-W.) and Training Grant GM18876 (to C. J. R-O.). H. P-W. is an Investigator of the Howard Hughes Medical Institute. Back

2 To whom requests for reprints should be addressed, at Department of Cell Biology and Physiology, Howard Hughes Medical Institute, Washington University School of Medicine, Box 8228, 660 South Euclid Avenue, St. Louis, MO 63110. Phone: (314) 362-6812; Fax: (314) 362-3709; E-mail: hpiwnica{at}cellbio.wustl.edu. Back

3 The abbreviations used are: GFP, green fluorescent protein; MCL, mammalian cell lysis; HA, hemagglutinin antigen. Back

Received for publication 7/27/01. Revision received 9/28/01. Accepted for publication 10/ 1/01.


    References
 TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and Methods
 References
 

  1. Morgan D. O. Cyclin dependent kinases. Engines, clocks, and microprocessors. Ann. Rev. Cell Dev. Biol., 13: 261-291, 1997.[Medline]
  2. Labbe J. C., Capony J. P., Caput D., Cavadore J. C., Derancourt J., Kaghad M., Lelias J. M., Picard A., Doree M. MPF from starfish oocytes at first meiotic metaphase is a heterodimer containing one molecule of cdc2 and one molecule of cyclin B. EMBO J., 8: 3053-3058, 1989.[Medline]
  3. Draetta G., Luca F., Westendorf J., Brizuela L., Ruderman J., Beach D. Cdc2 protein kinase is complexed with both cyclin A and B: evidence for proteolytic inactivation of MPF. Cell, 56: 829-838, 1989.[Medline]
  4. Gautier J., Minshull J., Lohka M., Glotzer M., Hunt T., Maller J. L. Cyclin is a component of maturation-promoting factor from Xenopus. Cell, 60: 487-494, 1990.[Medline]
  5. Meijer L., Arion D., Golsteyn R., Pines J., Brizuela L., Hunt T., Beach D. Cyclin is a component of the sea urchin egg M-phase specific histone H1 kinase. EMBO J., 8: 2275-2282, 1989.[Medline]
  6. Pines J., Hunter T. Isolation of a human cyclin cDNA: evidence for cyclin mRNA and protein regulation in the cell cycle and for interaction with p34cdc2. Cell, 58: 833-846, 1989.[Medline]
  7. Jeffrey P. D., Russo A. A., Polyak K., Gibbs E., Hurwitz J., Massagué J., Pavletich N. P. Mechanism of CDK activation revealed by the structure of a cyclin A-CDK2 complex. Nature (Lond.), 376: 313-320, 1995.[Medline]
  8. Solomon M. J., Glotzer M., Lee T. H., Philippe M., Kirschner M. W. Cyclin activation of p34cdc2. Cell, 63: 1013-1024, 1990.[Medline]
  9. Meijer L., Azzi L., Wang J. Y. J. Cyclin B targets p34cdc2 for tyrosine phosphorylation. EMBO J., 10: 1545-1554, 1991.[Medline]
  10. Parker L. L., Atherton-Fessler S., Lee M. S., Ogg S., Falk F. L., Swenson K. I., Piwnica-Worms H. Cyclin promotes the tyrosine phosphorylation of p34cdc2 in a wee1+ dependent manner. EMBO J., 10: 1255-1263, 1991.[Medline]
  11. Atherton-Fessler S., Parker L. L., Geahlen R. L., Piwnica-Worms H. Mechanism of p34cdc2 regulation. Mol. Cell. Biol., 13: 1675-1685, 1993.[Abstract/Free Full Text]
  12. Draetta G., Beach D. Activation of cdc2 protein kinase during mitosis in human cells: cell cycle-dependent phosphorylation and subunit rearrangement. Cell, 54: 17-26, 1988.[Medline]
  13. Draetta G., Piwnica-Worms H., Morrison D., Druker B., Roberts T., Beach D. Human cdc2 protein kinase is a major cell-cycle regulated tyrosine kinase substrate. Nature (Lond.), 336: 738-744, 1988.[Medline]
  14. Morla A. O., Draetta G., Beach D., Wang J. Y. J. Reversible tyrosine phosphorylation of cdc2: dephosphorylation accompanies activation during entry into mitosis. Cell, 58: 193-203, 1989.[Medline]
  15. Krek W., Nigg E. A. Differential phosphorylation of vertebrate p34cdc2 kinase at the G1/S and G2/M transitions of the cell cycle: identification of major phosphorylation sites. EMBO J., 10: 305-316, 1991.[Medline]
  16. Den Haese G. J., Walworth N., Carr A. M., Gould K. L. The Wee1 protein kinase regulates T14 phosphorylation of fission yeast Cdc2. Mol. Biol. Cell, 6: 371-385, 1995.[Abstract]
  17. Gould K. L., Nurse P. Tyrosine phosphorylation of the fission yeast cdc2+ protein kinase regulates entry into mitosis. Nature (Lond.), 342: 39-45, 1989.[Medline]
  18. Gould K. L., Moreno S., Owen D. J., Sazer S., Nurse P. Phosphorylation at Thr 167 is required for Schizosaccharomyces pombe p34cdc2 function. EMBO J., 10: 3297-3309, 1991.[Medline]
  19. Norbury C., Blow J., Nurse P. Regulatory phosphorylation of the p34cdc2 protein kinase in vertebrates. EMBO J., 10: 3321-3329, 1991.[Medline]
  20. Solomon M. J., Lee T., Kirschner M. W. Role of phosphorylation in p34cdc2 activation: identification of an activating kinase. Mol. Biol. Cell, 3: 13-27, 1992.[Abstract]
  21. Parker L. L., Atherton-Fessler S., Piwnica-Worms H. p107wee1 is a dual specificity kinase that phosphorylates p34cdc2 on tyrosine 15. Proc. Natl. Acad. Sci. USA, 89: 2917-2921, 1992.[Abstract/Free Full Text]
  22. Liu F., Stanton J. J., Wu Z., Piwnica-Worms H. The human Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and localizes to the endoplasmic reticulum and Golgi complex. Mol. Cell. Biol., 17: 571-583, 1997.[Abstract/Free Full Text]
  23. Connell-Crowley L., Solomon M. J., Wei N., Harper J. W. Phosphorylation-independent activation of human cyclin-dependent kinase 2 by cyclin A in vitro. Mol. Biol. Cell, 4: 79-92, 1993.[Abstract]
  24. Lee M. S., Ogg S., Xu M., Parker L. L., Donoghue D. J., Maller J. L., Piwnica-Worms H. cdc25+ encodes a protein phosphatase that dephosphorylates p34cdc2. Mol. Biol. Cell, 3: 73-84, 1992.[Abstract]
  25. Dunphy W. G., Kumagai A. The cdc25 protein contains an intrinsic phosphatase activity. Cell, 67: 189-196, 1991.[Medline]
  26. Gautier J., Solomon M. J., Booher R. N., Bazan J. F., Kirschner M. W. cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2. Cell, 67: 197-211, 1991.[Medline]
  27. Sebastian B., Kakizuka A., Hunter T. Cdc25M2 activation of cyclin-dependent kinases by dephosphorylation of threonine-14 and tyrosine-15. Proc. Natl. Acad. Sci. USA, 90: 3521-3524, 1993.[Abstract/Free Full Text]
  28. Featherstone C., Russell P. Fission yeast p107wee1 mitotic inhibitor is a tyrosine/serine kinase. Nature (Lond.), 349: 808-811, 1991.[Medline]
  29. Lee M. S., Enoch T., Piwnica-Worms H. Mik1+ encodes a tyrosine kinase that phosphorylates p34cdc2 on tyrosine 15. J. Biol. Chem., 269: 30530-30537, 1994.[Abstract/Free Full Text]
  30. Mueller P. R., Coleman T. R., Kumagai A., Dunphy W. G. Myt1: a membrane-associated inhibitory kinase that phosphorylates Cdc2 on both threonine-14 and tyrosine-15. Science (Wash. DC), 270: 86-90, 1995.[Abstract/Free Full Text]
  31. Liu F., Oviatt-Rothblum C., Ryan C. E., Piwnica-Worms H. Overproduction of the human Myt1 kinase induces a G2 cell cycle delay by interfering with the intracellular trafficking of Cdc2/cyclin B1 complexes. Mol. Cell. Biol., 19: 5113-5123, 1999.[Abstract/Free Full Text]
  32. Igarashi M., Nagata A., Jinno S., Suto K., Okayama H. Wee1+-like gene in human cells. Nature (Lond.), 353: 80-83, 1991.[Medline]
  33. Honda R., Ohba Y., Yasuda H. The cell cycle regulator, human p50wee1, is a tyrosine kinase and not a serine/tyrosine kinase. Biochem. Biophys. Res. Commun., 186: 1333-1338, 1992.[Medline]
  34. McGowan C. H., Russell P. Human Wee1 kinase inhibits cell division by phosphorylating p34cdc2 exclusively on Tyr 15. EMBO J., 12: 75-85, 1993.[Medline]
  35. McGowan C. H., Russell P. Cell cycle regulation of human WEE1. EMBO J., 14: 2166-2175, 1995.[Medline]
  36. Parker L. L., Sylvestre P. J., Byrnes M. J., III, Liu F., Piwnica-Worms H. Identification of a 95-kDa WEE1-like tyrosine kinase in HeLa cells. Proc. Natl. Acad. Sci. USA, 92: 9638-9642, 1995.[Abstract/Free Full Text]
  37. Parker L. L., Piwnica-Worms H. Inactivation of the p34cdc2-cyclin B complex by the human wee1 tyrosine kinase. Science (Wash. DC), 257: 1955-1957, 1992.[Abstract/Free Full Text]
  38. Watanabe N., Broome M., Hunter T. Regulation of the human WEE1Hu CDK tyrosine 15-kinase during the cell cycle. EMBO J., 14: 1878-1891, 1995.[Medline]
  39. Booher R. N., Holman P. S., Fattaey A. Human Myt1 is a cell cycle regulated kinase that inhibits Cdc2 but not Cdk2 activity. J. Biol. Chem., 272: 22300-22306, 1997.[Abstract/Free Full Text]
  40. Heald R., McLoughlin M., McKeon F. Human Wee1 maintains mitotic timing by protecting the nucleus from cytoplasmically activated Cdc2 kinase. Cell, 74: 463-474, 1993.[Medline]
  41. Baldin V., Ducommun B. Subcellular localisation of human wee1 kinase is regulated during the cell cycle. J. Cell Sci., 108: 2425-2432, 1995.[Abstract]
  42. Nakanishi M., Ando H., Watanabe N., Kitamura K., Ito K., Okayama H., Miyamoto T., Agui T., Sasaki M. Identification and characterization of human Wee1B, a new member of the Wee1 family of Cdk-inhibitory kinases. Genes Cells, 5: 839-847, 2000.[Abstract]
  43. Parker L. L., Walter S. A., Piwnica-Worms H. Phosphorylation and inactivation of p107wee1 by the nim1/cdr1 kinase. Nature (Lond.), 363: 736-738, 1993.[Medline]
  44. Wu L., Russell P. Nim1 kinase promotes mitosis by inactivating Wee1 tyrosine kinase. Nature (Lond.), 363: 738-741, 1993.[Medline]
  45. Coleman T. R., Tang Z., Dunphy W. G. Negative regulation of the wee1 protein kinase by direct action of the nim1/cdr1 mitotic inducer. Cell, 72: 919-929, 1993.[Medline]
  46. Boddy M. N., Furnari B., Mondesert O., Russell P. Replication checkpoint enforced by kinases Cds1 and Chk1. Science (Wash. DC), 280: 909-912, 1998.[Abstract/Free Full Text]
  47. O’Connell M. J., Raleigh J. M., Verkade H. M., Nurse P. Chk1 is a wee1 kinase in the G2 DNA damage checkpoint inhibiting cdc2 by Y15 phosphorylation. EMBO J., 16: 545-554, 1997.[Medline]
  48. Mueller P. R., Coleman T. R., Dunphy W. G. Cell cycle regulation of a Xenopus Wee1-like kinase. Mol. Biol. Cell, 6: 119-134, 1995.[Abstract]
  49. Tang Z., Coleman T. R., Dunphy W. G. Two distinct mechanisms for negative regulation of the Wee1 protein kinase. EMBO J., 12: 3427-3436, 1993.[Medline]
  50. Wang Y., Jacobs C., Hook K. E., Duan H., Booher R. N., Sun Y. Binding of 14-3-3ß to the carboxyl terminus of Wee1 increases Wee1 stability, kinase activity, and G2-M cell population. Cell Growth Differ., 11: 211-219, 2000.[Abstract/Free Full Text]
  51. Honda R., Ohba Y., Yasuda H. 14-3-3{zeta} protein binds to the carboxyl half of mouse wee1 kinase. Biochem. Biophys. Res. Commun., 230: 262-265, 1997.[Medline]
  52. Atherton-Fessler S., Liu F., Gabrielli B., Lee M. S., Peng C.-Y., Piwnica-Worms H. Cell cycle regulation of the p34cdc2 inhibitory kinases. Mol. Biol. Cell, 5: 989-1001, 1994.[Abstract]
  53. Wells N. J., Watanabe N., Tokusumi T., Jiang W., Verdecia M. A. The C-terminal domain of the Cdc2 inhibitory kinase Myt1 interacts with Cdc2 complexes and is required for inhibition of G2/M transition. J. Cell Sci., 112: 3361-3371, 1999.[Abstract]
  54. Graves P. R., Lovly C. M., Uy G. L., Piwnica-Worms H. Localization of human Cdc25C is regulated both by nuclear export and 14-3-3 binding. Oncogene, 20: 1839-1851, 2001.[Medline]
  55. Graves P. R., Yu L., Schwarz J. K., Gales J., Sausville E. A., O’Connor P. M., Piwnica-Worms H. The Chk1 protein kinase and the Cdc25C regulatory pathway are targets of the anticancer agent UCN-01. J. Biol. Chem., 275: 5600-5605, 2000.[Abstract/Free Full Text]
  56. Busby E. C., Leistritz D. F., Abraham R. T., Karnitz L. M., Sarkaria J. N. The radiosensitizing agent 7-hydroxystaurosporine (UCN-01) inhibits the DNA damage checkpoint kinase hChk1. Cancer Res., 60: 2108-2212, 2000.[Abstract/Free Full Text]
  57. Yu L., Orlandi L., Wang P., Orr M. S., Senderowicz A. M., Sausville E. A., Silvestrini R., Watanabe N., Piwnica-Worms H., O’Connor P. M. UCN-01 abrogates G2 arrest through a Cdc2-dependent pathway that is associated with inactivation of the Wee1Hu kinase and activation of the Cdc25C phosphatase. J. Biol. Chem., 273: 33455-33464, 1998.[Abstract/Free Full Text]
  58. Peng C-Y., Graves P. R., Thoma R. S., Wu Z., Shaw A., Piwnica-Worms H. Mitotic- and G2-checkpoint control. Regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine 216. Science (Wash. DC), 277: 1501-1505, 1997.[Abstract/Free Full Text]
  59. Peng C-Y., Graves P. R., Ogg S., Thoma R. S., Byrnes M. J., Wu Z., Stephenson M., Piwnica-Worms H. C-TAK1 protein kinase phosphorylates human Cdc25C on serine 216 and promotes 14-3-3 binding. Cell Growth Differ., 9: 197-208, 1998.[Abstract]
  60. Lee J., Kumagai A., Dunphy W. G. Positive regulation of Wee1 by Chk1 and 14-3-3 proteins. Mol. Biol. Cell, 12: 551-563, 2001.[Abstract/Free Full Text]
  61. Thorson J. A., Lily W. K., Hsu A. L., Graves P. R., Tanner J. W., Allen P. M., Piwnica-Worms H., Shaw A. S. 14-3-3 proteins are required for the maintenance of Raf-1 phosphorylation and kinase activity. Mol. Cell. Biol., 18: 5229-5238, 1998.[Abstract/Free Full Text]
  62. Dalal S. N., Schweitzer C. M., Gan J., Decaprio J. Cytoplasmic localization of human Cdc25C during interphase requires an intact 14-3-3 binding site. Mol. Cell. Biol., 19: 4465-4479, 1999.[Abstract/Free Full Text]
  63. He T.-C., Zhou S., DaCosta L. T., Yu J., Kinzler K. W., Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA, 95: 2509-2514, 1998.[Abstract/Free Full Text]
  64. Hermeking H., Lengauer C., Polyak K., He T-C., Zhang L., Thiagalingam S., Kinzler K. W., Vogelstein B. 14-3-3{varsigma} is a p53 regulated inhibitor of G2/M progression. Mol. Cell, 1: 3-13, 1997.[Medline]
  65. Cliby W. A., Roberts C. J., Cimprich K. A., Stringer C. M., Lamb J. R., Schreiber S. L., Friend S. H. Overexpression of a kinase-inactive ATR protein causes sensitivity to DNA-damaging agents and defects in cell cycle checkpoints. EMBO J., 17: 159-169, 1998.[Medline]



This article has been cited by other articles:


Home page
JCBHome page
J. S. Oh, S. J. Han, and M. Conti
Wee1B, Myt1, and Cdc25 function in distinct compartments of the mouse oocyte to control meiotic resumption
J. Cell Biol., January 25, 2010; 188(2): 199 - 207.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Muller, D. Lutter, and A. W. Puschel
Persistence of the cell-cycle checkpoint kinase Wee1 in SadA- and SadB-deficient neurons disrupts neuronal polarity
J. Cell Sci., January 15, 2010; 123(2): 286 - 294.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. N. Tse, T. N. Sheikh, H. Alan, T.-C. Chou, and G. K. Schwartz
90-kDa Heat Shock Protein Inhibition Abrogates the Topoisomerase I Poison-Induced G2/M Checkpoint in p53-Null Tumor Cells by Depleting Chk1 and Wee1
Mol. Pharmacol., January 1, 2009; 75(1): 124 - 133.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Kamata, N. Watanabe, Y. Nagaoka, and I. S. Y. Chen
Human Immunodeficiency Virus Type 1 Vpr Binds to the N Lobe of the Wee1 Kinase Domain and Enhances Kinase Activity for Cdc2
J. Virol., June 15, 2008; 82(12): 5672 - 5682.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Alvarez, X. Altafaj, S. Aranda, and S. de la Luna
DYRK1A Autophosphorylation on Serine Residue 520 Modulates Its Kinase Activity via 14-3-3 Binding
Mol. Biol. Cell, April 1, 2007; 18(4): 1167 - 1178.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. F. Taylor, S. C. McNeely, H. L. Miller, G. M. Lehmann, M. J. McCabe Jr., and J. C. States
p53 Suppression of Arsenite-Induced Mitotic Catastrophe Is Mediated by p21CIP1/WAF1
J. Pharmacol. Exp. Ther., July 1, 2006; 318(1): 142 - 151.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Y. Kim, E. J. Song, K.-J. Lee, and J. E. Ferrell Jr.
Multisite M-Phase Phosphorylation of Xenopus Wee1A
Mol. Cell. Biol., December 1, 2005; 25(23): 10580 - 10590.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. S. Stanford and J. V. Ruderman
Changes in Regulatory Phosphorylation of Cdc25C Ser287 and Wee1 Ser549 during Normal Cell Cycle Progression and Checkpoint Arrests
Mol. Biol. Cell, December 1, 2005; 16(12): 5749 - 5760.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Katayama, N. Fujita, and T. Tsuruo
Akt/Protein Kinase B-Dependent Phosphorylation and Inactivation of WEE1Hu Promote Cell Cycle Progression at G2/M Transition
Mol. Cell. Biol., July 1, 2005; 25(13): 5725 - 5737.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
A. Benzinger, N. Muster, H. B. Koch, J. R. Yates III, and H. Hermeking
Targeted Proteomic Analysis of 14-3-3{varsigma}, a p53 Effector Commonly Silenced in Cancer
Mol. Cell. Proteomics, June 1, 2005; 4(6): 785 - 795.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. Yuan, M. Kamata, Y.-M. Xie, and I. S. Y. Chen
Increased Levels of Wee-1 Kinase in G2 Are Necessary for Vpr- and Gamma Irradiation-Induced G2 Arrest
J. Virol., August 1, 2004; 78(15): 8183 - 8190.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. E. M. Meek, W. S. Lane, and H. Piwnica-Worms
Comprehensive Proteomic Analysis of Interphase and Mitotic 14-3-3-binding Proteins
J. Biol. Chem., July 30, 2004; 279(31): 32046 - 32054.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Uchida, A. Kuma, M. Ohtsubo, M. Shimura, M. Hirata, H. Nakagama, T. Matsunaga, Y. Ishizaka, and K. Yamashita
Binding of 14-3-3{beta} but not 14-3-3{sigma} controls the cytoplasmic localization of CDC25B: binding site preferences of 14-3-3 subtypes and the subcellular localization of CDC25B
J. Cell Sci., June 15, 2004; 117(14): 3011 - 3020.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. R. Kellogg
Wee1-dependent mechanisms required for coordination of cell growth and cell division
J. Cell Sci., December 15, 2003; 116(24): 4883 - 4890.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M.-S. Chen, C. E. Ryan, and H. Piwnica-Worms
Chk1 Kinase Negatively Regulates Mitotic Function of Cdc25A Phosphatase through 14-3-3 Binding
Mol. Cell. Biol., November 1, 2003; 23(21): 7488 - 7497.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
T. Matsuo, S. Yamaguchi, S. Mitsui, A. Emi, F. Shimoda, and H. Okamura
Control Mechanism of the Circadian Clock for Timing of Cell Division in Vivo
Science, October 10, 2003; 302(5643): 255 - 259.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Okubo, J. M. Lehman, and T. D. Friedrich
Negative Regulation of Mitotic Promoting Factor by the Checkpoint Kinase Chk1 in Simian Virus 40 Lytic Infection
J. Virol., January 15, 2003; 77(2): 1257 - 1267.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rothblum-Oviatt, C. J.
Right arrow Articles by Piwnica-Worms, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rothblum-Oviatt, C. J.
Right arrow Articles by Piwnica-Worms, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation