| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cell Growth & Differentiation |
Articles |
Department of Cell Biology, Baylor College of Medicine, Houston, Texas 77030
Abstract
Microdissection and differential display PCR were used to identify genes preferentially expressed in the highly proliferative terminal end buds (TEBs) in the mammary gland of 45-day-old virgin rats. One clone exhibited 87% homology to the human p190-B gene encoding a novel Rho-Gap. Using in situ hybridization, p190-B was detected in both the TEBs and the terminal ducts, with the highest expression observed in the outer layer of TEBs. During normal mammary gland development, p190-B mRNA expression was highest in the virgin mammary gland and decreased during late pregnancy and lactation. Interestingly, increased levels of p190-B mRNA relative to the normal mammary gland were seen in a subset of murine mammary tumors that appeared to be less well differentiated and potentially more aggressive. Transient transfection of a p190-B expression construct into MCF-10A human mammary epithelial cells resulted in disruption of the actin cytoskeleton, which suggests a role for p190-B in regulating the signaling pathways that influence cell migration and invasion. These results suggest that p190-B may be required for virgin mammary gland development, and its aberrant expression may occur in breast cancer.
Introduction
A womans reproductive history is one of the principal determinants of her susceptibility to breast cancer. An early full-term pregnancy is protective and the length of time between menarche and the first full-term pregnancy seems to be critical for the initiation of breast cancer (1) . This phenomenon has been extensively modeled in rat model systems, in which pregnancy per se (2) , (3) or treatment with estrogen and progesterone has been shown to be highly protective against NMU3 -induced carcinogenesis (4, 5) . Recently, parity-induced protection has also been reproduced in a mouse model (6) . Although the mechanism for this protective effect has not been defined, Russo and Russo (7) have suggested that the protective effects of an early full-term pregnancy result from estrogen- and progesterone-induced differentiation of mammary epithelial cells and the concomitant loss of cells susceptible to carcinogenesis. The effects of estrogen and progesterone are mediated by the induction of specific "local mediators," i. e., growth factors that act via autocrine and paracrine mechanisms to influence TD and TEB growth and differentiation (8) . These factors may induce persistent alterations in intracellular pathways that govern the proliferative response of mammary cells to carcinogenic action (9) . An alternative to Russos hypothesis suggests, however, that other alterations in addition to differentiation of the TEB and TD might explain the refractoriness to mammary carcinogenesis (10) . Regardless of which hypothesis is correct, no molecular markers are available to identify and follow the fate of the highly susceptible TEB cells. Yet, such intermediate biomarkers will be required to develop effective diagnostic tools and preventive therapies for breast cancer.
TEBs are composed of highly proliferative cells thought to be the most susceptible to neoplastic transformation. Ductal morphogenesis is accompanied by the penetration of these proliferative cells into the surrounding fat pad. The TEB contains two histologically distinct cell types: the more central body cells and the outer cap cells. The highest levels of proliferation are observed in the cap cells, whereas the body cells surrounding the lumen are highly apoptotic, thus providing a mechanism to generate a ductal structure (11) . With each estrous cycle, most of the TEBs in mature animals progressively differentiate into ABS. A small population become atrophic and give rise to TDs. Both TEBs and TDs are targets for carcinogen action in young and old virgin rats, respectively.
The objective of this study was to identify molecular markers for TEB and TD cells to follow their fate during mammary development and carcinogenesis. To do so, we sought to identify genes that were differentially expressed between TEBs and the M and S regions of the nulliparous rat mammary gland. A large repertoire of techniques, such as subtractive hybridization of cDNA (12) , cDNA arrays (13) , representational difference analysis (14) , and serial analysis of gene expression (reviewed in Ref. 15 ), now exist that are capable of generating a profile that reflects the presence of differentially expressed transcripts. However, with DD-PCR (16) , multiple RNA samples can be compared at one time. Moreover, as little as 5 µg of total RNA per sample is enough to carry out the analysis. Thus, when these studies were initiated, DD-PCR was the preferred method because only microgram quantities of RNA could be isolated from the various dissected regions of the mammary gland. In all, 14 differentially expressed cDNA fragments were subcloned from the TEB region and sequenced to identify potentially interesting genes. This study reports the identification and characterization of a Rho-GTPase-activating protein, p190-B, that may be required for virgin mammary gland development and may play a role in mammary neoplasia.
Results
Isolation of TEB Specific Genes.
DD-PCR analysis of the RNA samples obtained from the dissection of TEB
and of M and S regions of the rat virgin mammary gland (Fig. 1
) resulted in the isolation of 14 clones that were preferentially
expressed in the TEB (Fig. 2
). Some of these clones were identified because their differential
expression pattern could be reproduced in parallel runs of two
different pools of RNA (see Fig. 2, A and B
).
Homology searches were performed using BLAST (software) searches
against the GenBank database (17)
. A summary of the genes
showing homology to the EDD clones is presented in Table 1
. Ten of the EDD clones had a high similarity to sequences in the
database. Although five of these clones are expressed sequence tags
(ESTs) with unknown functions, the remaining clones were identified as
genes whose products perform a wide range of functions, such as growth
factors, signaling molecules, cell surface receptors, mitochondrial
products, and a mineral binding protein.
|
|
|
|
Localization of p190-B Transcripts by in Situ
Hybridization.
p190-B belongs to the Rho-Gap family of proteins and has many family
members, the closest being p190-A. p190-B has been implicated in
integrin signaling and cytoskeletal reorganization (18)
.
Because p190-Rho-Gaps enhance the conversion of GTP-Rho to GDP-Rho,
they negatively regulate cytoskeletal assembly and have a role in cell
motility and invasion. (See review 19
).
To confirm the differential tissue distribution of p190-B in the virgin
mammary gland, the cDNA was linearized to generate a
33P-riboprobe for the detection of its transcript
at the single cell level by in situ hybridization. In
agreement with the DD-PCR and Reverse Northern data, in situ
hybridization revealed that the highly proliferative and invasive TEBs
displayed the highest expression of p190-B (Fig. 4A
). Maximum level of p190-B message appears to be in the
outer cell layer (Fig. 4A
, arrow). Heterogeneous
expression levels of p190-B were also observed in the ABS and ducts and
in the S but at much reduced levels (compare the signal seen in
TEBs (Fig. 4A
) with the signal seen in ABS (Fig. 4D
) and ducts (Fig. 4G
) over the background as
seen in the sense controls depicted in Fig. 4, C, F, and I
on serial sections). These results
suggest that p190-B may play a role in normal mammary gland development
by facilitating the invasion of the TEBs into the surrounding fat pad.
Because neither good polyclonal nor good monoclonal antibodies
for p190-B were available, these results could not be further confirmed
at the protein level using immunohistochemical methods.
|
Interestingly, p190-B was differentially expressed during mammary
development. The highest level of expression was detected initially in
the virgin mammary gland of 45-day-old rats and maintained in old
virgin rats. p190-B mRNA levels then declined progressively during
pregnancy through lactation (Fig. 5A
). The relative levels of p190-B mRNA were compared with the
level of K18 mRNA (Fig. 5D
), a marker for ductal and
alveolar epithelial cells, to correct for the changes on both
epithelial cell content during mammary gland development and the
dilution effect of abundant milk protein mRNAs during lactation.
Using this correction, the relative expression of p190-B still
decreased significantly during late pregnancy and lactation when
compared with that of the 45-day-old virgin rats (Fig. 5E
).
The blot was also probed with ß-casein to indicate the integrity of
mRNA from pregnant and lactating glands (Fig. 5C
). The
relative decrease in expression of p190-B during pregnancy and
lactation as compared with that in the virgin mammary gland may be
attributed to the concomitant loss of TEBs with progressive
differentiation. These findings, therefore, support the earlier
observation of increased expression seen in the TEB fraction both by
DD-PCR and in situ hybridization.
|
|
|
|
|
Contrary to the expected 6.4- and 4.4-kb transcripts, an additional
8.5-kb transcript was detected in all of the mouse tumor RNAs analyzed.
To determine the origin of the third transcript, the blots were
hybridized to both 5' and 3' specific probes from p190-B cDNA. The 3'
specific probe gave rise to the expected 6.4- and 4.4-kb transcripts.
The 5' probe, however, resulted in the detection of all of the three
transcripts. The 5' end of p190-B shares significant homology to the
p190-A gene. The blot was, therefore, further hybridized to
p190-A specific probe. This p190-A probe detected the 8.5-kb band
(21)
. However, unlike p190-B, which displayed elevated
expression in a few tumors as compared with that observed in a
13-day pregnant mammary gland, p190-A expression was not
detectable in the 13-day pregnant mammary gland. It was, however,
detectable in all of the tumors analyzed (Fig. 8
; compare the signal
seen in bottom panel, Lane 1, with the signal seen in tumors
run in adjacent lanes), which suggests that it also may be
slightly up-regulated in all of the tumors analyzed in this study.
However, because we did not see a direct correlation between the
intensity of the 8.5-kb band in blots probed with the p190-B or the
p190-A probes, it is difficult to conclude whether the third transcript
in the mouse tumors is the result of cross-reactivity with p190-A
transcript. It is possible that the third transcript represents an as
yet unidentified isoform or a related gene transcript. This possibility
has not been completely excluded, because the complete genomic
structure of neither p190-B nor p190-A is known yet.
Overexpression of p190-B in MCF-10A Cells Results in Actin
Cytoskeleton Disruption.
Because overexpression of p190-B in TEBs and some less differentiated
tumors suggested that it might facilitate invasion of TEBs into the fat
pad during virgin mammary development and might also impart invasive
potential to some rodent mammary tumors, we wanted to understand how
p190-B might be implicated in signaling pathways that regulate ductal
morphogenesis, cell transformation, and/or invasion. Although, a direct
proof for its involvement in ductal morphogenesis can be obtained only
from experiments carried out using p190-B knockout mice mammary
epithelium, as an initial step we, therefore, first tried to understand
its role at the cellular level using transient transfection assays in
an in vitro cell culture model.
A hallmark of all transformed epithelia is the loss of distinctive
cell-to-cell contacts and the acquisition of migratory potential.
p190-B, as a negative regulator of Rho proteins, may directly influence
the adhesive capacity of a cell by affecting its actin stress fiber
organization. We tested this hypothesis by analyzing the actin
cytoskeletal architecture of p190-B-overexpressing cells. Accordingly,
p190-B was transiently transfected into MCF-10A human mammary
epithelial cells using an efficient adenovirus-mediated transfection
protocol (22)
. The MCF-10A cells have been characterized
as spontaneously immortalized, nontumorigenic, human breast epithelial
cells with a near diploid karyotype (23)
, and they possess
many of the markers characteristic of a normal mammary epithelial cell.
The function of p190-B was assessed by the simultaneous analysis of
actin stress fiber organization in p190-B-expressing cells grown on
coverslips using double immunofluorescence staining (see "Materials
and Methods"). The FITC-phalloidin staining pattern in the p190-B
expressing cells was circumferential as opposed to the fine overall
network of actin stress fibers observed in mock-transfected cells (Fig. 9
; compare A and C with B and
D). p190-B expression in these transfected cells appeared to
be punctate in the cytoplasm and was not localized at focal adhesions,
as might be expected if these cells had been grown on an ECM. However,
double immunofluorescence staining was used only to identify
transfected cells and not to study subcellular localization of p190-B
under different culture conditions. In additiondespite using
appropriate antibody dilutions to minimize background staining
problemsweak nuclear staining, which may be the result of nonspecific
cross-reactivity of the HA monoclonal antibody, was seen in some
mock-transfected and 190-B-transfected cells.
|
), as compared with only 9% of the mock-transfected
cells (Fig. 10A
). In addition, the majority of
p190-B-transfected cells exhibited a tendency to detach from the
MCF-10A cell clusters, and to remain as single, isolated cells (60%)
or in pairs detached from the cell monolayer (Fig. 10B
with
). When we further compared the tendency of both
transfected and mock-transfected cells to remain attached to the cell
monolayer, approximately 30% transfected cells (Fig. 10C
), as compared
with 80% mock transfected cells (Fig. 10C
), were found
attached to the monolayer. These studies suggest that p190-B
over-expression results in a disruption of the actin cytoskeleton,
which may, in turn, make the cells less adherent, an important step in
cell migration and invasion.
|
Both epidemiological studies and carcinogenesis experiments in rats indicate that hormonal changes during pregnancy exert a protective effect on breast cancer. Because rat and human mammary glands have similar developmental patterns and structural features, the rat has been used as a model system to identify the mechanism by which these hormones confer resistance (24) . Postnatal mammary development in rats commences during the 1st week after parturition. The primary duct branches into three to five secondary ducts. The distinctive club-shaped structures at the distal ends of the mammary ducts are the TEBs (25) . During adolescent mammary development the systemic hormones act on TEBs to stimulate proliferation and rapid ductal elongation into the mammary fat pad (8) . Carcinogenesis studies in rats have revealed that TEBs are also the major site for carcinogen-induced DNA damage (7) . Experiments were, therefore, initiated to isolate genes that were differentially expressed between TEBs, TDs, and S using a combination of DD-PCR and Reverse Northern techniques. Fourteen DD-PCR products, found primarily in the TEB Lanes of DD-PCR gels, were isolated, subcloned and sequenced, and compared with GenBank entries.
Although DD-PCR was the most suitable technique available at the time, two serious drawbacks were encountered: the generation of short 3' clones and the high incidence of false positives. The latter problem could be circumvented to some extent by confirming the DD-PCR results by Reverse Northern analysis. However, some of the clones did not provide a significant signal over background and were still below the level of detection by Reverse Northern using the phosphorimager for quantitation. In addition, because the TEBs and the M and S fractions were manually dissected from trypan blue-injected mammary glands of 10 different animals, the pooled fractions of RNA isolated were contaminated with tissue from the S. The availability of more recent techniques like laser-capture microdissection should eliminate these problems in future.
Despite these limitations, p190-B was found to be preferentially expressed in the TEBs. p190-B is a Rho-Gap member that is recruited to the sites of integrin clustering (18) . It encodes a protein with an NH2-terminal GTPase domain and a COOH-terminal Rho-Gap domain that stimulate the intrinsic GTPase activity of Rho, Rac, and cdc-42, thereby functioning as a negative regulator of their signal-transducing activity. p190-B shares some features in common with several members of the Ras, Rab, Ral, and Rho family of GTPases, but it is most closely related to p190-A, sharing 51% amino acid identity (see review 26 ). The sequences of both p190-A and -B are conserved among mouse, rats, and humans. In the present studies, differential expression of p190-B in TEBs of the rat virgin mammary gland and an increased expression in some less-well-differentiated murine mammary tumors were observed. Although the functional significance of increased p190-B expression in tumors remains to be investigated, overexpression of p190-B in "normal" human mammary epithelial cells resulted in the disruption of the actin cytoskeleton, which suggests, therefore, that it may facilitate cell migration and invasion. The direct involvement of Rho-Gaps in invadopodia formation in LOX melanoma cells has also been reported (27) . The Rho family of proteins have been implicated in the regulation of multiple signal transduction processes and are key components for the transforming action of diverse oncoproteins (reviewed in Ref. 28 ). They are also induced in response to receptor tyrosine kinase activation in human mammary epithelial cells, breast cancer tissues, and cell lines (29) .
The p190-B gene has been localized recently to mouse chromosome 12 and has been mapped to the conserved region of human chromosome 14; the closest linkage was to hsp70, which is located on 14q2224 (30) . This region has been shown to be amplified in a restricted group of human breast cancers (31) and to be deleted in ductal carcinoma in situ of the breast (32) by comparative genomic hybridization, thereby supporting the suggestion that the inappropriate regulation of this locus may be a factor in the etiology of breast cancer. Both the RNA expression profile during mammary development and the tissue distribution of p190-B suggest that p190-B may be required for ductal morphogenesis during virgin mammary gland development and that its aberrant expression may occur in aggressive tumors. The hypothesis that p190-B facilitates cell invasion by orchestrating the ECM-mediated integrin signals through Rho proteins, remains to be tested using stably transfected MCF-10A cells, with which it may be possible to study gain-of-function and loss-of-function mutants, and in vivo by generating a mammary gland-specific knockout of this gene.
Materials and Methods
Animals.
Wistar Furth rats with an inbred genetic background were obtained from
Harlan Sprague Dawley Inc. All of the animals were maintained and
killed according to Institutional Animal Care and Use
Committee-approved guidelines.
Tumor Tissues.
Dr. Daniel Medina (Baylor College of Medicine, Houston, TX) provided
the NMU-induced rat and mouse TM tumors.
Probes.
A full-length p190-B cDNA construct was a generous gift of Dr. Peter
Burbelo [Laboratory of Developmental Biology, National Institute of
Dental Research (NIDR), Bethesda, MD 20892]. Dr. Jeffrey
Settleman, Laboratory of Signal Transduction (Massachusetts General
Hospital Cancer Center, Charlestown, MA) kindly provided the
p190-A cDNA.
Antibodies.
Mouse monoclonal antibody (clone 12CA5) for HA epitope tag was
purchased from Boehringer Mannheim. FITC- phalloidin (Sigma) was a gift
from Dr. Bill Brinkley.
Adenovirus.
Adenovirus stocks were purchased from Dr. Nancy Weigels
laboratory Department of Molecular and Cellular Biology, Baylor
College of Medicine, Houston, TX 77030.
Mammary Gland Tissue Isolation by Dye Visualization.
TEBs and M and S tissue were isolated from the fourth inguinal mammary
glands of nulliparous 4245-day-old rats in the following manner.
After making a midline incision, the skin was separated from the
peritoneum, and the mammary gland was exposed. To visualize the mammary
ductal structure, the top portion of the fourth nipple was removed, and
the visualization dye (0.5% trypan blue w/v in PBS) was injected using
a 26-G needle. After complete infiltration of the dye throughout the
ductal tree, the three fractions were easily identified and surgically
isolated (see Fig. 1
). The tissue sections were snap-frozen in liquid
nitrogen and transferred to -80°C for storage until used for
isolation of RNA.
Isolation and Identification of DD-PCR Clones.
RT-PCR and PCR reactions were performed with the materials provided and
the protocols recommended for use of the RNAimage kit (GenHunter Corp,
Brooklyn, MA). Total RNA was prepared from each tissue region using
4-M guanidium isothiocyanate and CsCl buoyant-density
centrifugation (33)
. For each sample, two sets of three RT
reactions were prepared as per a previously described procedure
(16)
. The RT samples were then amplified by low-stringency
PCR in the presence of 20 pmol of
-35S-labeled
dATP (1200 Ci/mmol), the T-specific primer used in the RT reaction in
combination with various random 11mers supplied with the kit, and 1
unit of Ampli Taq polymerase (Perkin-Elmer Applied Biosystems).
To identify the differentially expressed genes, DD-PCR products from the three starting RNA populations (TEB, M, and S) were run on a 6% denaturing polyacrylamide gel, transferred to 3-mm Whatman paper, dried, and exposed to X-ray film (Eastman Kodak). To confirm the reproducibility of the banding pattern, each representative RT reaction was performed from two independent pools of RNA for each of the three regions (TEB, M, and S regions). Bands that were more intense in the TEB fraction were excised from the gel and reamplified. The PCR reaction was similar to the previous reaction except with 20 µM dNTP and no labeled nucleotide. The PCR products so generated were initially cloned into PCR-TRAP vector and then subcloned into HindIII site of pBluescript II (Stratagene).
Sequencing and Identification of DD-PCR Products.
The subcloned DD-PCR products, termed EDD clones were sequenced using
standard dideoxy chain termination methods. Both of the strands were
sequenced using T7 and T3 primers. BLAST search combined with repeat
masker was used to compare the clone sequences with GenBank entries.
Preparation and Analysis of Total RNA.
The fourth inguinal mammary glands from virgin, pregnant, and lactating
rats were dissected under anesthesia using standard surgical
procedures. Tissue was snap-frozen in liquid nitrogen and stored at
-80oC. Total cellular RNA was prepared using 4
M guanidium isothiocyanate and CsCl buoyant-density
centrifugation (33)
. RNA was fractionated on a 1.2%
formaldehyde agarose gel and transferred to Hybond N+ (Amersham)
membrane with 10x SSC. Hybridization was performed in Hybaid oven at
65oC using procedures recommended by Amersham.
The filters were quantitated for 1648 h using the PhosphorImager
(Molecular Dynamics). The data were normalized to the 28S rRNA signal.
Screening of High-Density Blots by Reverse Northern.
First strand 32P-cDNA was synthesized from 56
µg of total RNA from EB, M, and S fractions of the virgin mammary
gland using superscript II RT (Life Technologies, Inc.) in the presence
of 1 µg of oligo(dT)1218mer primers as per
manufacturers instructions. The cDNA was hydrolyzed by NaOH treatment
and neutralized with HCl treatment. The labeled cDNA was then purified
through a sephadex G50 column. The efficiency of the reaction was
monitored by determining the total radioactivity incorporated before
and after purification of the probe.
A total of eight DD-PCR clones and three control plasmids (K18, RPL19, and GAPDH) were subjected to PCR amplification. After amplification, a fixed amount of each of the PCR products was loaded onto high-density gels in triplicate (Centipede gel electrophoresis chambers; Owl Scientific, Woburn, MA). PCR products were alkali-denatured in the gel and blotted onto nylon membranes. The filters were hybridized with equivalent amounts of 32P-labeled single-stranded cDNA (specific activity, 1 x 109 cpm/µg) from TEB, M, and S regions of the virgin mammary gland. The filters were washed under stringent conditions as per the Church and Gilbert method (34) and quantitated using the phosphorimager. In addition, the filters were exposed to high-resolution Kodak Biomax MR films for up to 24 h at -80° C.
In Situ Hybridization.
Riboprobes were labeled with [33P]UTP (2500
Ci/mmol; Amersham), using the appropriate T3 or T7 transcription
systems from Stratagene. To generate the riboprobe templates, the cDNA
was linearized with a restriction enzyme so as to make an antisense
transcript that originates from the more divergent 3' end of the cDNA,
thus making it more specific for p190-B.
33P-riboprobes were used because, unlike
35S, 33P gives less
background, and very high specific-activity probes can be generated for
the detection of rare transcripts. The
33P-riboprobe was purified on a sephadex G50
column and counted in a scintillation counter.
Pretreatment of Slides and Hybridization.
The fourth inguinal mammary glands from virgin Wistar Furth rats were
excised and immediately fixed for 3 h in ice-cold 4%
paraformaldehyde in PBS, dehydrated in a graded series of ethanols to
xylene, and embedded in paraffin wax. Sections of 45 µm were
mounted on ProbeOn Plus slides (Fisher Biotech). Sections were baked
overnight at 37°C, dewaxed through xylene, and rehydrated through a
graded series of ethanols to PBS. After digestion with proteinase K (20
µg/ml; Sigma) at 50°C for 5 min, the sections were refixed in 4%
paraformaldehyde/PBS for 5 min. The sections were then acetylated in
100 mM triethanolamine and 25 mM acetic
anhydride and was dehydrated through ethanols. Sections were
prehybridized in 2x SSC, 50% formamide, 10% dextran sulfate, 1%
SDS, and 500 ng/ml denatured herring sperm DNA at 37°C in a sealed
humidified chamber. 33P-labeled riboprobe (1 x 105 cpm/µl) was diluted into 25 µl of
hybridization solution, which was then added to the solution already
covering the section. The sections were hybridized overnight at 42°C
in a sealed humidified chamber. The sections were subsequently washed
in 2x SSC at 55°C with the last wash in 0.1x SSC at 55°C.
Detection of the Radioactive Signal.
The sections were dehydrated in a graded series of ethanol/water
containing 0.3 M sodium acetate. The sections were
air-dried and coated with NTB2 nuclear emulsion (Eastman Kodak Co, NY)
and exposed in light-proof slide boxes for 4872 h. After development
(as per Kodak instructions), the sections were stained with either
hematoxylin or DAPI and visualized using dark-field microscopy in
combination with bright-field or fluorescence microscopy.
Construction of p190-B Expression Vector.
The expression plasmid was generated from an E3
plasmid4
provided by Dr. Peter Burbelo (Laboratory of Developmental Biology,
NIDR), which contains the complete coding sequence of p190-B
with flanking 5' and 3' untranslated sequences. A 1.2-kb
KpnI-EcoRV fragment from the 5' end was tagged at
the NH2 terminus with an HA sequence (nine amino
acids; YPYDVPDYA; Ref. 35
) by PCR using the forward
primer:
5'-CCGGTACCATGGGGTACCCATACGACGTCCCAGACTACGCTGCAAAAAACAAAGAGCCTCGTCCCCCATCC
(71mer), and the reverse primer:
5'-CTCGTGAAATCTTCGACTTTTTCAGATAGTCTTGGTACATGTCGTAGACTATAGGCTCTTCTCCTC
(66mer), with linearized E3 plasmid as the template. PCR was carried
out as follows: denaturation at 95°C for 5 min, followed by 25 cycles
of denaturation for 30 s at 95°C, annealing at 65°C for 3'
extension for 3 min at 72°C, after 10 min extension at 72°C. This
fragment was engineered to have a KpnI site at the 5' end
and a consensus Kozak sequence before the starting ATG. The
generated fragment was cloned into KpnI-EcoRV
site of PCR3.1 vector (Invitrogen). This vector was further cut with
EcoRV and NotI to accommodate a 3'
EcoRV-NotI fragment from the E3 plasmid. A
KpnI-NotI fragment from this second-generation
construct represents the complete coding region of p190-B and about
180bp of 3' untranslated region.
Cell Culture and Transfection.
Human breast epithelial cells (MCF-10A) were obtained from Barbara Ann
Karmanos Cancer Institute (passage 149) and cultured in DMEM:F12 Media
(1:1) supplemented with 5% serum, insulin (10 µg/ml), epidermal
growth factor (20ng/ml), cholera toxin (100ng/ml), hydrocortisone (0.5
µg/ml), penicillin 100 units/ml, streptomycin (100 µg/ml), and
fungizone (0.5 µg/ml). Cells were split 1:3 to 1:4 and passaged every
34 days. MCF-10A cells (2 x 105) were
seeded onto coverslips 24 h before transient transfection and
transfected with either 2 µg of p190-B expression plasmid or the
control vector using adenovirus-DNA-lysine cocktail in
serum-free media (22)
. To normalize for transfection
efficiency, 400 ng of cytomegalovirus ß-galactosidase was
cotransfected as a tracer. Twelve h after transfection, the cells were
switched to complete media for another 2436 h. The cells were fixed
and stained for simultaneous detection of p190-B and the actin
cytoskeleton, as described previously (36)
. The anti-HA
antibody was used at a dilution. of 1:500, whereas FITC-phalloidin was
used at a dilution of 1:1000. Goat antimouse IgG (Santa Cruz
Biotechnology) conjugated with Texas Red was used as the secondary
antibody against HA-antibody. The cells were analyzed by indirect
immunofluorescence, and images were collected at 5-µm steps using a
DeltaVision deconvolution microscope from Applied Precision, Inc.
(Issaquah, WA). Thirty of such 5-µm images were rendered to make a
projection using the softWoRx imaging workstation (also from Applied
Precision, Inc.).
Acknowledgments
We thank Drs. D. Medina and N. Greenberg for their critical evaluation of the manuscript; Dr. Peter Burbelo, Laboratory of Developmental Biology, NIDR, for providing the p190-B cDNA; and Dr. Jeffrey Settleman (Laboratory of Signal Transduction, Massachusetts General Hospital Cancer Center Charlestown, MA 02129) for providing the p190-A cDNA. We thank Dr. D. Medina (Baylor University, Houston, TX) for also providing the mouse and rat tumor samples. Special thanks to Frank Herbert from the Cell Biology Microscopy Core and Dr. Elena B. Kabotyanski for helping with the deconvolution microscopy.
Footnotes
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported by grants from the Army
Breast Cancer Research Program USAMRDC DAMD 17-94-J4253 and by NIH
Grant CA64255. ![]()
2 To whom requests for reprints should be
addressed, at Department of Cell Biology, Baylor College of Medicine,
Houston, TX 77030. E-mail: jrosen{at}bcm.tmc.edu ![]()
3 The abbreviations used are: NMU,
nitrosomethylurea; TD, terminal duct; EB, end bud; TEB, terminal EB;
ABS, alveolar buds; DD, differential display; EDD, EB DD; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; K18, Keratin-18; RT, reverse
transcription; M, midgland (tissue); S, stroma/stromal (tissue); ECM,
extracellular matrix; TRAP, telomeric repeat amplification protocol;
DAPI, 4',6-diamidino-2-phenylindole; EtBr, ethidium bromide; oligo(dT),
oligodeoxythymidylic acid. ![]()
4 P. Burbelo, unpublished data. ![]()
Received for publication 6/21/99. Revision received 3/15/00. Accepted for publication 5/22/00.
References
This article has been cited by other articles:
![]() |
D. Vaught, J. Chen, and D. M. Brantley-Sieders Regulation of Mammary Gland Branching Morphogenesis by EphA2 Receptor Tyrosine Kinase Mol. Biol. Cell, May 15, 2009; 20(10): 2572 - 2581. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Shen, H.-Y. Chen, M.-S. Lin, F.-Y. Li, C.-C. Chang, M.-L. Kuo, J. Settleman, and R.-H. Chen Breast Tumor Kinase Phosphorylates p190RhoGAP to Regulate Rho and Ras and Promote Breast Carcinoma Growth, Migration, and Invasion Cancer Res., October 1, 2008; 68(19): 7779 - 7787. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Vargo-Gogola, B. M. Heckman, E. J. Gunther, L. A. Chodosh, and J. M. Rosen P190-B Rho GTPase-Activating Protein Overexpression Disrupts Ductal Morphogenesis and Induces Hyperplastic Lesions in the Developing Mammary Gland Mol. Endocrinol., June 1, 2006; 20(6): 1391 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Hahn, Z. J. Su, C. J. Drogemuller, A. Tsykin, S. R. Waterman, P. J. Brautigan, S. Yu, G. Kremmidiotis, A. Gardner, P. J. Solomon, et al. Expression profiling reveals functionally important genes and coordinately regulated signaling pathway genes during in vitro angiogenesis Physiol Genomics, June 16, 2005; 22(1): 57 - 69. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Parsons, J. Monypenny, S. M. Ameer-Beg, T. H. Millard, L. M. Machesky, M. Peter, M. D. Keppler, G. Schiavo, R. Watson, J. Chernoff, et al. Spatially Distinct Binding of Cdc42 to PAK1 and N-WASP in Breast Carcinoma Cells Mol. Cell. Biol., March 1, 2005; 25(5): 1680 - 1695. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ruan, M. E. Monaco, and D. L. Kleinberg Progesterone Stimulates Mammary Gland Ductal Morphogenesis by Synergizing with and Enhancing Insulin-Like Growth Factor-I Action Endocrinology, March 1, 2005; 146(3): 1170 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Kontaridis, S. Eminaga, M. Fornaro, C. I. Zito, R. Sordella, J. Settleman, and A. M. Bennett SHP-2 Positively Regulates Myogenesis by Coupling to the Rho GTPase Signaling Pathway Mol. Cell. Biol., June 15, 2004; 24(12): 5340 - 5352. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Wozniak, R. Desai, P. A. Solski, C. J. Der, and P. J. Keely ROCK-generated contractility regulates breast epithelial cell differentiation in response to the physical properties of a three-dimensional collagen matrix J. Cell Biol., November 10, 2003; 163(3): 583 - 595. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cell Growth & Differentiation |