CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chakravarty, G.
Right arrow Articles by Rosen, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chakravarty, G.
Right arrow Articles by Rosen, J. M.
Cell Growth & Differentiation Vol. 11, 343-354, July 2000
© 2000 American Association for Cancer Research


Articles

p190-B, a Rho-GTPase-activating Protein, Is Differentially Expressed in Terminal End Buds and Breast Cancer1

Geetika Chakravarty, Deana Roy, Maria Gonzales, Jason Gay, Alejandro Contreras and Jeffrey M. Rosen2

Department of Cell Biology, Baylor College of Medicine, Houston, Texas 77030

Abstract

Microdissection and differential display PCR were used to identify genes preferentially expressed in the highly proliferative terminal end buds (TEBs) in the mammary gland of 45-day-old virgin rats. One clone exhibited 87% homology to the human p190-B gene encoding a novel Rho-Gap. Using in situ hybridization, p190-B was detected in both the TEBs and the terminal ducts, with the highest expression observed in the outer layer of TEBs. During normal mammary gland development, p190-B mRNA expression was highest in the virgin mammary gland and decreased during late pregnancy and lactation. Interestingly, increased levels of p190-B mRNA relative to the normal mammary gland were seen in a subset of murine mammary tumors that appeared to be less well differentiated and potentially more aggressive. Transient transfection of a p190-B expression construct into MCF-10A human mammary epithelial cells resulted in disruption of the actin cytoskeleton, which suggests a role for p190-B in regulating the signaling pathways that influence cell migration and invasion. These results suggest that p190-B may be required for virgin mammary gland development, and its aberrant expression may occur in breast cancer.

Introduction

A woman’s reproductive history is one of the principal determinants of her susceptibility to breast cancer. An early full-term pregnancy is protective and the length of time between menarche and the first full-term pregnancy seems to be critical for the initiation of breast cancer (1) . This phenomenon has been extensively modeled in rat model systems, in which pregnancy per se (2) , (3) or treatment with estrogen and progesterone has been shown to be highly protective against NMU3 -induced carcinogenesis (4, 5) . Recently, parity-induced protection has also been reproduced in a mouse model (6) . Although the mechanism for this protective effect has not been defined, Russo and Russo (7) have suggested that the protective effects of an early full-term pregnancy result from estrogen- and progesterone-induced differentiation of mammary epithelial cells and the concomitant loss of cells susceptible to carcinogenesis. The effects of estrogen and progesterone are mediated by the induction of specific "local mediators," i. e., growth factors that act via autocrine and paracrine mechanisms to influence TD and TEB growth and differentiation (8) . These factors may induce persistent alterations in intracellular pathways that govern the proliferative response of mammary cells to carcinogenic action (9) . An alternative to Russo’s hypothesis suggests, however, that other alterations in addition to differentiation of the TEB and TD might explain the refractoriness to mammary carcinogenesis (10) . Regardless of which hypothesis is correct, no molecular markers are available to identify and follow the fate of the highly susceptible TEB cells. Yet, such intermediate biomarkers will be required to develop effective diagnostic tools and preventive therapies for breast cancer.

TEBs are composed of highly proliferative cells thought to be the most susceptible to neoplastic transformation. Ductal morphogenesis is accompanied by the penetration of these proliferative cells into the surrounding fat pad. The TEB contains two histologically distinct cell types: the more central body cells and the outer cap cells. The highest levels of proliferation are observed in the cap cells, whereas the body cells surrounding the lumen are highly apoptotic, thus providing a mechanism to generate a ductal structure (11) . With each estrous cycle, most of the TEBs in mature animals progressively differentiate into ABS. A small population become atrophic and give rise to TDs. Both TEBs and TDs are targets for carcinogen action in young and old virgin rats, respectively.

The objective of this study was to identify molecular markers for TEB and TD cells to follow their fate during mammary development and carcinogenesis. To do so, we sought to identify genes that were differentially expressed between TEBs and the M and S regions of the nulliparous rat mammary gland. A large repertoire of techniques, such as subtractive hybridization of cDNA (12) , cDNA arrays (13) , representational difference analysis (14) , and serial analysis of gene expression (reviewed in Ref. 15 ), now exist that are capable of generating a profile that reflects the presence of differentially expressed transcripts. However, with DD-PCR (16) , multiple RNA samples can be compared at one time. Moreover, as little as 5 µg of total RNA per sample is enough to carry out the analysis. Thus, when these studies were initiated, DD-PCR was the preferred method because only microgram quantities of RNA could be isolated from the various dissected regions of the mammary gland. In all, 14 differentially expressed cDNA fragments were subcloned from the TEB region and sequenced to identify potentially interesting genes. This study reports the identification and characterization of a Rho-GTPase-activating protein, p190-B, that may be required for virgin mammary gland development and may play a role in mammary neoplasia.

Results

Isolation of TEB Specific Genes.
DD-PCR analysis of the RNA samples obtained from the dissection of TEB and of M and S regions of the rat virgin mammary gland (Fig. 1Citation ) resulted in the isolation of 14 clones that were preferentially expressed in the TEB (Fig. 2Citation ). Some of these clones were identified because their differential expression pattern could be reproduced in parallel runs of two different pools of RNA (see Fig. 2, A and BCitation ). Homology searches were performed using BLAST (software) searches against the GenBank database (17) . A summary of the genes showing homology to the EDD clones is presented in Table 1Citation . Ten of the EDD clones had a high similarity to sequences in the database. Although five of these clones are expressed sequence tags (ESTs) with unknown functions, the remaining clones were identified as genes whose products perform a wide range of functions, such as growth factors, signaling molecules, cell surface receptors, mitochondrial products, and a mineral binding protein.



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 1. Isolation of mammary tissue fractions by dye visualization. A, diagram of the virgin mammary gland; end bud (EB), midgland (M), and nipple (N), adapted from Ref. 25 . B, mammary tissue fractions dissected from a 45-day-old nulliparous rat after visualization of the ductal tree with trypan blue; stroma (S).

 


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 2. Representative denaturing polyacrylamide gel for DD analysis to detect cDNAs preferentially expressed in EB fraction of the mammary gland. 35S-labeled dATP DD-PCR products from three sets of RNA designated E, M, and S were run in adjacent lanes. A, DD gels using primer combination (T11-G + AP2); B, DD gels using primer combination (T11-C + AP8); C, DD gels using primer combination (T11-C + AP7). To minimize false-positive bands, each reaction was performed from two independent pools of RNA, and only those bands that were reproducible (arrows) were picked up for further analysis. To control for false positives from contaminating DNA, a -RT reaction was subjected to the same PCR conditions and run in parallel lanes (data not shown).

 

View this table:
[in this window]
[in a new window]
 
Table 1 Summary chart of genes that are preferentially expressed in TEB region of the rat virgin mammary gland

The DD-PCR clones were compared to GenBank sequences to identify potential homologues using a BLASTN search.

 
To further confirm these results, we followed the expression of EDD clones by "Reverse Northern," in which a fixed amount of each of the amplified DD-PCR clone was run on high-density gels and were probed with reverse-transcribed radiolabeled cRNA probes. Unlike conventional Northern analysis, in this technique, the cDNA clones are blotted onto nylon membranes and probed with reverse-transcribed cRNA probes (12) . The abundance of a transcript in the RNA used for RT should determine the signal intensity on the blot. This method was used because of the relatively low abundance and the difficulty in obtaining poly(A)+ RNA from micro-dissected TEB fractions required for Northern blot or RNase protection analyses. To increase the sensitivity of the assay, each of the selected clones was run in duplicate at two different concentrations. Expression of housekeeping genes like GAPDH and L19 were used to monitor the efficiency of RT reaction whereas K18, expressed only in epithelial cells, provided the positive control to determine the sensitivity of this method to identify differentially expressed genes. K18 expression was detected in both TEB and M fractions. which contain primarily epithelial cells, whereas the S fraction, which is exclusively from S, was negative for K18 expression (Fig. 3Citation ).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. Quantitative analysis of p190-B expression in TEB, M, and S fractions of the mammary gland by Reverse Northern: DD-PCR clones were PCR-amplified, and an equal amount of each clone was run in duplicate in a three-tier gel system and hybridized with oligo(dT)-primed 32P-radiolabeled reverse-transcribed cDNA (see "Materials and Methods") from EB, M, and S fractions. The filters were exposed to phosphorimager overnight and quantitated using the software Imagequant (Molecular Dynamics). The data were normalized for RPL19 expression and represent the mean fold-change over GAPDH expression ± SE. Results are representative of three independent experiments.

 
Despite the limitations of microdissecting a three-dimensional structure, Reverse Northern analysis confirmed the overexpression of EDDC2 in the TEB fraction (Fig. 3)Citation . Although, Reverse Northern analysis revealed only a minimal increase in C2 expression in TEB fractions, it may still have important functional ramifications inasmuch as all of the DD-PCR clones encoded very low abundance mRNAs when compared with genes like GAPDH and K18, which were used as positive controls for this experiment. Expression of Clone G7 on the other hand was high in both TEB and S fractions. Similarly, G5 expression was high in S and M fractions. Some of the clones, however, did not provide a significant signal over background and were still below the level of detection by Reverse Northern and, hence, could not be quantitated using the phosphorrimager. Although DD-PCR analysis revealed several-fold higher expression of EDD clones G6, G7, and C18 in TEB fraction (Fig. 2)Citation and looked more promising when compared with EDD clone C2 (see Fig. 2Citation ), additional studies were restricted to EDD clone C2 for the following reasons: (a) differential expression of this clone could be confirmed by more than one technique; and (b) as opposed to G6, G7, and C18, which had no homology to known genes and necessitated isolation of full-length clones, EDD clone C2 was 87% homologous to a novel Rho-Gap family member, p190-B, in a non-Rho-Gap region. A full-length p190-B clone was, thus, available for further analysis to determine whether it was differentially expressed during mammary development and carcinogenesis.

Localization of p190-B Transcripts by in Situ Hybridization.
p190-B belongs to the Rho-Gap family of proteins and has many family members, the closest being p190-A. p190-B has been implicated in integrin signaling and cytoskeletal reorganization (18) . Because p190-Rho-Gaps enhance the conversion of GTP-Rho to GDP-Rho, they negatively regulate cytoskeletal assembly and have a role in cell motility and invasion. (See review 19 ).

To confirm the differential tissue distribution of p190-B in the virgin mammary gland, the cDNA was linearized to generate a 33P-riboprobe for the detection of its transcript at the single cell level by in situ hybridization. In agreement with the DD-PCR and Reverse Northern data, in situ hybridization revealed that the highly proliferative and invasive TEBs displayed the highest expression of p190-B (Fig. 4ACitation ). Maximum level of p190-B message appears to be in the outer cell layer (Fig. 4ACitation , arrow). Heterogeneous expression levels of p190-B were also observed in the ABS and ducts and in the S but at much reduced levels (compare the signal seen in TEBs (Fig. 4ACitation ) with the signal seen in ABS (Fig. 4DCitation ) and ducts (Fig. 4GCitation ) over the background as seen in the sense controls depicted in Fig. 4, C, F, and ICitation on serial sections). These results suggest that p190-B may play a role in normal mammary gland development by facilitating the invasion of the TEBs into the surrounding fat pad. Because neither good polyclonal nor good monoclonal antibodies for p190-B were available, these results could not be further confirmed at the protein level using immunohistochemical methods.



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 4. In situ localization of p190-B gene expression in the virgin mammary gland. Dark field illuminations of x200 fields showing hybridization to the in vitro transcribed 33P-labeled p190-B transcripts. A (TEB), D (ABS), and G (Duct) show hybridization to the antisense transcripts. B, E, and H show the corresponding hematoxylin staining of the regions in A, D, and G at the same magnification. C (TEB), F (ABS), and I (Duct) show dark field illuminations of x200 fields and hybridization to sense transcripts on a serial section.

 
p190-B Gene Expression during Mammary Development.
In addition to systemic hormones and local growth factors, the S, ECM, and ECM-signaling proteins play a critical role in tissue remodeling and mammary gland development. Because p190-B may be directly involved in the regulation of the actin cytoskeleton and may, therefore, influence mammary morphogenesis, its expression was analyzed in various adult rat tissues and in mammary glands of Wistar Furth rats at different developmental stages. As reported previously (18) , p190-B cDNA is encoded by 6.4- and 4.4-kb transcripts. p190-B is expressed in several adult tissues including lung, liver, kidney, brain, and heart, and at much lower levels in ovary and uterus (data not shown).

Interestingly, p190-B was differentially expressed during mammary development. The highest level of expression was detected initially in the virgin mammary gland of 45-day-old rats and maintained in old virgin rats. p190-B mRNA levels then declined progressively during pregnancy through lactation (Fig. 5ACitation ). The relative levels of p190-B mRNA were compared with the level of K18 mRNA (Fig. 5DCitation ), a marker for ductal and alveolar epithelial cells, to correct for the changes on both epithelial cell content during mammary gland development and the dilution effect of abundant milk protein mRNAs during lactation. Using this correction, the relative expression of p190-B still decreased significantly during late pregnancy and lactation when compared with that of the 45-day-old virgin rats (Fig. 5ECitation ). The blot was also probed with ß-casein to indicate the integrity of mRNA from pregnant and lactating glands (Fig. 5CCitation ). The relative decrease in expression of p190-B during pregnancy and lactation as compared with that in the virgin mammary gland may be attributed to the concomitant loss of TEBs with progressive differentiation. These findings, therefore, support the earlier observation of increased expression seen in the TEB fraction both by DD-PCR and in situ hybridization.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5. Differential expression of p190-B during mammary development. Total cellular RNA (20 µg) from the fourth inguinal mammary gland was isolated from Wistar Furth rats at the following developmental stages: 45-day-old virgin (45dV), 120-day-old virgin (120dV), 12 days of pregnancy (12dP), 18 days of pregnancy (18dP), 2 days of lactation (2dL), 10 days of lactation (10dL), and 10 days of lactation followed by 5 days of involution, induced by forced removal of the pups from the mother (5dINV). A, total RNA hybridized to 32P-labeled p190-B cDNA and exposed to films for 24–48 h. B, EtBr staining demonstrates equal loading of RNA. C, blot (as in A) stripped and rehybridized to ß-casein cDNA. D, blot (as in A) stripped and rehybridized to K18 cDNA to normalize for epithelial content. The K18 signal was obtained from an 8–10-h exposure to the film as opposed to a 48-h exposure for the p190-B cDNA. E, phosphorimager quantitation of p190-B expression during mammary development. The blots were exposed to the phosphorimager for 24 h, and the results were quantitated using the software Imagequant (Molecular Dynamics). The ratio of p190-B:K18 expression is plotted as fold change over that of 45-day virgin expression in arbitrary volume units/µg RNA. Error bars, SE. Results are representative of three independent experiments. Because the RNA samples from 5dINV showed some degradation, they were excluded from quantitative analysis.

 
p190-B Is Overexpressed in Some Murine Mammary Tumors.
On the basis of the observation that p190-B was expressed at higher levels in the less differentiated mammary gland (virgin mammary gland) and at stages representing increased proliferation (i.e., 45-day virgin and early pregnancy), its expression was analyzed in a limited number of primary, rat NMU-induced tumors. Indeed, p190-B was highly expressed in 7 (35%) of 20 NMU-induced tumors analyzed. The expression level varied from 2-fold to several hundred-fold when compared with that of a 45-day- old rat virgin mammary gland, the time at which the animals received the carcinogen (Table 2Citation and Fig. 6Citation ; see Lane 1 control versus Lanes 3, 4, 9, and 10). p190-B expression in these samples was normalized using 28S RNA. Increased expression of p190-B mRNA was never observed in age-matched virgin animals [P = 0.000; df, 1; Fisher’s exact test (two-tailed)], and was not changed as a function of aging. When the controls were more than 200 days old, none of the rats ever developed spontaneous tumors or displayed increased expression of p190-B in the normal mammary glands.


View this table:
[in this window]
[in a new window]
 
Table 2 Summary of p190-B expression in NMU tumors and age-matched virgin mammary glands

Data were obtained from several independent Northern blot analyses. The percentage of tumor/glands with overexpression of p190-B are noted in parentheses.

 


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 6. Increased p190-B mRNA expression in some rodent mammary tumors. Total RNA (20 µg) from the indicated murine mammary tumors was hybridized to a 32P-labeled p190-B cDNA and analyzed for p190-B expression using Northern blotting. Top, representative rat NMU- induced mammary tumors (T1, T2, T3 and so forth) were analyzed for p190-B expression. Left-most lane, normal mammary gland RNA from a 45-day-old virgin rat (the time at which the animal received the carcinogen) and was used as a control for analyzing overexpression in NMU tumor RNA (loaded in adjacent lanes). Bottom, EtBr staining of the RNA gel.

 
Interestingly, when in situ hybridization was used to identify the cell populations expressing p190-B mRNA, no detectable signal was observed in areas of the tumor that exhibited normal mammary epithelial histology (Fig. 7ACitation ; see B for representative histology of the region in A). In contrast, both the S and less-well-differentiated epithelium of the NMU-induced tumors expressed p190-B mRNA (Fig. 7CCitation ; see D for representative histology of the region in C). However, a second, more highly differentiated tumor, did not contain detectable p190-B transcripts (Fig. 7ECitation ; see F for representative histology of the region in E). In other tumors, p190-B expression was localized to regions that were also less well differentiated (data not shown). These studies suggest that the heterogeneous expression of p190-B that was observed in different NMU-induced tumors may be attributed to differences in epithelial cell types and/or epithelial-Sl interactions in these tumors.



View larger version (135K):
[in this window]
[in a new window]
 
Fig. 7. Heterogeneous expression of p190-B in some rodent mammary tumors. A, C, and E, the dark field illumination of the tumor sections hybridized to the in vitro transcribed 33P-antisense transcript for p190-B. The normal epithelium in A does not show hybridization to the probe. On the other hand, a strong hybridization signal is seen in both the epithelial and the S regions of the tumor in C. Because the tumor sections used for in situ analysis were stained with DAPI and visualized using fluorescence microscopy, H&E images from an adjacent section are included in B, D, and F as an illustration of the representative histology of the same tumor. All of the photomicrographs were taken at x100. Data for sense controls are not shown.

 
To determine whether p190-B expression was altered during cancer progression, its expression was also analyzed in a set of mouse TM tumors (20) . TM tumors are grown by injecting TM cell lines into the mammary fat pad of syngeneic mice. p190-B expression was studied in these tumors because a complete spectrum of tumors ranging from hyperplastic nodules (HAN) to malignant tumors was available for study. Because the TM alveolar hyperplasias are morphologically similar to midpregnant mammary glands, p190-B expression in these hyperplasias and tumors was compared with that of a mouse at day 13 of pregnancy. p190-B expression in 7 (44%) of 16 tumors varied from 0.5- to 8-fold (Fig. 8Citation top panel; compare the control in Lanes 1 to the tumor samples in Lanes 4, 5, 6, and 7) when normalized with 28S RNA. In contrast, the level of expression ranged from 2- to 100-fold in NMU tumors.



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 8. p190-B mRNA expression in some murine mammary tumors. Top, representative mouse TM mammary tumors analyzed for p190-B expression. Left lane, total RNA from normal mammary gland of a 13-day pregnant C57BL/6 mice was used as a control for comparing the levels as seen in tumor RNA samples designated TM4, TM10, or TM40D. T and H extensions have been used to indicate a tumor or a hyperplasia. Middle, EtBr staining of the gel. Bottom, The blot was stripped and hybridized to p190-A cDNA to confirm the origin of the third transcript seen in mouse tumor RNA panel.

 
These studies suggest that increased expression of p190-B mRNA may be associated with breast cancer. Although the functional significance of p190-B expression in hyperplasias and/or tumors remains to be investigated, this increase may reflect potentiation of the tumorigenic or invasive potential of these tumors. It is, however, important to note that the hyperplasias used in our study did not appear de novo but, instead, are maintained as transplants. It is possible that, under these circumstances, there was selection for p190-B expression in vivo. A more detailed analysis of p190-B expression in various other tumor types is in progress.

Contrary to the expected 6.4- and 4.4-kb transcripts, an additional 8.5-kb transcript was detected in all of the mouse tumor RNAs analyzed. To determine the origin of the third transcript, the blots were hybridized to both 5' and 3' specific probes from p190-B cDNA. The 3' specific probe gave rise to the expected 6.4- and 4.4-kb transcripts. The 5' probe, however, resulted in the detection of all of the three transcripts. The 5' end of p190-B shares significant homology to the p190-A gene. The blot was, therefore, further hybridized to p190-A specific probe. This p190-A probe detected the 8.5-kb band (21) . However, unlike p190-B, which displayed elevated expression in a few tumors as compared with that observed in a 13-day pregnant mammary gland, p190-A expression was not detectable in the 13-day pregnant mammary gland. It was, however, detectable in all of the tumors analyzed (Fig. 8Citation ; compare the signal seen in bottom panel, Lane 1, with the signal seen in tumors run in adjacent lanes), which suggests that it also may be slightly up-regulated in all of the tumors analyzed in this study. However, because we did not see a direct correlation between the intensity of the 8.5-kb band in blots probed with the p190-B or the p190-A probes, it is difficult to conclude whether the third transcript in the mouse tumors is the result of cross-reactivity with p190-A transcript. It is possible that the third transcript represents an as yet unidentified isoform or a related gene transcript. This possibility has not been completely excluded, because the complete genomic structure of neither p190-B nor p190-A is known yet.

Overexpression of p190-B in MCF-10A Cells Results in Actin Cytoskeleton Disruption.
Because overexpression of p190-B in TEBs and some less differentiated tumors suggested that it might facilitate invasion of TEBs into the fat pad during virgin mammary development and might also impart invasive potential to some rodent mammary tumors, we wanted to understand how p190-B might be implicated in signaling pathways that regulate ductal morphogenesis, cell transformation, and/or invasion. Although, a direct proof for its involvement in ductal morphogenesis can be obtained only from experiments carried out using p190-B knockout mice mammary epithelium, as an initial step we, therefore, first tried to understand its role at the cellular level using transient transfection assays in an in vitro cell culture model.

A hallmark of all transformed epithelia is the loss of distinctive cell-to-cell contacts and the acquisition of migratory potential. p190-B, as a negative regulator of Rho proteins, may directly influence the adhesive capacity of a cell by affecting its actin stress fiber organization. We tested this hypothesis by analyzing the actin cytoskeletal architecture of p190-B-overexpressing cells. Accordingly, p190-B was transiently transfected into MCF-10A human mammary epithelial cells using an efficient adenovirus-mediated transfection protocol (22) . The MCF-10A cells have been characterized as spontaneously immortalized, nontumorigenic, human breast epithelial cells with a near diploid karyotype (23) , and they possess many of the markers characteristic of a normal mammary epithelial cell. The function of p190-B was assessed by the simultaneous analysis of actin stress fiber organization in p190-B-expressing cells grown on coverslips using double immunofluorescence staining (see "Materials and Methods"). The FITC-phalloidin staining pattern in the p190-B expressing cells was circumferential as opposed to the fine overall network of actin stress fibers observed in mock-transfected cells (Fig. 9Citation ; compare A and C with B and D). p190-B expression in these transfected cells appeared to be punctate in the cytoplasm and was not localized at focal adhesions, as might be expected if these cells had been grown on an ECM. However, double immunofluorescence staining was used only to identify transfected cells and not to study subcellular localization of p190-B under different culture conditions. In addition—despite using appropriate antibody dilutions to minimize background staining problems—weak nuclear staining, which may be the result of nonspecific cross-reactivity of the HA monoclonal antibody, was seen in some mock-transfected and 190-B-transfected cells.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 9. p190-B-induced actin cytoskeletal reorganization in MCF-10A cells. MCF-10A cells were transiently transfected either with the vector alone or with a p190-B expression construct and were grown on coverslips, fixed, and simultaneously stained with anti-HA antibody and FITC-phalloidin, as described in "Materials and Methods." A and C, vector-transfected control cells. B and D, cells transfected with a HA-tagged p190-B construct. The p190-B transfected cells have a markedly reduced actin stress fiber network and exhibit circumferential staining for actin. All of the photomicrographs were taken on a DeltaVision deconvolution microscope using the x63 lens.

 
Eighty-four % of p190-B-transfected cells exhibited a significantly reduced actin stress fiber network (Fig. 10ACitation , ), as compared with only 9% of the mock-transfected cells (Fig. 10ACitation , {blacksquare}). In addition, the majority of p190-B-transfected cells exhibited a tendency to detach from the MCF-10A cell clusters, and to remain as single, isolated cells (60%) or in pairs detached from the cell monolayer (Fig. 10BCitation ; compare with {blacksquare}). When we further compared the tendency of both transfected and mock-transfected cells to remain attached to the cell monolayer, approximately 30% transfected cells (Fig. 10CCitation , ), as compared with 80% mock transfected cells (Fig. 10CCitation , {blacksquare}), were found attached to the monolayer. These studies suggest that p190-B over-expression results in a disruption of the actin cytoskeleton, which may, in turn, make the cells less adherent, an important step in cell migration and invasion.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 10. A total of 100 cells each of transfected () and vector-transfected cells ({blacksquare}) were scored for the loss of actin fibrils (A), the presence of single isolated cells (B), and whether the cells were attached to the monolayer (C). The data were normalized for transfection efficiency. Error bars, SE from three separate experiments.

 
Discussion

Both epidemiological studies and carcinogenesis experiments in rats indicate that hormonal changes during pregnancy exert a protective effect on breast cancer. Because rat and human mammary glands have similar developmental patterns and structural features, the rat has been used as a model system to identify the mechanism by which these hormones confer resistance (24) . Postnatal mammary development in rats commences during the 1st week after parturition. The primary duct branches into three to five secondary ducts. The distinctive club-shaped structures at the distal ends of the mammary ducts are the TEBs (25) . During adolescent mammary development the systemic hormones act on TEBs to stimulate proliferation and rapid ductal elongation into the mammary fat pad (8) . Carcinogenesis studies in rats have revealed that TEBs are also the major site for carcinogen-induced DNA damage (7) . Experiments were, therefore, initiated to isolate genes that were differentially expressed between TEBs, TDs, and S using a combination of DD-PCR and Reverse Northern techniques. Fourteen DD-PCR products, found primarily in the TEB Lanes of DD-PCR gels, were isolated, subcloned and sequenced, and compared with GenBank entries.

Although DD-PCR was the most suitable technique available at the time, two serious drawbacks were encountered: the generation of short 3' clones and the high incidence of false positives. The latter problem could be circumvented to some extent by confirming the DD-PCR results by Reverse Northern analysis. However, some of the clones did not provide a significant signal over background and were still below the level of detection by Reverse Northern using the phosphorimager for quantitation. In addition, because the TEBs and the M and S fractions were manually dissected from trypan blue-injected mammary glands of 10 different animals, the pooled fractions of RNA isolated were contaminated with tissue from the S. The availability of more recent techniques like laser-capture microdissection should eliminate these problems in future.

Despite these limitations, p190-B was found to be preferentially expressed in the TEBs. p190-B is a Rho-Gap member that is recruited to the sites of integrin clustering (18) . It encodes a protein with an NH2-terminal GTPase domain and a COOH-terminal Rho-Gap domain that stimulate the intrinsic GTPase activity of Rho, Rac, and cdc-42, thereby functioning as a negative regulator of their signal-transducing activity. p190-B shares some features in common with several members of the Ras, Rab, Ral, and Rho family of GTPases, but it is most closely related to p190-A, sharing 51% amino acid identity (see review 26 ). The sequences of both p190-A and -B are conserved among mouse, rats, and humans. In the present studies, differential expression of p190-B in TEBs of the rat virgin mammary gland and an increased expression in some less-well-differentiated murine mammary tumors were observed. Although the functional significance of increased p190-B expression in tumors remains to be investigated, overexpression of p190-B in "normal" human mammary epithelial cells resulted in the disruption of the actin cytoskeleton, which suggests, therefore, that it may facilitate cell migration and invasion. The direct involvement of Rho-Gaps in invadopodia formation in LOX melanoma cells has also been reported (27) . The Rho family of proteins have been implicated in the regulation of multiple signal transduction processes and are key components for the transforming action of diverse oncoproteins (reviewed in Ref. 28 ). They are also induced in response to receptor tyrosine kinase activation in human mammary epithelial cells, breast cancer tissues, and cell lines (29) .

The p190-B gene has been localized recently to mouse chromosome 12 and has been mapped to the conserved region of human chromosome 14; the closest linkage was to hsp70, which is located on 14q22–24 (30) . This region has been shown to be amplified in a restricted group of human breast cancers (31) and to be deleted in ductal carcinoma in situ of the breast (32) by comparative genomic hybridization, thereby supporting the suggestion that the inappropriate regulation of this locus may be a factor in the etiology of breast cancer. Both the RNA expression profile during mammary development and the tissue distribution of p190-B suggest that p190-B may be required for ductal morphogenesis during virgin mammary gland development and that its aberrant expression may occur in aggressive tumors. The hypothesis that p190-B facilitates cell invasion by orchestrating the ECM-mediated integrin signals through Rho proteins, remains to be tested using stably transfected MCF-10A cells, with which it may be possible to study gain-of-function and loss-of-function mutants, and in vivo by generating a mammary gland-specific knockout of this gene.

Materials and Methods

Animals.
Wistar Furth rats with an inbred genetic background were obtained from Harlan Sprague Dawley Inc. All of the animals were maintained and killed according to Institutional Animal Care and Use Committee-approved guidelines.

Tumor Tissues.
Dr. Daniel Medina (Baylor College of Medicine, Houston, TX) provided the NMU-induced rat and mouse TM tumors.

Probes.
A full-length p190-B cDNA construct was a generous gift of Dr. Peter Burbelo [Laboratory of Developmental Biology, National Institute of Dental Research (NIDR), Bethesda, MD 20892]. Dr. Jeffrey Settleman, Laboratory of Signal Transduction (Massachusetts General Hospital Cancer Center, Charlestown, MA) kindly provided the p190-A cDNA.

Antibodies.
Mouse monoclonal antibody (clone 12CA5) for HA epitope tag was purchased from Boehringer Mannheim. FITC- phalloidin (Sigma) was a gift from Dr. Bill Brinkley.

Adenovirus.
Adenovirus stocks were purchased from Dr. Nancy Weigel’s laboratory Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030.

Mammary Gland Tissue Isolation by Dye Visualization.
TEBs and M and S tissue were isolated from the fourth inguinal mammary glands of nulliparous 42–45-day-old rats in the following manner. After making a midline incision, the skin was separated from the peritoneum, and the mammary gland was exposed. To visualize the mammary ductal structure, the top portion of the fourth nipple was removed, and the visualization dye (0.5% trypan blue w/v in PBS) was injected using a 26-G needle. After complete infiltration of the dye throughout the ductal tree, the three fractions were easily identified and surgically isolated (see Fig. 1Citation ). The tissue sections were snap-frozen in liquid nitrogen and transferred to -80°C for storage until used for isolation of RNA.

Isolation and Identification of DD-PCR Clones.
RT-PCR and PCR reactions were performed with the materials provided and the protocols recommended for use of the RNAimage kit (GenHunter Corp, Brooklyn, MA). Total RNA was prepared from each tissue region using 4-M guanidium isothiocyanate and CsCl buoyant-density centrifugation (33) . For each sample, two sets of three RT reactions were prepared as per a previously described procedure (16) . The RT samples were then amplified by low-stringency PCR in the presence of 20 pmol of {alpha}-35S-labeled dATP (1200 Ci/mmol), the T-specific primer used in the RT reaction in combination with various random 11mers supplied with the kit, and 1 unit of Ampli Taq polymerase (Perkin-Elmer Applied Biosystems).

To identify the differentially expressed genes, DD-PCR products from the three starting RNA populations (TEB, M, and S) were run on a 6% denaturing polyacrylamide gel, transferred to 3-mm Whatman paper, dried, and exposed to X-ray film (Eastman Kodak). To confirm the reproducibility of the banding pattern, each representative RT reaction was performed from two independent pools of RNA for each of the three regions (TEB, M, and S regions). Bands that were more intense in the TEB fraction were excised from the gel and reamplified. The PCR reaction was similar to the previous reaction except with 20 µM dNTP and no labeled nucleotide. The PCR products so generated were initially cloned into PCR-TRAP vector and then subcloned into HindIII site of pBluescript II (Stratagene).

Sequencing and Identification of DD-PCR Products.
The subcloned DD-PCR products, termed EDD clones were sequenced using standard dideoxy chain termination methods. Both of the strands were sequenced using T7 and T3 primers. BLAST search combined with repeat masker was used to compare the clone sequences with GenBank entries.

Preparation and Analysis of Total RNA.
The fourth inguinal mammary glands from virgin, pregnant, and lactating rats were dissected under anesthesia using standard surgical procedures. Tissue was snap-frozen in liquid nitrogen and stored at -80oC. Total cellular RNA was prepared using 4 M guanidium isothiocyanate and CsCl buoyant-density centrifugation (33) . RNA was fractionated on a 1.2% formaldehyde agarose gel and transferred to Hybond N+ (Amersham) membrane with 10x SSC. Hybridization was performed in Hybaid oven at 65oC using procedures recommended by Amersham. The filters were quantitated for 16–48 h using the PhosphorImager (Molecular Dynamics). The data were normalized to the 28S rRNA signal.

Screening of High-Density Blots by Reverse Northern.
First strand 32P-cDNA was synthesized from 5–6 µg of total RNA from EB, M, and S fractions of the virgin mammary gland using superscript II RT (Life Technologies, Inc.) in the presence of 1 µg of oligo(dT)12–18mer primers as per manufacturer’s instructions. The cDNA was hydrolyzed by NaOH treatment and neutralized with HCl treatment. The labeled cDNA was then purified through a sephadex G50 column. The efficiency of the reaction was monitored by determining the total radioactivity incorporated before and after purification of the probe.

A total of eight DD-PCR clones and three control plasmids (K18, RPL19, and GAPDH) were subjected to PCR amplification. After amplification, a fixed amount of each of the PCR products was loaded onto high-density gels in triplicate (Centipede gel electrophoresis chambers; Owl Scientific, Woburn, MA). PCR products were alkali-denatured in the gel and blotted onto nylon membranes. The filters were hybridized with equivalent amounts of 32P-labeled single-stranded cDNA (specific activity, 1 x 109 cpm/µg) from TEB, M, and S regions of the virgin mammary gland. The filters were washed under stringent conditions as per the Church and Gilbert method (34) and quantitated using the phosphorimager. In addition, the filters were exposed to high-resolution Kodak Biomax MR films for up to 24 h at -80° C.

In Situ Hybridization.
Riboprobes were labeled with [33P]UTP (2500 Ci/mmol; Amersham), using the appropriate T3 or T7 transcription systems from Stratagene. To generate the riboprobe templates, the cDNA was linearized with a restriction enzyme so as to make an antisense transcript that originates from the more divergent 3' end of the cDNA, thus making it more specific for p190-B. 33P-riboprobes were used because, unlike 35S, 33P gives less background, and very high specific-activity probes can be generated for the detection of rare transcripts. The 33P-riboprobe was purified on a sephadex G50 column and counted in a scintillation counter.

Pretreatment of Slides and Hybridization.
The fourth inguinal mammary glands from virgin Wistar Furth rats were excised and immediately fixed for 3 h in ice-cold 4% paraformaldehyde in PBS, dehydrated in a graded series of ethanols to xylene, and embedded in paraffin wax. Sections of 4–5 µm were mounted on ProbeOn Plus slides (Fisher Biotech). Sections were baked overnight at 37°C, dewaxed through xylene, and rehydrated through a graded series of ethanols to PBS. After digestion with proteinase K (20 µg/ml; Sigma) at 50°C for 5 min, the sections were refixed in 4% paraformaldehyde/PBS for 5 min. The sections were then acetylated in 100 mM triethanolamine and 25 mM acetic anhydride and was dehydrated through ethanols. Sections were prehybridized in 2x SSC, 50% formamide, 10% dextran sulfate, 1% SDS, and 500 ng/ml denatured herring sperm DNA at 37°C in a sealed humidified chamber. 33P-labeled riboprobe (1 x 105 cpm/µl) was diluted into 25 µl of hybridization solution, which was then added to the solution already covering the section. The sections were hybridized overnight at 42°C in a sealed humidified chamber. The sections were subsequently washed in 2x SSC at 55°C with the last wash in 0.1x SSC at 55°C.

Detection of the Radioactive Signal.
The sections were dehydrated in a graded series of ethanol/water containing 0.3 M sodium acetate. The sections were air-dried and coated with NTB2 nuclear emulsion (Eastman Kodak Co, NY) and exposed in light-proof slide boxes for 48–72 h. After development (as per Kodak instructions), the sections were stained with either hematoxylin or DAPI and visualized using dark-field microscopy in combination with bright-field or fluorescence microscopy.

Construction of p190-B Expression Vector.
The expression plasmid was generated from an E3 plasmid4 provided by Dr. Peter Burbelo (Laboratory of Developmental Biology, NIDR), which contains the complete coding sequence of p190-B with flanking 5' and 3' untranslated sequences. A 1.2-kb KpnI-EcoRV fragment from the 5' end was tagged at the NH2 terminus with an HA sequence (nine amino acids; YPYDVPDYA; Ref. 35 ) by PCR using the forward primer: 5'-CCGGTACCATGGGGTACCCATACGACGTCCCAGACTACGCTGCAAAAAACAAAGAGCCTCGTCCCCCATCC (71mer), and the reverse primer: 5'-CTCGTGAAATCTTCGACTTTTTCAGATAGTCTTGGTACATGTCGTAGACTATAGGCTCTTCTCCTC (66mer), with linearized E3 plasmid as the template. PCR was carried out as follows: denaturation at 95°C for 5 min, followed by 25 cycles of denaturation for 30 s at 95°C, annealing at 65°C for 3' extension for 3 min at 72°C, after 10 min extension at 72°C. This fragment was engineered to have a KpnI site at the 5' end and a consensus Kozak sequence before the starting ATG. The generated fragment was cloned into KpnI-EcoRV site of PCR3.1 vector (Invitrogen). This vector was further cut with EcoRV and NotI to accommodate a 3' EcoRV-NotI fragment from the E3 plasmid. A KpnI-NotI fragment from this second-generation construct represents the complete coding region of p190-B and about 180bp of 3' untranslated region.

Cell Culture and Transfection.
Human breast epithelial cells (MCF-10A) were obtained from Barbara Ann Karmanos Cancer Institute (passage 149) and cultured in DMEM:F12 Media (1:1) supplemented with 5% serum, insulin (10 µg/ml), epidermal growth factor (20ng/ml), cholera toxin (100ng/ml), hydrocortisone (0.5 µg/ml), penicillin 100 units/ml, streptomycin (100 µg/ml), and fungizone (0.5 µg/ml). Cells were split 1:3 to 1:4 and passaged every 3–4 days. MCF-10A cells (2 x 105) were seeded onto coverslips 24 h before transient transfection and transfected with either 2 µg of p190-B expression plasmid or the control vector using adenovirus-DNA-lysine cocktail in serum-free media (22) . To normalize for transfection efficiency, 400 ng of cytomegalovirus ß-galactosidase was cotransfected as a tracer. Twelve h after transfection, the cells were switched to complete media for another 24–36 h. The cells were fixed and stained for simultaneous detection of p190-B and the actin cytoskeleton, as described previously (36) . The anti-HA antibody was used at a dilution. of 1:500, whereas FITC-phalloidin was used at a dilution of 1:1000. Goat antimouse IgG (Santa Cruz Biotechnology) conjugated with Texas Red was used as the secondary antibody against HA-antibody. The cells were analyzed by indirect immunofluorescence, and images were collected at 5-µm steps using a DeltaVision deconvolution microscope from Applied Precision, Inc. (Issaquah, WA). Thirty of such 5-µm images were rendered to make a projection using the softWoRx imaging workstation (also from Applied Precision, Inc.).

Acknowledgments

We thank Drs. D. Medina and N. Greenberg for their critical evaluation of the manuscript; Dr. Peter Burbelo, Laboratory of Developmental Biology, NIDR, for providing the p190-B cDNA; and Dr. Jeffrey Settleman (Laboratory of Signal Transduction, Massachusetts General Hospital Cancer Center Charlestown, MA 02129) for providing the p190-A cDNA. We thank Dr. D. Medina (Baylor University, Houston, TX) for also providing the mouse and rat tumor samples. Special thanks to Frank Herbert from the Cell Biology Microscopy Core and Dr. Elena B. Kabotyanski for helping with the deconvolution microscopy.

Footnotes

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the Army Breast Cancer Research Program USAMRDC DAMD 17-94-J4253 and by NIH Grant CA64255. Back

2 To whom requests for reprints should be addressed, at Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030. E-mail: jrosen{at}bcm.tmc.edu Back

3 The abbreviations used are: NMU, nitrosomethylurea; TD, terminal duct; EB, end bud; TEB, terminal EB; ABS, alveolar buds; DD, differential display; EDD, EB DD; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; K18, Keratin-18; RT, reverse transcription; M, midgland (tissue); S, stroma/stromal (tissue); ECM, extracellular matrix; TRAP, telomeric repeat amplification protocol; DAPI, 4',6-diamidino-2-phenylindole; EtBr, ethidium bromide; oligo(dT), oligodeoxythymidylic acid. Back

4 P. Burbelo, unpublished data. Back

Received for publication 6/21/99. Revision received 3/15/00. Accepted for publication 5/22/00.

References

  1. MacMahon B., Cole P., Lin T. M., Lowe C. R., Mirra A. P., Ravnihar B., Salber E. J., Valaoras V. G., Yuasa S. Age at first birth and breast cancer risk. Bull. WHO, 43: 209-221, 1970.[Medline]
  2. Sinha D. K., Pazik J. E., Dao T. L. Prevention of mammary carcinogenesis in rats by pregnancy: effect of full-term and interrupted pregnancy. Br. J. Cancer, 57: 390-394, 1988.[Medline]
  3. Yang J., Yoshizawa K., Nandi S., Tsubura A. Protective effects of pregnancy and lactation against N-methyl-N- nitrosourea-induced mammary carcinomas in female Lewis rats. Carcinogenesis (Lond.), 20: 623-628, 1999.[Abstract/Free Full Text]
  4. Thordarson G., Jin E., Guzman R. C., Swanson S. M., Nandi S., Talamantes F. Refractoriness to mammary tumorigenesis in parous rats: is it caused by persistent changes in the hormonal environment or permanent biochemical alterations in the mammary epithelia?. Carcinogenesis (Lond.), 16: 2847-2853, 1995.[Abstract/Free Full Text]
  5. Grubbs C. J., Farnell D. R., Hill D. L., McDonough K. C. Chemoprevention of N-nitroso-N-methylurea-induced mammary cancers by pretreatment with 17ß-estradiol and progesterone. J. Natl. Cancer Inst, 74: 927-931, 1985.
  6. Medina D., Smith G. Chemical carcinogen-induced tumorigenesis in parous, involuted mouse mammary glands. J. Natl. Cancer Inst, 91: 967-969, 1999.[Free Full Text]
  7. Russo J., Russo I. H. Biological and molecular bases of mammary carcinogenesis. Lab. Investig, 57: 112-137, 1987.[Medline]
  8. Topper Y. J., Freeman C. S. Multiple hormone interactions in the developmental biology of the mammary gland. Physiol. Rev, 60: 1049-1106, 1980.[Free Full Text]
  9. Sivaraman L., Stephens L. C., Markaverich B. M., Clark S., Krnacik J. A., Conneely O. M., O’Malley B. W., Medina D. Hormone-induced refractoriness to mammary carcinogenesis in Wistar- Furth rats. Carcinogenesis (Lond.), 19: 1573-1581, 1998.[Abstract/Free Full Text]
  10. Guzman R. C., Yang J., Rajkumar L., Thordarson G., Chen X., Nandi S. Hormonal prevention of breast cancer: mimicking the protective effect of pregnancy. Proc. Natl. Acad. Sci. USA, 96: 2520-2525, 1999.[Abstract/Free Full Text]
  11. Humphreys R. C., Lydon J., O’Malley B. W., Rosen J. M. Mammary gland development is mediated by both stromal and epithelial progesterone receptors. Mol. Endocrinol, 11: 801-811, 1997.[Abstract/Free Full Text]
  12. von Stein O. D., Thies W. G., Hofmann M. A high throughput screening for rarely transcribed differentially expressed genes. Nucleic Acids Res, 25: 2598-2602, 1997.[Abstract/Free Full Text]
  13. Schena M. Genome analysis with gene expression microarrays. BioEssays, 18: 427-431, 1996.[Medline]
  14. Lisitsyn N., Wigler M. Cloning the differences between two complex genomes. Science (Washington DC), 259: 946-951, 1993.[Abstract]
  15. Carulli J. P., Artinger M., Swain P. M., Root C. D., Chee L., Tulig C., Guerin J., Osborne M., Stein G., Lian J., Lomedico P. T. High throughput analysis of differential gene expression. J. Cell. Biochem. Suppl, 30–31: 286-296, 1998.
  16. Liang P., Pardee A. B. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science (Washington DC), 257: 967-971, 1992.[Abstract/Free Full Text]
  17. Altschul S. F., Madden T. L., Schaffer A. A., Zhang J., Zhang Z., Miller W., Lipman D. J. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res, 25: 3389-3402, 1997.[Abstract/Free Full Text]
  18. Burbelo P. D., Miyamoto S., Utani V., Brill S., Yamada K. M., Hall A., Yamada Y. p190-B, a new member of the Rho GAP family, and Rho are induced to cluster after integrin cross-linking. J. Biol. Chem, 270: 30919-30926, 1995.[Abstract/Free Full Text]
  19. Keely P., Parise L., Juliano R. Integrins and GTPases in tumour cell growth, motility and invasion. Trends Cell Biol, 8: 101-106, 1998.[Medline]
  20. Medina D., Kittrell F. S., Liu Y. J., Schwartz M. Morphological and functional properties of TM preneoplastic mammary outgrowths. Cancer Res, 53: 663-667, 1993.[Abstract/Free Full Text]
  21. Settleman J., Narasimhan V., Foster L. C., Weinberg R. A. Molecular cloning of cDNAs encoding the GAP-associated protein p190: implications for a signaling pathway from ras to the nucleus. Cell, 69: 539-549, 1992.[Medline]
  22. Allgood V. E., Zhang Y., O’Malley B. W., Weigel N. L. Analysis of chicken progesterone receptor function and phosphorylation using an adenovirus-mediated procedure for high-efficiency DNA transfer. Biochemistry, 36: 224-232, 1997.[Medline]
  23. Soule H. D., Maloney T. M., Wolman S. R., Peterson W. D., Jr., Brenz R., McGrath C. M., Russo J., Pauley R. J., Jones R. F., Brooks S. C. Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res, 50: 6075-6086, 1990.[Abstract/Free Full Text]
  24. Russo J., Russo I. H. Experimentally induced mammary tumors in rats. Breast Cancer Res. Treat, 39: 7-20, 1996.[Medline]
  25. Russo J., Tay L. K., Russo I. H. Differentiation of the mammary gland and susceptibility to carcinogenesis. Breast Cancer Res. Treat, 2: 5-73, 1982.[Medline]
  26. Scheffzek K., Ahmadian M. R., Wittinghofer A. GTPase-activating proteins: helping hands to complement an active site. Trends Biochem. Sci, 23: 257-262, 1998.[Medline]
  27. Nakahara H., Mueller S. C., Nomizu M., Yamada Y., Yeh Y., Chen W. T. Activation of beta1 integrin signaling stimulates tyrosine phosphorylation of p190RhoGAP and membrane-protrusive activities at invadopodia. J. Biol. Chem, 273: 9-12, 1998.[Abstract/Free Full Text]
  28. Zohn I. M., Campbell S. L., Khosravi-Far R., Rossman K. L., Der C. J. Rho family proteins and Ras transformation: the RHOad less traveled gets congested. Oncogene, 17: 1415-1438, 1998.[Medline]
  29. de Cremoux P., Gauville C., Closson V., Linares G., Calvo F., Tavitian A., Olofsson B. EGF modulation of the ras-related rhoB gene expression in human breast- cancer cell lines. Int. J. Cancer, 59: 408-415, 1994.[Medline]
  30. Burbelo P. D., Finegold A. A., Kozak C. A., Yamada Y., Takami H. Cloning, genomic organization and chromosomal assignment of the mouse p190-B gene. Biochim. Biophys. Acta, 1443: 203-210, 1998.[Medline]
  31. Courjal F., Theillet C. Comparative genomic hybridization analysis of breast tumors with predetermined profiles of DNA amplification. Cancer Res, 57: 4368-4377, 1997.[Abstract/Free Full Text]
  32. James L. A., Mitchell E. L., Menasce L., Varley J. M. Comparative genomic hybridisation of ductal carcinoma in situ of the breast: identification of regions of DNA amplification and deletion in common with invasive breast carcinoma. Oncogene, 14: 1059-1065, 1997.[Medline]
  33. Chirgwin J. M., Przybyla A. E., MacDonald R. J., Rutter W. J. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry, 18: 5294-5299, 1979.[Medline]
  34. Church G. M., Gilbert W. Genomic sequencing. Proc. Natl. Acad. Sci. USA, 81: 1991-1995, 1984.[Abstract/Free Full Text]
  35. Wilson I. A., Niman H. L., Houghten R. A., Cherenson A. R., Connolly M. L., Lerner R. A. The structure of an antigenic determinant in a protein. Cell, 37: 767-778, 1984.[Medline]
  36. Kazansky A. V., Kabotyanski E. B., Wyszomierski S. L., Mancini M. A., Rosen J. M. Differential effects of prolactin and src/abl kinases on the nuclear translocation of STAT5B and STAT5A. J. Biol. Chem, 274: 22484-22492, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
D. Vaught, J. Chen, and D. M. Brantley-Sieders
Regulation of Mammary Gland Branching Morphogenesis by EphA2 Receptor Tyrosine Kinase
Mol. Biol. Cell, May 15, 2009; 20(10): 2572 - 2581.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C.-H. Shen, H.-Y. Chen, M.-S. Lin, F.-Y. Li, C.-C. Chang, M.-L. Kuo, J. Settleman, and R.-H. Chen
Breast Tumor Kinase Phosphorylates p190RhoGAP to Regulate Rho and Ras and Promote Breast Carcinoma Growth, Migration, and Invasion
Cancer Res., October 1, 2008; 68(19): 7779 - 7787.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Vargo-Gogola, B. M. Heckman, E. J. Gunther, L. A. Chodosh, and J. M. Rosen
P190-B Rho GTPase-Activating Protein Overexpression Disrupts Ductal Morphogenesis and Induces Hyperplastic Lesions in the Developing Mammary Gland
Mol. Endocrinol., June 1, 2006; 20(6): 1391 - 1405.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
C. N. Hahn, Z. J. Su, C. J. Drogemuller, A. Tsykin, S. R. Waterman, P. J. Brautigan, S. Yu, G. Kremmidiotis, A. Gardner, P. J. Solomon, et al.
Expression profiling reveals functionally important genes and coordinately regulated signaling pathway genes during in vitro angiogenesis
Physiol Genomics, June 16, 2005; 22(1): 57 - 69.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Parsons, J. Monypenny, S. M. Ameer-Beg, T. H. Millard, L. M. Machesky, M. Peter, M. D. Keppler, G. Schiavo, R. Watson, J. Chernoff, et al.
Spatially Distinct Binding of Cdc42 to PAK1 and N-WASP in Breast Carcinoma Cells
Mol. Cell. Biol., March 1, 2005; 25(5): 1680 - 1695.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. Ruan, M. E. Monaco, and D. L. Kleinberg
Progesterone Stimulates Mammary Gland Ductal Morphogenesis by Synergizing with and Enhancing Insulin-Like Growth Factor-I Action
Endocrinology, March 1, 2005; 146(3): 1170 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. I. Kontaridis, S. Eminaga, M. Fornaro, C. I. Zito, R. Sordella, J. Settleman, and A. M. Bennett
SHP-2 Positively Regulates Myogenesis by Coupling to the Rho GTPase Signaling Pathway
Mol. Cell. Biol., June 15, 2004; 24(12): 5340 - 5352.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. A. Wozniak, R. Desai, P. A. Solski, C. J. Der, and P. J. Keely
ROCK-generated contractility regulates breast epithelial cell differentiation in response to the physical properties of a three-dimensional collagen matrix
J. Cell Biol., November 10, 2003; 163(3): 583 - 595.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chakravarty, G.
Right arrow Articles by Rosen, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chakravarty, G.
Right arrow Articles by Rosen, J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation