CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by García, I.
Right arrow Articles by Zubiaga, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García, I.
Right arrow Articles by Zubiaga, A. M.
Cell Growth & Differentiation Vol. 11, 91-98, February 2000
© 2000 American Association for Cancer Research


Articles

A Role for E2F1 in the Induction of Apoptosis during Thymic Negative Selection1

Itxaso García, Matilde Murga, Alberto Vicario, Seth J. Field2 and Ana M. Zubiaga3

Department of Animal Biology and Genetics, Faculty of Sciences, University of the Basque Country, E-48080, Spain [I. G., M. M., A. V., A. M. Z.], and Children’s Hospital, Department of Neuroscience, Harvard Medical School, Boston, Massachusetts 02115 [S. J. F.]

Abstract

Thymic negative selection is the process in which maturing thymocytes that express T-cell receptors recognizing self are eliminated by apoptotic cell death. The molecular mechanism by which this occurs is poorly understood. Notably, genes involved in cell death, even thymocyte death, such as Fas, Fas-ligand, p53, caspase-1, caspase-3, and caspase-9, and Bcl-2 have been found to not be required for normal thymic negative selection. We have demonstrated previously that E2F1-deficient mice have a defect in thymocyte apoptosis. Here we show that E2F1 is required for normal thymic negative selection. Furthermore, we observed an E2F1-dependent increase of p53 protein levels during the process of thymic clonal deletion, which suggests that E2F1 regulates activation-induced apoptosis of self-reactive thymocytes by a p53-dependent mechanism. In contrast, other apoptotic pathways operating on developing thymocytes, such as glucocorticoid-induced cell death, are not mediated by E2F1. The T lymphocytes that escape thymic negative selection migrate to the peripheral immune system but do not appear to be autoreactive, indicating that there may exist E2F1-independent mechanisms of peripheral tolerance, which protect mice from developing an autoimmune response. We expect that E2F1-deficient mice will provide a useful tool for understanding the molecular mechanism of and the immunological importance of thymic negative selection.

Introduction

At its discovery 20 years ago, the process of thymic negative selection was hailed as a major leap in our understanding of the mechanism underlying the immune system’s exquisite ability to distinguish self from non-self (1, 2, 3) . Since that time, relatively little progress has been made in understanding the molecular mechanism underlying this process. Thymic negative selection, the mechanism by which thymocytes bearing self-reactive antigen receptors undergo apoptosis in response to a death signal from neighboring cells, requires TCR4 -mediated recognition of antigenic peptides associated with major histocompatibility complex class I or II molecules on the surface of antigen-presenting cells and involves thymocytes at the immature CD4/CD8 DP developmental stage or early in the mature single positive stage (1, 2, 3) . Major advances in our knowledge of thymic selection have resulted from the utilization of transgenic mouse models in which TCRs of known specificity are used. Examples of this approach include the introduction of genes encoding a TCR recognizing the male H-Y antigen in the context of H-2Db. Thymocytes from these transgenic mice are deleted at or before the CD4/CD8 DP developmental stage when the male H-Y antigen is present (4 , 5) .

Although the process of negative selection is understood to involve the initiation of apoptotic cell death in thymocytes that express TCRs that recognize self, the details are unclear. Notably, in vivo mutational analysis of a number of proteins that originally were expected to be important for thymic cell death, including p53, Fas, Fas-ligand, caspase-1, caspase-3, caspase-9, Bcl-2, and others, has shown that none of these are required for normal thymic negative selection. Indeed, to date only a null mutation of the CD30 gene has been found to impair negative selection (6) . Mutation of CD30, a surface antigen found on Reed-Sternberg cells of Hodgkin’s disease and on a variety of non-Hodgkin’s lymphoma cells, results in a 5-fold increase in the survival of cells expressing particular TCRs that recognize self-antigens, demonstrating a requirement for CD30 in normal thymic negative selection. The identification of additional examples of genes required for thymic negative selection is crucial for two purposes: (a) these genes will help delineate the molecular mechanism by which apoptosis is triggered and executed in thymic negative selection; and (b) these mutant mice will provide model systems to investigate the role for thymic negative selection in shaping the immune repertoire.

The E2F transcription factor, although initially described as a factor involved in promoting cell cycle progression, has more recently been found to play an important role in apoptosis (7, 8, 9, 10) . The E2F gene family is comprised of six members that show different affinities for pRB family members. E2F1, E2F2, and E2F3 bind with high affinity to pRB, whereas E2F4 and E2F5 bind with high affinity to the pRB-related proteins p107 and p130. A newly identified E2F species, referred to as EMA or E2F6, lacks the Rb-interaction domain and does not physically associate with members of the RB family (8) . A variety of genes encoding proteins important for cell proliferation are activated by E2F, and the expression of these genes may be a result of transcriptional activation, as well as derepression (8, 9, 10) . The target genes include those important for DNA replication (e.g., Pol {alpha}, Orcl, Mcm, and TS), control of cell cycle (cyclin A and cyclin E), proto-oncogenes (myc and myb), and the RB family (Rb and 107). These studies also show that the individual E2F proteins display distinct specificities in the activation of the target genes (11) . Coincident with the differential abilities to activate a large array of endogenous genes that encode proteins important for DNA replication and cell cycle, the E2F family members possess distinct activities and functions in cell growth. For example, ectopic overexpression of various E2Fs (including E2F1, E2F2, and E2F3) in tissue culture cells can drive quiescent cells to enter the S phase of cell cycle, whereas E2F4 and E2F5 show little activity in S-phase induction (11, 12, 13, 14, 15) . Moreover, E2F1 or E2F4 can function as oncogenes in standard fibroblast cotransformation assays with activated ras (16) or participate in the immortalization of primary human keratinocytes (17) .

Interestingly, overexpression of E2F1, but not other E2Fs, has the additional property of inducing apoptosis in fibroblast cells grown in low serum (11) . Furthermore, it has been shown that inhibition of E2F activity by dominant negative mutants can prevent apoptosis in cultured breast epithelial cells and promote tumor growth in SCID mice (18) . More direct evidence of a role for E2F1 in apoptosis is provided by experiments with E2F1-deficient mice. Mice mutant for E2F1 display a defect in apoptosis of CD4/CD8 DP thymocytes, leading to an excess of mature T cells (19) . These mice are also predisposed to tumor formation (19 , 20) , a finding that might reflect a role for E2F1 in limiting hyperplasia and tumorigenesis in specific tissues, and thus, E2F1 would function as a tumor suppressor.

Several reports have shown that E2F1 can induce p53-independent apoptosis (21 , 22) , although in most cases E2F1 appears to induce apoptosis by a p53-mediated mechanism (23 , 24) . In addition, overexpression of E2F1, but not E2F2, leads to increased levels of p53, and coexpression of the MDM2 protein blocks both E2F1-mediated apoptosis as well as E2F1-mediated accumulation of p53 (15) . The mechanism by which E2F1 regulates p53 is unknown, although it could be mediated by p19ARF, a protein that stabilizes p53 and activates p53-dependent transcription (25 , 26) . p19ARF can be induced by E2F1 (11) , and its expression is slightly elevated in Rb-/- cells (27) , providing a connection between E2F1 and p53. However, p19ARF induction may not be sufficient for apoptosis, and additional E2F1 targets may be necessary for this process (8) .

Recent work indicates that the presence of E2F1 is required for the defects caused by the loss of RB function in many cell types in the developing embryo and suggests that dysregulation of E2F1 function is responsible for these defects (28 , 29) . The fact that E2F1 mutation rescued apoptosis occurring in the developing lens and central nervous system, which are dependent on p53, but not in the peripheral nervous system, which is p53 independent, also points toward a requirement for the induction of the p53 pathway for the function of E2F1 in apoptosis (29) . Loss of E2F1 function also leads to a complete suppression of apoptosis induced by inactivation of Rb in the choroid plexus of mice expressing the Tag121 transgene, just as in loss of p53 function. It is important to note that the choroid plexus, lens, and central nervous system are normal in E2F1-deficient mice, and it is only after disruption of the pRB/E2F regulatory network by SV40-T or Rb loss that this role in apoptosis is unmasked (30) .

We have demonstrated previously that mutation of E2F1 in mice results in a defect in thymocyte apoptosis (19) . Here we introduced the E2F1 mutation into mice expressing a transgene for an H-Y-specific T-cell receptor, a system allowing the assessment of thymic negative selection (6) . Our results show that apoptosis during negative selection of immature DP thymocytes is impaired in E2F1-deficient mice. We also found that expression of p53 correlates with the extent of negative selection. We conclude that E2F1 plays a crucial role in normal thymic negative selection by a mechanism that appears to involve p53.

Results

Defective TCR-mediated, but not Glucocorticoid-mediated, Apoptosis in E2F1-/- Thymocytes.
We have shown previously that in vitro cultured E2F1-/- thymocytes demonstrate increased viability relative to their wild-type control cells. Specifically, CD4/CD8 DP thymocytes display an enhanced level of survival in culture (spontaneous cell death), suggesting that E2F1 plays some role in the regulation of apoptosis in this immature population (19) . To examine the effect of E2F1 mutation on apoptosis caused by inducers of cell death that specifically target immature thymocytes, we evaluated the in vitro responses to dexamethasone treatment, a glucocorticoid known to cause rapid apoptotic death of cortical DP thymocytes (31 , 32) . After 18 h of treatment with this agent, there was extensive cell death in culture, but we found no differences in viability between thymocytes from mutant and control mice (Fig. 1)Citation . We further investigated thymocyte responses to cross-linking with anti-CD3 antibody, which is known to activate mature T cells but kill immature DP thymocytes in vitro and in vivo (33) . By 24 h after in vitro anti-CD3 cross-linking, there were ~30% more live E2F1-mutant thymocytes as compared with controls (Fig. 1)Citation , consistent with the data obtained by in vivo anti-CD3 treatment (19) . These results suggest that E2F1 may be selectively involved in the apoptosis triggered through the TCR in immature thymocytes.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Defect in apoptosis induced in vitro by anti-CD3 of E2F1-deficient thymocytes. Thymocytes (1.5 x 106 cells/ml) harvested from adult E2F1+/+ (n = 3) and E2F1-/- (n = 3) mice were cultured in 96-well plates for 18 or 24 h in complete DMEM in the absence or presence of dexamethasone (1 µM; Dex) or immobilized anti-CD3 antibody (2 µg/ml). Cell viability was assayed by trypan blue exclusion. No significant differences in viability were observed when comparing untreated E2F1+/+ and E2F1-/- thymocytes (data not shown). The values depict the percentage of alive cells in treated cultures compared with that of untreated cultures for each time point. The data shown represent the means for measurements of viability of thymocytes obtained from three independent experiments; bars, SE.

 
Negative Selection in TCR-Transgenic E2F1-/- Mice Is Defective.
Treatment of thymocytes with anti-CD3 is thought to mimic activation-induced cell death similar to that observed with thymic deletion. Thus, the observation that thymocytes from E2F1-deficient mice are not susceptible to anti-CD3-mediated death pointed toward a possible defect in negative selection. Negative selection, the mechanism by which thymocytes that recognize self-antigen are eliminated, results from apoptotic loss of self-antigen-recognizing thymocytes stimulated through the TCR (2 , 3) .

Ordinarily, negative selection is difficult to observe because only a small fraction of thymocytes undergo negative selection to any particular antigen (34) . To increase the fraction of thymocytes undergoing negative selection, we crossed the E2F1-/- mice with a TCR-transgenic mouse line specific for the male (H-Y) antigen, maintaining the H-2b background. The transgenic receptor is composed of the V{alpha}3 and Vß8.2 members of the {alpha} and ß chain variable region gene families, and this TCR is expressed in virtually all T cells in transgenic mice (4) . Thymocytes expressing the H-Y-specific transgenic TCRs are positively selected in female H-2b mice, negatively selected in male H-2b mice, and nonselected in H-2d mice (5) .

When we analyzed the positive-selecting transgenic female mice, we found that thymocyte phenotypes were similar in E2F1-/- as well as E2F1+/+ mice (data not shown). Next, we analyzed negative-selecting transgenic male mice, and similar to what has been reported previously (4) , we found that the negative-selecting male mice show a massive reduction in cell number in the thymus because of the deletion of H-Y-specific DP thymocytes by apoptosis. Results obtained from E2F1+/+ or E2F1+/- mice were similar for all of the experiments described in this article. In contrast, in negative-selecting male mice carrying an E2F1 mutation, the reduction in thymocyte number was inhibited, and there was a 50–70% higher cell survival rate in E2F1-deficient mice (Fig. 2a)Citation . The proportion of DP cells was also less affected in the mutant mice, which contained approximately a 3–4-fold increase in DP cells compared with wild-type controls (Fig. 2b)Citation . Similarly, the percentage of thymocytes that presumably escape from negative selection, expressing the transgenic Vß8 chain and the accessory molecule CD8, was 3–4-fold higher in E2F1-deficient mice (29% versus 7%). Thus, these data indicate that H-Y transgenic E2F1-/- mice have a partial, but clearly significant, defect in negative selection in the thymus.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2. Clonal deletion of H-Y TCR-transgenic thymocytes is defective in E2F1-/- mice. A, thymocytes were harvested from the thymuses of H-Y transgenic E2F1+/+ (n = 14) and E2F1-/- (n = 13) male mice. The number of thymocytes per thymus was counted and is shown on the graph. Bars, SE. B, thymocytes from E2F1+/+ control male mice and E2F1+/+ and E2F1-/- H-Y TCR-transgenic male mice were double stained with anti-CD8-FITC and anti-CD4-PE or anti-Vß8-FITC and anti-CD8-PE MAbs and analyzed by flow cytometry. In the graphs shown, each dot represents CD4, CD8, or Vß8 expression levels for a single cell. The cell populations are divided in four quadrants. The numbers in each quadrant represent the percentage of cells in that quadrant. The experiment shown is representative of five experiments comparing in total seven wild-type and seven E2F1-/- male mice. C, thymocytes from E2F1+/+ control mice and E2F1+/+ and E2F1-/- H-Y transgenic male mice were harvested and fixed. Apoptosis was assayed using a fluoresceinated in situ DNA end-labeling method (TUNEL) as described in "Materials and Methods." Samples were analyzed using a Coulter XL cytometer. Results are representative of the data obtained in two independent experiments.

 
The thymic defect observed in transgenic E2F1-/- male mice suggests that E2F1 regulates negative selection by inducing apoptosis of self-reactive thymocytes. To test this possibility, we performed a fluorescent in situ cell death assay (TUNEL) on thymocytes from TCR-transgenic E2F1+/+ and E2F1-/- male mice and analyzed apoptosis by flow cytometry, as measured by the fraction of cells labeled by FITC-conjugated dUTP. The percentage of thymocytes undergoing apoptosis is detectable in transgenic E2F1+/+ male mice relative to nontransgenic mice. However, this percentage is significantly reduced in H-Y transgenic E2F1-deficient thymocytes (Fig. 2c)Citation , suggesting that E2F1 plays a role in apoptosis during activation-induced cell death of immature thymocytes.

Increased Levels of Undeleted Mature T Lymphocytes in Transgenic E2F1-/- Male Mice.
The lymph nodes of H-Y transgenic E2F1-mutant mice were also enlarged relative to the E2F1 wild-type controls. Adult E2F1-/- mice, 6–8 week of age, had ~80% more lymphocytes than age-matched E2F1+/+ controls (Fig. 3a)Citation . We then analyzed the phenotype of these cells by flow cytometry and found that >95% of the T lymphocytes expressed transgenic Vß8 chain (data not shown). To recognize H-Y antigen, T cells need to express both the TCR transgenes and the TCR-associated molecule CD8. We analyzed expression of transgenic Vß8 and the accessory molecule CD8 in peripheral T cells from male (H-Y-expressing) wild-type and E2F1-deficient mice. We found a 2–3-fold increase in potentially functional H-Y-specific peripheral lymphocytes (i.e., expressing Vß8 and CD8) in E2F1-/- mice compared with wild-type controls (Fig. 3b)Citation . These results provide further evidence that self-reactive transgene-expressing thymocytes escape negative selection in the thymus.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. Enlarged lymph nodes contain higher levels of undeleted T lymphocytes that are not functionally autoreactive. A, cells from 12 lymph nodes were harvested from each of six E2F1+/+ and six E2F1-/- 6–8-week-old TCR-transgenic male mice from corresponding anatomical locations and counted, and the average number of cells per mouse was calculated; bars, SE. B, lymph node cells from E2F1+/+ control male mice and E2F1+/+ and E2F1-/- H-Y TCR-transgenic male mice were double stained with anti-Vß8-FITC and anti-CD8-PE MAbs and analyzed by flow cytometry. The numbers in each quadrant represent the percentage of cells in that quadrant. The experiment shown is representative of five experiments comparing in total seven wild-type and seven E2F1-/- TCR-transgenic male mice. C, lymph node cells from E2F1+/+ control male mice and E2F1+/+ and E2F1-/- H-Y TCR-transgenic male mice were plated in 96-well flat-bottomed plates at 1.5 x 106 cells/ml and cultured in the absence or presence of ConA (1 µg/ml) or SEB (10 µg/ml). After 3 days, cells were pulsed with 1 µCi of [3H]thymidine/well for 16 h. The data presented are from triplicate cultures (±SEM) and show one representative example of two independent experiments; bars, SE.

 
To test whether lymph node cells were functionally reactive to mitogenic stimulation, we induced them with the lectin ConA (which activates all T cells) or SEB superantigen (which activates T cells expressing Vß3, Vß7, Vß8, and Vß17; Ref. 35 ) and analyzed their proliferative ability, as measured by [3H]thymidine uptake. E2F1+/+ and E2F1-/- TCR-transgenic lymphocytes responded to ConA stimulation equally well and to the same level as the nontransgenic lymphocytes (Fig. 3c)Citation , indicating that the proliferative capacity of these cells remains intact. On the other hand, when we analyzed the T-cell response to SEB, we found differences between the transgenic and nontransgenic lymphocytes. The response to SEB of transgenic E2F1+/+ T lymphocytes was greatly inhibited, because virtually all transgenic T cells carry an SEB-reactive TCR, in contrast to only 20–30% in nontransgenic T cells. This is consistent with the idea that transgenic Vß8-bearing T cells are anergic to their specific antigen and thus are not autoreactive (4) . When we compared the response to SEB in E2F1+/+ and E2F1-/- cells, no differences were found in the response to SEB between T lymphocytes carrying a mutation in the E2F1 locus and their wild-type controls (Fig. 3c)Citation , suggesting that TCR-transgenic E2F1-/- T cells are not functionally autoreactive, as far as can be determined by this experimental approach.

Induction of Negative Selection by Superantigen SEB Is Impaired in TCR-Transgenic E2F1-/- Female Mice.
To further examine Vß8 TCR transgenic E2F1-deficient thymocytes for altered sensitivity to negative selection, we analyzed clonal deletion in female transgenic mice by using superantigen SEB. This antigen has been shown to bind to thymocytes expressing Vß8, leading to a deletion of thymocytes in the DP compartment when high to moderate doses of SEB are injected (35) . The intraperitoneal injection of SEB (1.5 µg/gram body weight) led, by 24 h of treatment, to a 75% reduction in the total number of E2F1+/- transgenic thymocytes compared with the total number of thymocytes in PBS-injected transgenic females. On the other hand, we only observed a 25% reduction in the number of E2F1-/- transgenic thymocytes after SEB injection (Fig. 4)Citation . Similar differences were found in the DP compartment. The percentage of CD4/CD8 DP thymocytes was reduced from 60% in PBS-treated animals to 40% in SEB-treated E2F1+/- transgenic mice. In contrast, no reduction in the percentage of DP thymocytes was observed in E2F1-/- transgenic mice (Fig. 4)Citation . These results suggest that E2F1 regulates the negative selection that follows in vivo treatment with SEB by inducing clonal deletion of Vß8-bearing CD4/CD8 transgenic thymocytes.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4. E2F1 mutation impairs SEB-mediated deletion in thymocytes. Six-week-old E2F1+/- or E2F1-/- TCR-transgenic female mice received i.p. injections of PBS or SEB (1.5 µg/gram body weight). After 24 h, thymocytes were harvested and counted. Cells (2 x 105) were stained with anti-CD8-FITC and anti-CD4-PE MAbs and analyzed by flow cytometry. The data shown represent the means of the total number of thymocytes as well as DP thymocytes counted after each treatment and were obtained from two independent experiments; bars, SE.

 
Reduced Levels of p53 Expression in SEB-treated E2F1-/- Transgenic Thymocytes.
A number of reports have shown that E2F1 mediates apoptosis by p53-dependent as well as independent mechanisms (29) . To begin to understand the mechanism by which E2F1 regulates apoptosis during thymic negative selection, we first analyzed p53 expression in transgenic thymocytes harvested from female wild-type mice that had been subjected to SEB treatment for various time periods. A Western analysis of the samples indicated that there was an increase in the expression of p53 levels in thymocytes 24 h after SEB injection, detectable above the background levels observed in thymocytes injected with PBS alone (Fig. 5a)Citation . This increase was detectable by 12 h after SEB treatment (data not shown). The higher levels of p53 expression decreased by the second day of the treatment (Fig. 5a)Citation .



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 5. E2F1 is required for the induction of p53 levels in thymocytes after SEB stimulation. A, six-week-old E2F1+/+ H-Y TCR-transgenic female mice received i.p. injections of PBS or SEB (1.5 µg/gram body weight). Thymuses were harvested at different time points and lysed as described in "Materials and Methods." Protein extracts were separated in SDS-PAGE, blotted to polyvinylidene difluoride membranes, and probed sequentially with anti-p53 and anti-actin antibodies, the last as an internal protein loading control. Protein bands were detected using the ECL system. B, six-week-old E2F1+/- or E2F1-/- TCR-transgenic female mice received i.p. injections of SEB (1.5 µg/gram body weight). After 12 or 24 h, thymocytes were harvested, and cell extracts were prepared and analyzed as in A.

 
By using this experimental approach, we next examined the levels of p53 expression in E2F1-deficient thymocytes after treating mice with SEB for 12 or 24 h. We found that the level of p53 expression was significantly reduced in E2F1-/- thymocytes compared with E2F1+/- controls at both time-points analyzed (Fig. 5b)Citation . The reduction in p53 accumulation correlates with the defect in negative selection observed in SEB-treated E2F1-mutant mice and suggests that E2F1 mediates apoptosis during thymic negative selection by a p53-dependent mechanism.

Discussion

Our results show a requirement for E2F1 during the process of negative selection in the development of T cells. Specifically, E2F1 appears to be required for normal induction of apoptosis in thymocytes bearing TCRs that recognize self-antigens. One of the difficulties of analyzing negative selection comes from the fact that very few apoptotic cells can be detected in the thymus at a given time (34) . When TCR-transgenic mice are used, virtually all thymocytes express the transgenic TCR. As a result, if the antigen recognized by this receptor is present, massive cell death occurs, primarily at the CD4/CD8 DP stage of thymic maturation, which makes negative selection more easily detectable. Considering that there are no single experimental approaches to analyze thymic negative selection in all of its complexity (36 , 37) , we set out to study the role of E2F1 in two negative selection models involving the use of TCR-transgenic animals. In one case, the self-antigen (H-Y) is constantly present in male mice (4 , 5) . This allows us to analyze not only the role of E2F1 during thymic negative selection but also the effect that the lack of E2F1 may have on the peripheral selection of T lymphocytes. A 3–4-fold higher number of CD8+/Vß8+ cells can be seen both in the thymus and the lymph nodes of E2F1-/- mice compared with wild-type controls, suggesting that the lack of E2F1 protects a proportion of H-Y-specific immature thymocytes from TCR-mediated apoptosis, which would then migrate to the periphery and accumulate there.

The transgenic system used in our study allows us to analyze the role of E2F1 in negative selection using a second type of experimental approach. It consists of analyzing in vivo thymic selection induced by superantigen SEB into H-Y TCR-transgenic female mice, where clonal deletion attributable to the presence of the male H-Y antigen is not occurring (5) . Similarly to what we found in transgenic males, negative selection in E2F1-deficient female mice was also impaired after SEB administration. These results further support the idea that E2F1 regulates thymic negative selection and suggest that E2F1 not only functions to eliminate preneoplastic cells that may have accumulated mutations in genes, such as in Rb, but also to eliminate autoimmune T cells.

On the basis of our in vitro proliferation data, E2F1-deficient transgenic lymph node T cells from male mice appear to be anergic to the same extent as T cells from E2F1 wild-type controls. This is based on the finding that they respond minimally to SEB (a specific antigen), whereas they proliferate normally after ConA treatment. These results suggest that the transgenic T cells have fallen into an anergic state in the mutant mice, and that some homeostatic process may exist, which is independent of E2F1, to prevent these cells from initiating an autoimmune response. A similar conclusion was reached after the H-Y TCR-transgenic system was used to determine the function of the surface glycoprotein CD30, a member of the tumor necrosis factor receptor family. It was found that CD30 is involved in mediating death signals during negative selection, but that mature cells were not autoreactive (6) . Our examination of TCR-transgenic E2F1-/- mice has not revealed any signs of autoimmune disease to date. Nevertheless, we cannot presently rule out the possibility that the CD8+/Vß8+ cells show some "benign" autoreactivity that could only be revealed in vivo and could develop into a more aggressive form in certain conditions where, for instance, lymphokines up-regulate the level of antigen or up-regulate the effector function of these autoreactive T cells (38 , 39) . Adoptive transfer-type experiments may reveal whether a higher expansion potential of this cell population can be detected in E2F1-mutant compared to wild-type animals.

A variety of conditions induce thymic apoptosis, although the mechanisms by which these conditions induce cell death appear to be different. For example, bcl-2-transgenic thymocytes and caspase-9-deficient thymocytes display resistance to dexamethasone- and {gamma}-irradiation-mediated death but are sensitive to anti-CD95 antibody (40, 41, 42) , whereas p35-transgenic thymocytes are resistant to several apoptosis-inducing agents but sensitive to spontaneous cell death in vitro (43) . It is well established that either TCR engagement or dexamethasone treatment causes specific cell death of immature cortical thymocytes at the DP stage (31 , 40) , but their apoptosis pathways appear to be different, based on our in vivo and in vitro results showing that E2F1 is involved in apoptosis mediated through TCR engagement but not in glucocorticoid-induced apoptosis. On the one hand, it is known that dexamethasone-mediated apoptosis is p53 independent (44 , 45) . On the other hand, our results on SEB-mediated apoptosis correlate p53 levels with the extent of apoptosis, suggesting that p53 mediates self-antigen-induced clonal deletion of immature thymocytes. During thymic development, E2F1 may regulate p53 levels, perhaps by inducing p19ARF, leading to the deletion of self-reactive thymocytes by apoptosis. The extremely low levels of p19ARF that we detect in our system does not presently allow us to determine whether TCR engagement of DP cells leads to an increase in p19ARF levels. However, it is important to note that E2F2 also induces p19ARF, and yet E2F2 does not induce apoptosis (11) , suggesting that p19ARF induction is not sufficient for apoptosis, and that additional E2F1 targets are necessary for this process. Although the genes controlled by E2F1 that promote apoptosis are largely unknown, it will be interesting to analyze the expression of p53 regulators (such as p19ARF or Mdm2), as well as the genes regulated by p53 in this system. Additionally, introducing the E2F1 mutation into mice carrying mutations in other regulators of negative selection (such as CD30 or nur77) may shed light on the mechanisms that govern this process.

Together with an understanding of the mechanism of E2F1-dependent apoptosis, we believe that E2F1-deficient mice provide a useful tool to dissect the molecular mechanism of apoptosis. Furthermore, we expect that these mice will be a useful model for understanding the role of negative selection in shaping the immune repertoire.

Materials and Methods

Mice.
E2F1-/- (H-2b) mice were crossed with H-Y TCR (V{alpha}3Vß8.2) transgenic mice (H-2b, E2F1+/+; Ref. 35 ). F1 mice (H-2b, E2F1+/-) were intercrossed to obtain the H-Y TCR/E2F1-/- mice. To detect the transgenic H-Y TCR by standard PCR technology, we routinely used the Vß (AACACATGGAGGCTGCAGTC) and the DJß (TTCTGCACTGTTATCACCGC) primers. These primers hybridize with the variable region of the ß8.2-chain and the VDJ joining region of the ß8.2-chain of the transgenic TCR, respectively. The amplified fragment of the transgene is 306 bp long. To detect the wild-type (170 bp) or mutant E2F1 allele (230 bp) by PCR, we used a common E2F1 primer (GGATATGATTCTTGGACTTCTTGG) and the E2F1 wild-type exon primer (CTAAATCTGACCACCAAACGC) or the neo gene primer (CAAGTGCCAGCGGGGCTGCTAAAG).

Harvest of Thymocytes and Lymph Node Cells.
Thymuses and lymph nodes were mechanically dissociated between two pieces of ground glass. Debris was allowed to settle, and the cells were washed in DMEM supplemented with 10% heat-inactivated fetal bovine serum, 0.5 mM ß-mercaptoethanol, 2 mM glutamine, 1 mM HEPES (pH 7.4), and antibiotics (all from Life Technologies, Inc.). Contaminating erythrocytes were removed by hypotonic lysis (155 mM NH4Cl, 10 mM KHCO3, and 0.1 mM EDTA, pH 7.3) by incubating the cells on ice for 5 min. The cells were washed again in medium and then used in subsequent experiments.

In Vitro Apoptosis and T-Cell Stimulation Assays.
Thymocytes were plated in 96-well plates at a concentration of 3 x 105 cells per 200 µl in complete DMEM in the absence (spontaneous cell death) or presence of apoptosis inducers. Some wells were coated overnight with antihamster IgG antibody (1 µg/ml; Pharmingen) at 37°C. Wells were washed with PBS and coated with anti-CD3{varepsilon} antibody (145-2C11; 2 µg/ml; Pharmingen) for an additional 18-h period at 37°C. Wells were washed again with PBS prior to the addition of the thymocytes. Cell death was assayed at the indicated times after the initiation of culture. Aliquots from replicate wells were mixed with an equal volume of 0.4% trypan blue, and the concentrations of live and dead cells were counted on a hemacytometer. The percentage of cell survival in treated cultures was calculated relative to the percentage survival of parallel untreated cultures.

Lymph node cells (3 x 105) were placed into flat-bottomed 96-well plates and stimulated with 1 µg/ml ConA (Sigma) or 10 µg/ml of SEB (kindly provided by Dr. Ed Palmer, Basel Institute, Basel, Switzerland). Cells were harvested at day 3 after a 16-h pulse with 1 µCi of [3H]thymidine/well. [3H]Thymidine uptake was counted using a gas-phase scintillation counter.

In Vivo Apoptosis.
Transgenic female mice (4–6 weeks of age) were challenged with a single i.p. injection of superantigen SEB at a dose of 1.5 µg/gram body weight. Control mice were injected with a similar volume (0.2 ml) of PBS. Thymocytes were isolated at day 1, 2, or 3 and processed for flow cytometric analysis and Western analysis.

Flow Cytometric Analysis and TUNEL Assay.
The following MAbs (all obtained from Pharmingen) were used: anti-CD4 (FITC labeled or PE conjugated); anti-CD8 (FITC or PE labeled); and anti-Vß8 (FITC labeled). Single-cell suspensions of thymocytes and lymph node cells from 3- to 8-week-old male and female mice were washed in PBS and incubated with appropriated MAbs for 30 min on ice. After staining, the cells were washed in PBS, fixed in 2% paraformaldehyde, and analyzed on a Coulter XL cytometer (Coulter, Miami, FL). Dead cells were excluded by gating on forward and side light scatter. For the TUNEL assay, a fluoresceinated in situ cell death detection kit was used (Boehringer Mannheim). Briefly, thymocyte suspensions from mice were washed with PBS and fixed in 2% paraformaldehyde. Cells were then permeabilized according to the manufacturer’s instructions and incubated with the TUNEL reaction mixture (containing terminal deoxynucleotidyl transferase and FITC-labeled dUTP). Cells were analyzed by flow cytometry.

Western Blot Analysis.
Protein extracts were obtained by lysing the thymocytes on lysis buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5% NP40, supplemented with protease inhibitors] for 5 min on ice. Lysates were centrifuged at 21,000 x g, and protein concentrations in supernatants were determined using a commercially available kit (Bio-Rad). Thirty µg were loaded per lane, fractionated by SDS-PAGE in 12% polyacrylamide gels, and transferred onto polyvinylidene difluoride membranes (Amersham). Western blots were probed with a MAb against p53 (Ab-1; Oncogene Science) or a MAb against ß-actin (AC-15; Sigma). Blots were developed with an horseradish peroxidase-conjugated antimouse IgG antibody (Amersham) secondary antibody and a commercially available chemiluminescence kit, according to the manufacturer’s instructions (ECL; Amersham).

Acknowledgments

We thank our laboratory colleagues for helpful discussions, A. González for technical help, F. Merino for help with flow cytometry, E. Palmer for a generous gift of SEB, and M. Greenberg for providing the E2F1-/- mice.

Footnotes

1 I. G. and M. M. are recipients of Basque Government fellowships for graduate studies. This work was supported by Grant UPV 154.310-EA005/97 from the University of the Basque Country and Grant PI97/69 from the Department of Education of the Basque Government (to A. M. Z.). Back

2 Present address: Division of Endocrinology, Massachusetts General Hospital, Boston, MA 02114. Back

3 To whom requests for reprints should be addressed, at Department of Animal Biology and Genetics, Faculty of Sciences, University of the Basque Country, Bilbao E-48080, Spain. Phone: (34-94) 601-2000; Fax: (34-94) 464-8500; E-mail: ggpzuela{at}lg.ehu.es Back

4 The abbreviations used are: TCR, T-cell receptor; DP, double positive; SEB, staphylococcal enterotoxin B; TUNEL, terminal deoxynucleotidyltransferase-mediated nick end labeling; MAb, monoclonal antibody; PE, phycoerythrin. Back

Received for publication 9/23/99. Revision received 1/ 4/00. Accepted for publication 1/10/00.

References

  1. von Boehmer H. Thymic selection: a matter of life and death. Immunol. Today, 13: 454-456, 1992.[Medline]
  2. Nossal G. J. Negative selection of lymphocytes. Cell, 76: 229-239, 1994.[Medline]
  3. Sprent J., Webb S. R. Intrathymic and extrathymic clonal deletion of T cells. Curr. Biol., 7: 196-205, 1994.
  4. Kisielow P., Blüthmann H., Staerz U. D., Steinmetz M., von Boehmer H. Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature (Lond.), 333: 742-746, 1988.[Medline]
  5. Teh H. S., Kisielow P., Scott B., Kishi H., Uematsu Y., Blüthmann H., von Boehmer H. Thymic major histocompatibility complex antigens and the {alpha}ß T-cell receptor determine the CD4/CD8 phenotype of T cells. Nature (Lond.), 335: 229-233, 1988.[Medline]
  6. Amakawa R., Hakem A., Kundig T. M., Matsuyama T., Simard J. J. L., Timms E., Wakeham A., Mittruecker H. W., Griesser H., Takimoto H., Schmits R., Shahinian A., Ohashi P. S., Penninger J. M., Mak T. W. Impaired negative selection of T cells in Hodgkin’s disease antigen CD30-deficient mice. Cell, 84: 551-562, 1996.[Medline]
  7. Nevins J. R. E2F: a link between the Rb tumor suppressor protein and viral oncoproteins. Science (Washington DC), 258: 424-429, 1992.[Abstract/Free Full Text]
  8. Dyson N. The regulation of E2F by pRB-family proteins. Genes Dev., 12: 2245-2262, 1998.[Free Full Text]
  9. Helin K. Regulation of cell proliferation by the E2F transcription factors. Curr. Opin. Genet. Dev., 8: 28-35, 1998.[Medline]
  10. Macleod K. pRb and E2f-1 in mouse development and tumorigenesis. Curr. Opin. Genet. Dev., 9: 31-39, 1999.[Medline]
  11. DeGregori J., Leone G., Miron A., Jakoi L., Nevins J. R. Distinct roles for E2F proteins in cell growth control and apoptosis. Proc. Natl. Acad. Sci. USA, 94: 7245-7250, 1997.[Abstract/Free Full Text]
  12. Johnson D. G., Schwarz J. K., Cress W. D., Nevins J. R. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature (Lond.), 365: 349-352, 1993.[Medline]
  13. Qin X. Q., Livingston D. M., Kaelin W. G., Jr., Adams P. D. Deregulated transcription factor E2F-1 expression leads to S-phase entry and p53-mediated apoptosis. Proc. Natl. Acad. Sci. USA, 91: 10918-10922, 1994.[Abstract/Free Full Text]
  14. Shan B., Lee W. H. Deregulated expression of E2F-1 induces S-phase entry and apoptosis. Mol. Cell. Biol., 14: 8166-8173, 1994.[Abstract/Free Full Text]
  15. Kowalik T. F., DeGregori J., Leone G., Jakoi L., Nevins J. R. E2F-1-specific induction of apoptosis and p53 accumulation, which is blocked by Mdm2. Cell Growth Differ., 9: 113-118, 1998.[Abstract]
  16. Singh P., Wong S. W., Hong W. Overexpression of E2F-1 in rat embryo fibroblasts leads to neoplastic transformation. EMBO J., 13: 3329-3338, 1994.[Medline]
  17. Melillo R. M., Helin K., Lowy D. R., Schiller J. T. E2F-1 positive and negative regulation of cell proliferation: influence of protein level and HPV oncoprotein. Mol. Cell. Biol., 14: 8241-8249, 1994.[Abstract/Free Full Text]
  18. Bargou R. C., Wagener C., Bommert K., Arnold W., Daniel P. T., Mapara M. Y., Grinstein E., Royer H. D., Dorken B. Blocking of transcription factor E2F/DP by dominant-negative mutants in a normal breast epithelial cell line efficiently inhibits apoptosis and induces tumor growth in SCID mice. J. Exp. Med., 183: 3-10, 1996.
  19. Field S. J., Tsai F. Y., Kuo F., Zubiaga A. M., Kaelin W. G., Jr., Livingston D. M., Orkin S. H., Greenberg M. E. E2F-1 functions in mice to promote apoptosis and suppress proliferation. Cell, 85: 549-561, 1996.[Medline]
  20. Yamasaki L., Jacks T., Bronson R., Goillot E., Harlow E., Dyson N. J. Tumor induction and tissue atrophy in mice lacking E2F-1. Cell, 85: 537-548, 1996.[Medline]
  21. Hsieh J. K., Fredersdorf S., Kouzarides T., Martin K., Lu X. E2F-1-induced apoptosis requires DNA binding but not transactivation and is inhibited by the retinoblastoma protein through direct interaction. Genes Dev., 11: 1840-1852, 1997.[Abstract/Free Full Text]
  22. Phillips A. C., Bates S., Ryan K. M., Helin K., Vousden K. H. Induction of DNA synthesis and apoptosis are separable functions of E2F-1. Genes Dev., 11: 1853-1863, 1997.[Abstract/Free Full Text]
  23. Wu X., Levine A. J. p53 and E2F-1 cooperate to mediate apoptosis. Proc. Natl. Acad. Sci. USA, 91: 3802-3806, 1994.
  24. Hiebert S. W., Packham G., Strom D. K., Haffner R., Oren M., Zambetti G., Cleveland J. L. E2F-1/DP induces p53 and overrides survival factors to trigger apoptosis. Mol. Cell. Biol., 15: 6864-6874, 1995.[Abstract/Free Full Text]
  25. Pomerantz J., Schreiber-Agus N., Liegeois N. J., Silverman A., Alland L., Chin L., Potes J., Chen K., Orlow I., Lee H. W., Cordon-Cardo C., DePinho R. The ink4a tumor suppressor product, p19ARF, interacts with MDM2 and neutralizes MDM2 inhibition of p53. Cell, 92: 713-723, 1998.[Medline]
  26. Zhang Y., Xiong Y., Yarbrough W. G. ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4A locus deletion impairs both the Rb and p53 tumor suppressor pathways. Cell, 92: 725-734, 1998.[Medline]
  27. de Stanchina E., McCurrach M. E., Zindy F., Shieh S. Y., Ferbeyre G., Smuelson A. V., Prives C., Roussel M. F., Sherr C. J., Lowe S. W. E1A signaling to p53 involves the p19ARF tumor suppressor. Genes Dev., 12: 2434-2442, 1998.[Abstract/Free Full Text]
  28. Yamasaki L., Bronson R., Williams B. O., Dyson N. J., Harlow E., Jacks T. Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rb1(+/-) mice. Nat. Genet., 18: 360-364, 1998.[Medline]
  29. Tsai K. Y., Hu Y., Macleod K. F., Crowley D., Yamasaki L., Jacks T. Mutation of E2f-1 suppresses apoptosis and inappropriate S phase entry and extends survival of Rb-deficient mouse embryos. Mol. Cell, 2: 293-304, 1998.[Medline]
  30. Pan H., Yin C., Dyson N. J., Harlow E., Yamasaki L., Van Dyke T. Key roles for E2F1 in signaling p53-dependent apoptosis and in cell division within developing tumors. Mol. Cell, 2: 283-292, 1998.[Medline]
  31. Wyllie A. H. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature (Lond.), 284: 555-556, 1980.[Medline]
  32. Scollay R., Bartlett P., Shortman K. T cell development in the adult murine thymus: changes in the expression of the surface antigens Ly2, L3T4 and B2A2 during development from early precursor cells to emigrants. Immunol. Rev., 82: 79-103, 1984.[Medline]
  33. Smith C. A., Williams G. T., Kingston R., Jenkinson E. J., Owen J. J. Antibodies to CD3/T-cell receptor complex induce death by apoptosis in immature T cells in thymic cultures. Nature (Lond.), 337: 181-184, 1989.[Medline]
  34. Suhr C. D., Sprent J. T-cell apoptosis detected in situ during positive and negative selection in the thymus. Nature (Lond.), 372: 100-103, 1994.[Medline]
  35. White J., Herman A., Pullen A. M., Kubo R., Kappler J. W., Marrack P. The Vß-specific superantigen staphylococcal enterotoxin B: stimulation of mature T cells and clonal deletion in neonatal mice. Cell, 56: 27-35, 1989.[Medline]
  36. Foy, Aruffo A., Bajorath J., Buhlmann J. E., Noelle R. J. Immune regulation by CD40 and its ligand GP39. Annu. Rev. Immunol., 14: 591-617, 1996.[Medline]
  37. Page D. M., Roberts E. M., Peschon J. J., Hedrick S. M. TNF receptor-deficient mice reveal striking differences between several models of thymocyte negative selection. J. Immunol., 160: 120-133, 1998.[Abstract/Free Full Text]
  38. Rocha B., von Boehmer H. Peripheral selection of the T cell repertoire. Science (Washington DC), 251: 1225-1228, 1991.[Abstract/Free Full Text]
  39. von Boehmer H., Kirberg J., Rocha B. An unusual lineage of {alpha}/ß T cells that contains autoreactive cells. J. Exp. Med., 174: 1001-1008, 1991.[Abstract/Free Full Text]
  40. Smith K. G., Strasser A., Vaux D. L. CrmA expression in T lymphocytes of transgenic mice inhibits CD95 (Fas/APO-1)-transduced apoptosis, but does not cause lymphoadenopathy or autoimmune disease. EMBO J., 15: 5167-5176, 1996.[Medline]
  41. Hakem R., Hakem A., Duncan G. S., Henderson J. T., Woo M., Soengas M. S., Elia A., de la Pompa J. L., Kagi D., Khoo W., Potter J., Yoshida R., Kaufman S. A., Lowe S. W., Penninger J. M., Mak T. W. Differential requirement for caspase 9 in apoptotic pathways in vivo. Cell, 94: 339-352, 1998.[Medline]
  42. Kuida K., Zheng T. S., Na S., Kuan C., Yang D., Karasuyama H., Rakic P., Flavell R. A. Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature (Lond.), 384: 368-372, 1996.[Medline]
  43. Izquierdo M., Grandien A., Criado L. M., Robles S., Leonardo E., Albar J. P., González de Buitrago G., Martínez-A C. Blocked negative selection of developing T cells in mice expressing the baculovirus p35 caspase inhibitor. EMBO J., 18: 156-166, 1999.[Medline]
  44. Lowe S. W., Schmitt E. M., Smith S. W., Osborne B. A., Jacks T. p53 is required for radiation-induced apoptosis in mouse thymocytes. Nature (Lond.), 362: 847-849, 1993.[Medline]
  45. Clarke A. R., Purdie C. A., Harrison D. J., Morris R. G., Bird C. C., Hooper M. L., Wyllie A. H. Thymocyte apoptosis induced by p53-dependent and independent pathways. Nature (Lond.), 362: 849-852, 1993.[Medline]



This article has been cited by other articles:


Home page
J BiochemHome page
Y. Wei, D. Liu, Y. Ge, F. Zhou, J. Xu, H. Chen, J. Gu, and J. Jiang
Identification of E1AF as a Target Gene of E2F1-induced Apoptosis in Response to DNA Damage
J. Biochem., October 1, 2008; 144(4): 539 - 546.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Panchanathan, H. Xin, and D. Choubey
Disruption of Mutually Negative Regulatory Feedback Loop between Interferon-Inducible p202 Protein and the E2F Family of Transcription Factors in Lupus-Prone Mice
J. Immunol., May 1, 2008; 180(9): 5927 - 5934.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Y. Lee, Y. I. Choi, J. Kim, J. W. Choi, D. H. Sohn, C. Lee, S. H. Jeon, and R. H. Seong
Down-Regulation of the SWI/SNF Chromatin Remodeling Activity by TCR Signaling Is Required for Proper Thymocyte Maturation
J. Immunol., June 1, 2007; 178(11): 7088 - 7096.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Qiao, L. Di Stefano, C. Tian, Y.-Y. Li, Y.-H. Yin, X.-P. Qian, X.-W. Pang, Y. Li, M. A. McNutt, K. Helin, et al.
Human TFDP3, a Novel DP Protein, Inhibits DNA Binding and Transactivation by E2F
J. Biol. Chem., January 5, 2007; 282(1): 454 - 466.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
X. Lu, J. i. Jung, H. J. Cho, D. Y. Lim, H. S. Lee, H. S. Chun, D. Y. Kwon, and J. H. Park
Fisetin Inhibits the Activities of Cyclin-Dependent Kinases Leading to Cell Cycle Arrest in HT-29 Human Colon Cancer Cells
J. Nutr., December 1, 2005; 135(12): 2884 - 2890.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Z. Li, J. Stanelle, C. Leurs, H. Hanenberg, and B. M. Putzer
Selection of novel mediators of E2F1-induced apoptosis through retroviral expression of an antisense cDNA library
Nucleic Acids Res., May 16, 2005; 33(9): 2813 - 2821.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Q. Cao, Y. Xia, M. Azadniv, and I. N. Crispe
The E2F-1 Transcription Factor Promotes Caspase-8 and Bid Expression, and Enhances Fas Signaling in T Cells
J. Immunol., July 15, 2004; 173(2): 1111 - 1117.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Scheijen, M. Bronk, T. van der Meer, D. De Jong, and R. Bernards
High Incidence of Thymic Epithelial Tumors in E2F2 Transgenic Mice
J. Biol. Chem., March 12, 2004; 279(11): 10476 - 10483.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. W. Verschuren, J. G. Hodgson, J. W. Gray, S. Kogan, N. Jones, and G. I. Evan
The Role of p53 in Suppression of KSHV Cyclin-induced Lymphomagenesis
Cancer Res., January 15, 2004; 64(2): 581 - 589.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
U. Ziebold, E. Y. Lee, R. T. Bronson, and J. A. Lees
E2F3 Loss Has Opposing Effects on Different pRB-Deficient Tumors, Resulting in Suppression of Pituitary Tumors but Metastasis of Medullary Thyroid Carcinomas
Mol. Cell. Biol., September 15, 2003; 23(18): 6542 - 6552.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. DeRyckere, D. L. Mann, and J. DeGregori
Characterization of Transcriptional Regulation During Negative Selection In Vivo
J. Immunol., July 15, 2003; 171(2): 802 - 811.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. X. Li, J. W. Zhu, C. J. Hogan, and J. DeGregori
Defective Gene Expression, S Phase Progression, and Maturation during Hematopoiesis in E2F1/E2F2 Mutant Mice
Mol. Cell. Biol., May 15, 2003; 23(10): 3607 - 3622.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. D. MUNDLE and G. SABERWAL
Evolving intricacies and implications of E2F1 regulation
FASEB J, April 1, 2003; 17(6): 569 - 574.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. E. Cloud, C. Rogers, T. L. Reza, U. Ziebold, J. R. Stone, M. H. Picard, A. M. Caron, R. T. Bronson, and J. A. Lees
Mutant Mouse Models Reveal the Relative Roles of E2F1 and E2F3 In Vivo
Mol. Cell. Biol., April 15, 2002; 22(8): 2663 - 2672.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. W. Zhu, S. J. Field, L. Gore, M. Thompson, H. Yang, Y. Fujiwara, R. D. Cardiff, M. Greenberg, S. H. Orkin, and J. DeGregori
E2F1 and E2F2 Determine Thresholds for Antigen-Induced T-Cell Proliferation and Suppress Tumorigenesis
Mol. Cell. Biol., December 15, 2001; 21(24): 8547 - 8564.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. A. D'Souza, A. Pajak, K. Balazsi, and L. Dagnino
Ca2+ and BMP-6 Signaling Regulate E2F during Epidermal Keratinocyte Differentiation
J. Biol. Chem., June 22, 2001; 276(26): 23531 - 23538.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by García, I.
Right arrow Articles by Zubiaga, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García, I.
Right arrow Articles by Zubiaga, A. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation