| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cell Growth & Differentiation |
Articles |
Department of Animal Biology and Genetics, Faculty of Sciences, University of the Basque Country, E-48080, Spain [I. G., M. M., A. V., A. M. Z.], and Children’s Hospital, Department of Neuroscience, Harvard Medical School, Boston, Massachusetts 02115 [S. J. F.]
Abstract
Thymic negative selection is the process in which maturing thymocytes that express T-cell receptors recognizing self are eliminated by apoptotic cell death. The molecular mechanism by which this occurs is poorly understood. Notably, genes involved in cell death, even thymocyte death, such as Fas, Fas-ligand, p53, caspase-1, caspase-3, and caspase-9, and Bcl-2 have been found to not be required for normal thymic negative selection. We have demonstrated previously that E2F1-deficient mice have a defect in thymocyte apoptosis. Here we show that E2F1 is required for normal thymic negative selection. Furthermore, we observed an E2F1-dependent increase of p53 protein levels during the process of thymic clonal deletion, which suggests that E2F1 regulates activation-induced apoptosis of self-reactive thymocytes by a p53-dependent mechanism. In contrast, other apoptotic pathways operating on developing thymocytes, such as glucocorticoid-induced cell death, are not mediated by E2F1. The T lymphocytes that escape thymic negative selection migrate to the peripheral immune system but do not appear to be autoreactive, indicating that there may exist E2F1-independent mechanisms of peripheral tolerance, which protect mice from developing an autoimmune response. We expect that E2F1-deficient mice will provide a useful tool for understanding the molecular mechanism of and the immunological importance of thymic negative selection.
Introduction
At its discovery 20 years ago, the process of thymic negative selection was hailed as a major leap in our understanding of the mechanism underlying the immune system’s exquisite ability to distinguish self from non-self (1, 2, 3) . Since that time, relatively little progress has been made in understanding the molecular mechanism underlying this process. Thymic negative selection, the mechanism by which thymocytes bearing self-reactive antigen receptors undergo apoptosis in response to a death signal from neighboring cells, requires TCR4 -mediated recognition of antigenic peptides associated with major histocompatibility complex class I or II molecules on the surface of antigen-presenting cells and involves thymocytes at the immature CD4/CD8 DP developmental stage or early in the mature single positive stage (1, 2, 3) . Major advances in our knowledge of thymic selection have resulted from the utilization of transgenic mouse models in which TCRs of known specificity are used. Examples of this approach include the introduction of genes encoding a TCR recognizing the male H-Y antigen in the context of H-2Db. Thymocytes from these transgenic mice are deleted at or before the CD4/CD8 DP developmental stage when the male H-Y antigen is present (4 , 5) .
Although the process of negative selection is understood to involve the initiation of apoptotic cell death in thymocytes that express TCRs that recognize self, the details are unclear. Notably, in vivo mutational analysis of a number of proteins that originally were expected to be important for thymic cell death, including p53, Fas, Fas-ligand, caspase-1, caspase-3, caspase-9, Bcl-2, and others, has shown that none of these are required for normal thymic negative selection. Indeed, to date only a null mutation of the CD30 gene has been found to impair negative selection (6) . Mutation of CD30, a surface antigen found on Reed-Sternberg cells of Hodgkin’s disease and on a variety of non-Hodgkin’s lymphoma cells, results in a 5-fold increase in the survival of cells expressing particular TCRs that recognize self-antigens, demonstrating a requirement for CD30 in normal thymic negative selection. The identification of additional examples of genes required for thymic negative selection is crucial for two purposes: (a) these genes will help delineate the molecular mechanism by which apoptosis is triggered and executed in thymic negative selection; and (b) these mutant mice will provide model systems to investigate the role for thymic negative selection in shaping the immune repertoire.
The E2F transcription factor, although initially described as a factor
involved in promoting cell cycle progression, has more recently been
found to play an important role in apoptosis (7, 8, 9, 10)
.
The E2F gene family is comprised of six members that show
different affinities for pRB family members. E2F1, E2F2, and E2F3 bind
with high affinity to pRB, whereas E2F4 and E2F5 bind with high
affinity to the pRB-related proteins p107 and p130. A newly identified
E2F species, referred to as EMA or E2F6, lacks the Rb-interaction
domain and does not physically associate with members of the RB family
(8)
. A variety of genes encoding proteins important for
cell proliferation are activated by E2F, and the expression of these
genes may be a result of transcriptional activation, as well as
derepression (8, 9, 10)
. The target genes include those
important for DNA replication (e.g., Pol 
, Orcl,
Mcm, and TS), control of cell cycle (cyclin
A and cyclin E), proto-oncogenes (myc and
myb), and the RB family (Rb and 107).
These studies also show that the individual E2F proteins display
distinct specificities in the activation of the target genes
(11)
. Coincident with the differential abilities to
activate a large array of endogenous genes that encode proteins
important for DNA replication and cell cycle, the E2F family members
possess distinct activities and functions in cell growth. For example,
ectopic overexpression of various E2Fs (including E2F1, E2F2, and E2F3)
in tissue culture cells can drive quiescent cells to enter the S phase
of cell cycle, whereas E2F4 and E2F5 show little activity in S-phase
induction (11, 12, 13, 14, 15)
. Moreover, E2F1 or E2F4 can function as
oncogenes in standard fibroblast cotransformation assays with activated
ras (16)
or participate in the immortalization
of primary human keratinocytes (17)
.
Interestingly, overexpression of E2F1, but not other E2Fs, has the additional property of inducing apoptosis in fibroblast cells grown in low serum (11) . Furthermore, it has been shown that inhibition of E2F activity by dominant negative mutants can prevent apoptosis in cultured breast epithelial cells and promote tumor growth in SCID mice (18) . More direct evidence of a role for E2F1 in apoptosis is provided by experiments with E2F1-deficient mice. Mice mutant for E2F1 display a defect in apoptosis of CD4/CD8 DP thymocytes, leading to an excess of mature T cells (19) . These mice are also predisposed to tumor formation (19 , 20) , a finding that might reflect a role for E2F1 in limiting hyperplasia and tumorigenesis in specific tissues, and thus, E2F1 would function as a tumor suppressor.
Several reports have shown that E2F1 can induce p53-independent apoptosis (21 , 22) , although in most cases E2F1 appears to induce apoptosis by a p53-mediated mechanism (23 , 24) . In addition, overexpression of E2F1, but not E2F2, leads to increased levels of p53, and coexpression of the MDM2 protein blocks both E2F1-mediated apoptosis as well as E2F1-mediated accumulation of p53 (15) . The mechanism by which E2F1 regulates p53 is unknown, although it could be mediated by p19ARF, a protein that stabilizes p53 and activates p53-dependent transcription (25 , 26) . p19ARF can be induced by E2F1 (11) , and its expression is slightly elevated in Rb-/- cells (27) , providing a connection between E2F1 and p53. However, p19ARF induction may not be sufficient for apoptosis, and additional E2F1 targets may be necessary for this process (8) .
Recent work indicates that the presence of E2F1 is required for the defects caused by the loss of RB function in many cell types in the developing embryo and suggests that dysregulation of E2F1 function is responsible for these defects (28 , 29) . The fact that E2F1 mutation rescued apoptosis occurring in the developing lens and central nervous system, which are dependent on p53, but not in the peripheral nervous system, which is p53 independent, also points toward a requirement for the induction of the p53 pathway for the function of E2F1 in apoptosis (29) . Loss of E2F1 function also leads to a complete suppression of apoptosis induced by inactivation of Rb in the choroid plexus of mice expressing the Tag121 transgene, just as in loss of p53 function. It is important to note that the choroid plexus, lens, and central nervous system are normal in E2F1-deficient mice, and it is only after disruption of the pRB/E2F regulatory network by SV40-T or Rb loss that this role in apoptosis is unmasked (30) .
We have demonstrated previously that mutation of E2F1 in mice results in a defect in thymocyte apoptosis (19) . Here we introduced the E2F1 mutation into mice expressing a transgene for an H-Y-specific T-cell receptor, a system allowing the assessment of thymic negative selection (6) . Our results show that apoptosis during negative selection of immature DP thymocytes is impaired in E2F1-deficient mice. We also found that expression of p53 correlates with the extent of negative selection. We conclude that E2F1 plays a crucial role in normal thymic negative selection by a mechanism that appears to involve p53.
Results
Defective TCR-mediated, but not Glucocorticoid-mediated, Apoptosis
in E2F1-/- Thymocytes.
We have shown previously that in vitro cultured
E2F1-/- thymocytes demonstrate increased viability
relative to their wild-type control cells. Specifically, CD4/CD8 DP
thymocytes display an enhanced level of survival in culture
(spontaneous cell death), suggesting that E2F1 plays some role in the
regulation of apoptosis in this immature population (19)
.
To examine the effect of E2F1 mutation on apoptosis caused
by inducers of cell death that specifically target immature thymocytes,
we evaluated the in vitro responses to dexamethasone
treatment, a glucocorticoid known to cause rapid apoptotic death of
cortical DP thymocytes (31
, 32)
. After 18 h of
treatment with this agent, there was extensive cell death in culture,
but we found no differences in viability between thymocytes from mutant
and control mice (Fig. 1)
. We further investigated thymocyte responses to cross-linking with
anti-CD3 antibody, which is known to activate mature T cells but kill
immature DP thymocytes in vitro and in vivo
(33)
. By 24 h after in vitro anti-CD3
cross-linking, there were 
30% more live E2F1-mutant
thymocytes as compared with controls (Fig. 1)
, consistent with the data
obtained by in vivo anti-CD3 treatment (19)
.
These results suggest that E2F1 may be selectively involved in the
apoptosis triggered through the TCR in immature thymocytes.
|
Ordinarily, negative selection is difficult to observe because only a
small fraction of thymocytes undergo negative selection to any
particular antigen (34)
. To increase the fraction of
thymocytes undergoing negative selection, we crossed the
E2F1-/- mice with a TCR-transgenic mouse line
specific for the male (H-Y) antigen, maintaining the H-2b
background. The transgenic receptor is composed of the V3 and
Vß8.2 members of the and ß chain variable region gene families,
and this TCR is expressed in virtually all T cells in transgenic mice
(4)
. Thymocytes expressing the H-Y-specific transgenic
TCRs are positively selected in female H-2b mice,
negatively selected in male H-2b mice, and nonselected in
H-2d mice (5)
.
When we analyzed the positive-selecting transgenic female mice, we
found that thymocyte phenotypes were similar in
E2F1-/- as well as
E2F1+/+ mice (data not shown). Next, we analyzed
negative-selecting transgenic male mice, and similar to what has been
reported previously (4)
, we found that the
negative-selecting male mice show a massive reduction in cell number in
the thymus because of the deletion of H-Y-specific DP thymocytes by
apoptosis. Results obtained from E2F1+/+ or
E2F1+/- mice were similar for all of the
experiments described in this article. In contrast, in
negative-selecting male mice carrying an E2F1 mutation, the
reduction in thymocyte number was inhibited, and there was a 50–70%
higher cell survival rate in E2F1-deficient mice (Fig. 2a)
. The proportion of DP cells was also less affected in the mutant mice,
which contained approximately a 3–4-fold increase in DP cells compared
with wild-type controls (Fig. 2b)
. Similarly, the percentage
of thymocytes that presumably escape from negative selection,
expressing the transgenic Vß8 chain and the accessory molecule CD8,
was 3–4-fold higher in E2F1-deficient mice (29%
versus 7%). Thus, these data indicate that H-Y transgenic
E2F1-/- mice have a partial, but clearly
significant, defect in negative selection in the thymus.
|
,
suggesting that E2F1 plays a role in apoptosis during
activation-induced cell death of immature thymocytes.
Increased Levels of Undeleted Mature T Lymphocytes in Transgenic
E2F1-/- Male Mice.
The lymph nodes of H-Y transgenic E2F1-mutant mice were also
enlarged relative to the E2F1 wild-type controls. Adult
E2F1-/- mice, 6–8 week of age, had 80%
more lymphocytes than age-matched E2F1+/+
controls (Fig. 3a)
. We then analyzed the phenotype of these cells by flow cytometry and
found that >95% of the T lymphocytes expressed transgenic Vß8 chain
(data not shown). To recognize H-Y antigen, T cells need to express
both the TCR transgenes and the TCR-associated molecule CD8. We
analyzed expression of transgenic Vß8 and the accessory molecule CD8
in peripheral T cells from male (H-Y-expressing) wild-type and
E2F1-deficient mice. We found a 2–3-fold increase in
potentially functional H-Y-specific peripheral lymphocytes
(i.e., expressing Vß8 and CD8) in
E2F1-/- mice compared with wild-type controls
(Fig. 3b)
. These results provide further evidence that
self-reactive transgene-expressing thymocytes escape negative selection
in the thymus.
|
, indicating that the
proliferative capacity of these cells remains intact. On the other
hand, when we analyzed the T-cell response to SEB, we found differences
between the transgenic and nontransgenic lymphocytes. The response to
SEB of transgenic E2F1+/+ T lymphocytes was
greatly inhibited, because virtually all transgenic T cells carry an
SEB-reactive TCR, in contrast to only 20–30% in nontransgenic T
cells. This is consistent with the idea that transgenic Vß8-bearing T
cells are anergic to their specific antigen and thus are not
autoreactive (4)
. When we compared the response to SEB in
E2F1+/+ and E2F1-/-
cells, no differences were found in the response to SEB between T
lymphocytes carrying a mutation in the E2F1 locus and their
wild-type controls (Fig. 3c)
, suggesting that TCR-transgenic
E2F1-/- T cells are not functionally
autoreactive, as far as can be determined by this experimental
approach.
Induction of Negative Selection by Superantigen SEB Is Impaired in
TCR-Transgenic E2F1-/- Female Mice.
To further examine Vß8 TCR transgenic E2F1-deficient
thymocytes for altered sensitivity to negative selection, we analyzed
clonal deletion in female transgenic mice by using superantigen SEB.
This antigen has been shown to bind to thymocytes expressing Vß8,
leading to a deletion of thymocytes in the DP compartment when high to
moderate doses of SEB are injected (35)
. The
intraperitoneal injection of SEB (1.5 µg/gram body weight) led, by
24 h of treatment, to a 75% reduction in the total number of
E2F1+/- transgenic thymocytes compared with the
total number of thymocytes in PBS-injected transgenic females. On the
other hand, we only observed a 25% reduction in the number of
E2F1-/- transgenic thymocytes after SEB
injection (Fig. 4)
. Similar differences were found in the DP compartment. The percentage of
CD4/CD8 DP thymocytes was reduced from 60% in PBS-treated animals to
40% in SEB-treated E2F1+/- transgenic mice. In
contrast, no reduction in the percentage of DP thymocytes was observed
in E2F1-/- transgenic mice (Fig. 4)
. These
results suggest that E2F1 regulates the negative selection that follows
in vivo treatment with SEB by inducing clonal deletion of
Vß8-bearing CD4/CD8 transgenic thymocytes.
|
. This increase was detectable by 12 h after SEB treatment (data not
shown). The higher levels of p53 expression decreased by the second day
of the treatment (Fig. 5a)
.
|
. The reduction in p53
accumulation correlates with the defect in negative selection observed
in SEB-treated E2F1-mutant mice and suggests that E2F1 mediates
apoptosis during thymic negative selection by a p53-dependent
mechanism. Discussion
Our results show a requirement for E2F1 during the process of negative selection in the development of T cells. Specifically, E2F1 appears to be required for normal induction of apoptosis in thymocytes bearing TCRs that recognize self-antigens. One of the difficulties of analyzing negative selection comes from the fact that very few apoptotic cells can be detected in the thymus at a given time (34) . When TCR-transgenic mice are used, virtually all thymocytes express the transgenic TCR. As a result, if the antigen recognized by this receptor is present, massive cell death occurs, primarily at the CD4/CD8 DP stage of thymic maturation, which makes negative selection more easily detectable. Considering that there are no single experimental approaches to analyze thymic negative selection in all of its complexity (36 , 37) , we set out to study the role of E2F1 in two negative selection models involving the use of TCR-transgenic animals. In one case, the self-antigen (H-Y) is constantly present in male mice (4 , 5) . This allows us to analyze not only the role of E2F1 during thymic negative selection but also the effect that the lack of E2F1 may have on the peripheral selection of T lymphocytes. A 3–4-fold higher number of CD8+/Vß8+ cells can be seen both in the thymus and the lymph nodes of E2F1-/- mice compared with wild-type controls, suggesting that the lack of E2F1 protects a proportion of H-Y-specific immature thymocytes from TCR-mediated apoptosis, which would then migrate to the periphery and accumulate there.
The transgenic system used in our study allows us to analyze the role of E2F1 in negative selection using a second type of experimental approach. It consists of analyzing in vivo thymic selection induced by superantigen SEB into H-Y TCR-transgenic female mice, where clonal deletion attributable to the presence of the male H-Y antigen is not occurring (5) . Similarly to what we found in transgenic males, negative selection in E2F1-deficient female mice was also impaired after SEB administration. These results further support the idea that E2F1 regulates thymic negative selection and suggest that E2F1 not only functions to eliminate preneoplastic cells that may have accumulated mutations in genes, such as in Rb, but also to eliminate autoimmune T cells.
On the basis of our in vitro proliferation data, E2F1-deficient transgenic lymph node T cells from male mice appear to be anergic to the same extent as T cells from E2F1 wild-type controls. This is based on the finding that they respond minimally to SEB (a specific antigen), whereas they proliferate normally after ConA treatment. These results suggest that the transgenic T cells have fallen into an anergic state in the mutant mice, and that some homeostatic process may exist, which is independent of E2F1, to prevent these cells from initiating an autoimmune response. A similar conclusion was reached after the H-Y TCR-transgenic system was used to determine the function of the surface glycoprotein CD30, a member of the tumor necrosis factor receptor family. It was found that CD30 is involved in mediating death signals during negative selection, but that mature cells were not autoreactive (6) . Our examination of TCR-transgenic E2F1-/- mice has not revealed any signs of autoimmune disease to date. Nevertheless, we cannot presently rule out the possibility that the CD8+/Vß8+ cells show some "benign" autoreactivity that could only be revealed in vivo and could develop into a more aggressive form in certain conditions where, for instance, lymphokines up-regulate the level of antigen or up-regulate the effector function of these autoreactive T cells (38 , 39) . Adoptive transfer-type experiments may reveal whether a higher expansion potential of this cell population can be detected in E2F1-mutant compared to wild-type animals.
A variety of conditions induce thymic apoptosis, although the
mechanisms by which these conditions induce cell death appear to be
different. For example, bcl-2-transgenic thymocytes and
caspase-9-deficient thymocytes display resistance to
dexamethasone- and 
-irradiation-mediated death but are sensitive to
anti-CD95 antibody (40, 41, 42)
, whereas p35-transgenic
thymocytes are resistant to several apoptosis-inducing agents but
sensitive to spontaneous cell death in vitro
(43)
. It is well established that either TCR engagement or
dexamethasone treatment causes specific cell death of immature cortical
thymocytes at the DP stage (31
, 40)
, but their apoptosis
pathways appear to be different, based on our in vivo and
in vitro results showing that E2F1 is involved in apoptosis
mediated through TCR engagement but not in glucocorticoid-induced
apoptosis. On the one hand, it is known that dexamethasone-mediated
apoptosis is p53 independent (44
, 45)
. On the other hand,
our results on SEB-mediated apoptosis correlate p53 levels with the
extent of apoptosis, suggesting that p53 mediates
self-antigen-induced clonal deletion of immature thymocytes. During
thymic development, E2F1 may regulate p53 levels, perhaps by inducing
p19ARF, leading to the deletion of self-reactive thymocytes
by apoptosis. The extremely low levels of p19ARF that we
detect in our system does not presently allow us to determine whether
TCR engagement of DP cells leads to an increase in p19ARF
levels. However, it is important to note that E2F2 also induces
p19ARF, and yet E2F2 does not induce apoptosis
(11)
, suggesting that p19ARF induction is not
sufficient for apoptosis, and that additional E2F1 targets are
necessary for this process. Although the genes controlled by E2F1 that
promote apoptosis are largely unknown, it will be interesting to
analyze the expression of p53 regulators (such as p19ARF or
Mdm2), as well as the genes regulated by p53 in this system.
Additionally, introducing the E2F1 mutation into mice carrying
mutations in other regulators of negative selection (such as CD30 or
nur77) may shed light on the mechanisms that govern this
process.
Together with an understanding of the mechanism of E2F1-dependent apoptosis, we believe that E2F1-deficient mice provide a useful tool to dissect the molecular mechanism of apoptosis. Furthermore, we expect that these mice will be a useful model for understanding the role of negative selection in shaping the immune repertoire.
Materials and Methods
Mice.
E2F1-/- (H-2b) mice were crossed
with H-Y TCR (V3Vß8.2) transgenic mice (H-2b,
E2F1+/+; Ref. 35
). F1 mice (H-2b,
E2F1+/-) were intercrossed to obtain the H-Y
TCR/E2F1-/- mice. To detect the transgenic H-Y
TCR by standard PCR technology, we routinely used the Vß
(AACACATGGAGGCTGCAGTC) and the DJß (TTCTGCACTGTTATCACCGC) primers.
These primers hybridize with the variable region of the ß8.2-chain
and the VDJ joining region of the ß8.2-chain of the transgenic TCR,
respectively. The amplified fragment of the transgene is 306 bp long.
To detect the wild-type (170 bp) or mutant E2F1 allele (230
bp) by PCR, we used a common E2F1 primer
(GGATATGATTCTTGGACTTCTTGG) and the E2F1 wild-type exon
primer (CTAAATCTGACCACCAAACGC) or the neo gene primer
(CAAGTGCCAGCGGGGCTGCTAAAG).
Harvest of Thymocytes and Lymph Node Cells.
Thymuses and lymph nodes were mechanically dissociated between two
pieces of ground glass. Debris was allowed to settle, and the cells
were washed in DMEM supplemented with 10% heat-inactivated fetal
bovine serum, 0.5 mM ß-mercaptoethanol, 2 mM
glutamine, 1 mM HEPES (pH 7.4), and antibiotics (all from
Life Technologies, Inc.). Contaminating erythrocytes were removed by
hypotonic lysis (155 mM NH4Cl, 10
mM KHCO3, and 0.1 mM EDTA, pH 7.3)
by incubating the cells on ice for 5 min. The cells were washed again
in medium and then used in subsequent experiments.
In Vitro Apoptosis and T-Cell Stimulation Assays.
Thymocytes were plated in 96-well plates at a concentration of 3
x 105 cells per 200 µl in complete DMEM in the absence
(spontaneous cell death) or presence of apoptosis inducers. Some wells
were coated overnight with antihamster IgG antibody (1 µg/ml;
Pharmingen) at 37°C. Wells were washed with PBS and coated with
anti-CD3
antibody (145-2C11; 2 µg/ml; Pharmingen) for an
additional 18-h period at 37°C. Wells were washed again with PBS
prior to the addition of the thymocytes. Cell death was assayed at the
indicated times after the initiation of culture. Aliquots from
replicate wells were mixed with an equal volume of 0.4% trypan blue,
and the concentrations of live and dead cells were counted on a
hemacytometer. The percentage of cell survival in treated cultures was
calculated relative to the percentage survival of parallel untreated
cultures.
Lymph node cells (3 x 105) were placed into flat-bottomed 96-well plates and stimulated with 1 µg/ml ConA (Sigma) or 10 µg/ml of SEB (kindly provided by Dr. Ed Palmer, Basel Institute, Basel, Switzerland). Cells were harvested at day 3 after a 16-h pulse with 1 µCi of [3H]thymidine/well. [3H]Thymidine uptake was counted using a gas-phase scintillation counter.
In Vivo Apoptosis.
Transgenic female mice (4–6 weeks of age) were challenged with a
single i.p. injection of superantigen SEB at a dose of 1.5 µg/gram
body weight. Control mice were injected with a similar volume (0.2 ml)
of PBS. Thymocytes were isolated at day 1, 2, or 3 and processed for
flow cytometric analysis and Western analysis.
Flow Cytometric Analysis and TUNEL Assay.
The following MAbs (all obtained from Pharmingen) were used: anti-CD4
(FITC labeled or PE conjugated); anti-CD8 (FITC or PE labeled); and
anti-Vß8 (FITC labeled). Single-cell suspensions of thymocytes and
lymph node cells from 3- to 8-week-old male and female mice were washed
in PBS and incubated with appropriated MAbs for 30 min on ice. After
staining, the cells were washed in PBS, fixed in 2% paraformaldehyde,
and analyzed on a Coulter XL cytometer (Coulter, Miami, FL). Dead cells
were excluded by gating on forward and side light scatter. For the
TUNEL assay, a fluoresceinated in situ cell death detection
kit was used (Boehringer Mannheim). Briefly, thymocyte suspensions from
mice were washed with PBS and fixed in 2% paraformaldehyde. Cells were
then permeabilized according to the manufacturer’s instructions and
incubated with the TUNEL reaction mixture (containing terminal
deoxynucleotidyl transferase and FITC-labeled dUTP). Cells were
analyzed by flow cytometry.
Western Blot Analysis.
Protein extracts were obtained by lysing the thymocytes on lysis buffer
[50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5%
NP40, supplemented with protease inhibitors] for 5 min on ice. Lysates
were centrifuged at 21,000 x g, and protein
concentrations in supernatants were determined using a commercially
available kit (Bio-Rad). Thirty µg were loaded per lane, fractionated
by SDS-PAGE in 12% polyacrylamide gels, and transferred onto
polyvinylidene difluoride membranes (Amersham). Western blots were
probed with a MAb against p53 (Ab-1; Oncogene Science) or a MAb against
ß-actin (AC-15; Sigma). Blots were developed with an horseradish
peroxidase-conjugated antimouse IgG antibody (Amersham) secondary
antibody and a commercially available chemiluminescence kit, according
to the manufacturer’s instructions (ECL; Amersham).
Acknowledgments
We thank our laboratory colleagues for helpful discussions, A. González for technical help, F. Merino for help with flow cytometry, E. Palmer for a generous gift of SEB, and M. Greenberg for providing the E2F1-/- mice.
Footnotes
1 I. G. and M. M. are recipients of
Basque Government fellowships for graduate studies. This work was
supported by Grant UPV 154.310-EA005/97 from the University of the
Basque Country and Grant PI97/69 from the Department of Education of
the Basque Government (to A. M. Z.). 
2 Present address: Division of Endocrinology,
Massachusetts General Hospital, Boston, MA 02114.
3 To whom requests for reprints should be
addressed, at Department of Animal Biology and Genetics, Faculty of
Sciences, University of the Basque Country, Bilbao E-48080,
Spain. Phone: (34-94) 601-2000; Fax: (34-94) 464-8500; E-mail: ggpzuela{at}lg.ehu.es
4 The abbreviations used are: TCR, T-cell
receptor; DP, double positive; SEB, staphylococcal enterotoxin B;
TUNEL, terminal deoxynucleotidyltransferase-mediated nick end labeling;
MAb, monoclonal antibody; PE, phycoerythrin.
Received for publication 9/23/99. Revision received 1/ 4/00. Accepted for publication 1/10/00.
References
ß T-cell receptor determine the CD4/CD8 phenotype of T cells. Nature (Lond.), 335: 229-233, 1988.[Medline]
/ß T cells that contains autoreactive cells. J. Exp. Med., 174: 1001-1008, 1991.This article has been cited by other articles:
 |
|
 |
|
  Y. Wei, D. Liu, Y. Ge, F. Zhou, J. Xu, H. Chen, J. Gu, and J. Jiang Identification of E1AF as a Target Gene of E2F1-induced Apoptosis in Response to DNA Damage J. Biochem., October 1, 2008; 144(4): 539 - 546. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Panchanathan, H. Xin, and D. Choubey Disruption of Mutually Negative Regulatory Feedback Loop between Interferon-Inducible p202 Protein and the E2F Family of Transcription Factors in Lupus-Prone Mice J. Immunol., May 1, 2008; 180(9): 5927 - 5934. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Y. Lee, Y. I. Choi, J. Kim, J. W. Choi, D. H. Sohn, C. Lee, S. H. Jeon, and R. H. Seong Down-Regulation of the SWI/SNF Chromatin Remodeling Activity by TCR Signaling Is Required for Proper Thymocyte Maturation J. Immunol., June 1, 2007; 178(11): 7088 - 7096. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Qiao, L. Di Stefano, C. Tian, Y.-Y. Li, Y.-H. Yin, X.-P. Qian, X.-W. Pang, Y. Li, M. A. McNutt, K. Helin, et al. Human TFDP3, a Novel DP Protein, Inhibits DNA Binding and Transactivation by E2F J. Biol. Chem., January 5, 2007; 282(1): 454 - 466. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Lu, J. i. Jung, H. J. Cho, D. Y. Lim, H. S. Lee, H. S. Chun, D. Y. Kwon, and J. H. Park Fisetin Inhibits the Activities of Cyclin-Dependent Kinases Leading to Cell Cycle Arrest in HT-29 Human Colon Cancer Cells J. Nutr., December 1, 2005; 135(12): 2884 - 2890. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Li, J. Stanelle, C. Leurs, H. Hanenberg, and B. M. Putzer Selection of novel mediators of E2F1-induced apoptosis through retroviral expression of an antisense cDNA library Nucleic Acids Res., May 16, 2005; 33(9): 2813 - 2821. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Cao, Y. Xia, M. Azadniv, and I. N. Crispe The E2F-1 Transcription Factor Promotes Caspase-8 and Bid Expression, and Enhances Fas Signaling in T Cells J. Immunol., July 15, 2004; 173(2): 1111 - 1117. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Scheijen, M. Bronk, T. van der Meer, D. De Jong, and R. Bernards High Incidence of Thymic Epithelial Tumors in E2F2 Transgenic Mice J. Biol. Chem., March 12, 2004; 279(11): 10476 - 10483. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. W. Verschuren, J. G. Hodgson, J. W. Gray, S. Kogan, N. Jones, and G. I. Evan The Role of p53 in Suppression of KSHV Cyclin-induced Lymphomagenesis Cancer Res., January 15, 2004; 64(2): 581 - 589. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Ziebold, E. Y. Lee, R. T. Bronson, and J. A. Lees E2F3 Loss Has Opposing Effects on Different pRB-Deficient Tumors, Resulting in Suppression of Pituitary Tumors but Metastasis of Medullary Thyroid Carcinomas Mol. Cell. Biol., September 15, 2003; 23(18): 6542 - 6552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. DeRyckere, D. L. Mann, and J. DeGregori Characterization of Transcriptional Regulation During Negative Selection In Vivo J. Immunol., July 15, 2003; 171(2): 802 - 811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. X. Li, J. W. Zhu, C. J. Hogan, and J. DeGregori Defective Gene Expression, S Phase Progression, and Maturation during Hematopoiesis in E2F1/E2F2 Mutant Mice Mol. Cell. Biol., May 15, 2003; 23(10): 3607 - 3622. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. D. MUNDLE and G. SABERWAL Evolving intricacies and implications of E2F1 regulation FASEB J, April 1, 2003; 17(6): 569 - 574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Cloud, C. Rogers, T. L. Reza, U. Ziebold, J. R. Stone, M. H. Picard, A. M. Caron, R. T. Bronson, and J. A. Lees Mutant Mouse Models Reveal the Relative Roles of E2F1 and E2F3 In Vivo Mol. Cell. Biol., April 15, 2002; 22(8): 2663 - 2672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. W. Zhu, S. J. Field, L. Gore, M. Thompson, H. Yang, Y. Fujiwara, R. D. Cardiff, M. Greenberg, S. H. Orkin, and J. DeGregori E2F1 and E2F2 Determine Thresholds for Antigen-Induced T-Cell Proliferation and Suppress Tumorigenesis Mol. Cell. Biol., December 15, 2001; 21(24): 8547 - 8564. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. A. D'Souza, A. Pajak, K. Balazsi, and L. Dagnino Ca2+ and BMP-6 Signaling Regulate E2F during Epidermal Keratinocyte Differentiation J. Biol. Chem., June 22, 2001; 276(26): 23531 - 23538. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cell Growth & Differentiation |
