CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antoine, M.
Right arrow Articles by Kiefer, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antoine, M.
Right arrow Articles by Kiefer, P.
Cell Growth & Differentiation Vol. 11, 593-605, November 2000
© 2000 American Association for Cancer Research


Articles

NH2-Terminal Cleavage of Xenopus Fibroblast Growth Factor 3 Is Necessary for Optimal Biological Activity and Receptor Binding

Marianne Antoine, Markus Daum, Roman Köhl, Volker Blecken, M. James Close, Gordon Peters and Paul Kiefer1

Ruhr-Universität Bochum, Med. Fakultät, Abteilung für Virologie, D-44780 Bochum, Geb. MA 6/130, Germany [M. A., M. D., R. K., V. B., P. K.], and Imperial Cancer Research Fund Laboratories, London WC2A 3PX, United Kingdom [M. J. C., G. P.]

Abstract

Fibroblast growth factor 3 (FGF3) was originally identified as the mouse proto-oncogene Int-2, which is activated by proviral insertion in tumors induced by mouse mammary tumor virus. To facilitate the biological characterization of the ligand, we have analyzed its homologue in Xenopus laevis, XFGF3. Here we confirm that the X. laevis genome contains two distinct FGF3 alleles, neither of which is capable of encoding the NH2-terminally extended forms specified by the mouse and human FGF3 genes. Unlike the mammalian proteins, XFGF3 is efficiently secreted as a Mr 31,000 glycoprotein, gp31, which undergoes proteolytic cleavage to produce an NH2-terminally truncated product, gp27. Processing removes a segment of 18 amino acids immediately distal to the signal peptide that is not present in the mammalian homologues. By inserting an epitope-tag adjacent to the cleavage site, we show that a substantial amount of the gp27 is generated intracellularly, although processing can also occur in the extracellular matrix. Two residues are also removed from the COOH terminus. To compare the biological properties of the different forms, cDNAs were constructed that selectively give rise to the larger, gp31, or smaller, gp27, forms of XFGF3. As judged by their ability to cause morphological transformation of NIH3T3 cells, their mitogenicity on specific cell types, and their affinity for the IIIb and IIIc isoforms of Xenopus FGF receptors, gp27 has a much higher biological activity than gp31. Sequence comparison revealed an intriguing similar cleavage motif immediately downstream of the signal peptide cleavage site in the NH2-terminus of mouse and human FGF3. Analysis of secreted mutant mouse FGF3 confirmed an additional NH2-terminal processing at the corresponding sequence motif. NH2-terminal trimming of Xenopus and mammalian FGF3s may therefore be a prerequisite of optimal biological activity.

Introduction

The FGFs2 are a family of related polypeptides, typically between Mr 15,000 and Mr 35,000 in size, that have been credited with many and diverse biological functions (reviewed in Refs. 1, 2, 3, 4, 5, 6, 7 ). The prototypic factors, FGF1 and FGF2 (previously acidic and basic FGF, respectively), were discovered in a wide spectrum of cell types but have aroused most interest as inducers of mesoderm, as endothelial cell mitogens, and as angiogenic factors. This latter activity suggests a possible role in tumorigenesis, and three members of the FGF family have been directly implicated as cellular oncogenes. These are FGF3 (formerly Int-2), FGF4 (formerly Hst-1 or KFGF) and FGF8, the genes for which are known targets for proviral insertion in tumors induced by mouse mammary tumor virus (8 , 9) .

In trying to understand the role of FGF3 in mammary tumorigenesis, it became clear that the gene is not expressed in normal mammary epithelial cells nor in the majority of adult mouse tissues (10, 11, 12, 13, 14) . The principal sites of expression occur in the developing embryo, where a complex series of transcripts can be detected as early as 6.5 days (13 , 15) . Expression is maintained until parturition but occurs at highly restricted sites and times. From these patterns of expression and the biochemical properties of the FGF family, it has generally been assumed that FGF3 acts as a cell-to-cell signalling molecule. However, the function of the mouse FGF3 protein has proved difficult to address because its expression and release from cells appears to be tightly regulated at the transcriptional (16, 17, 18) , translational (19 , 20) , and posttranslational levels (21, 22, 23, 24) .

A recent study on the Xenopus homologue of FGF3 has shown that XFGF3 is more efficiently secreted and a more potent mitogen than its mouse counterpart (25) . The Xenopus ligand is also more widely expressed and can interact with a broader range of high-affinity transmembrane tyrosine kinase receptors than the mouse protein. Four high-affinity receptors genes have been identified thus far in mammals (FGFR1, FGFR2, FGFR3 and FGFR4) and analogous receptor genes have been isolated from amphibians (Ref. 7 ; reviewed in Ref. 26 ). Although these receptors share the same basic structure, comprising an extracellular ligand-binding domain with two or three immunoglobulin-like motifs, a short transmembrane domain and a highly conserved tyrosine kinase element, each receptor gene can specify a variety of different forms through differential splicing and processing. Although the function of many of these FGFR variants is not yet understood, isoforms of FGFR 1, 2, and 3 that differ in the second half of the third immunoglobulin loop (designated IIIb and IIIc) exhibit distinct ligand-binding specifities (27, 28, 29, 30, 31) . XFGF3 binds with high affinity to both isoforms of mouse and Xenopus FGFR2, whereas mouse FGF3 only interacts with the IIIb isoform of FGFR2 and weakly with the IIIb isoform of FGFR1 (32 , 33) .

This species difference could reflect the additional 18-amino acid segment in the Xenopus ligand not present in the mammalian FGF3 proteins, or the fact that XFGF3 undergoes posttranslational processing. To investigate these possibilities and the significance of NH2-terminal processing for the biological activity of XFGF3, we generated mutant versions that are resistant to proteolytic cleavage, as well as epitope tagged forms that enabled us to determine whether processing was occurring in intracellular or extracellular compartments. The nonprocessed forms of XFGF3 exhibit a much lower affinity for the Xenopus FGF receptors and have lower transforming and mitogenic activity on mouse cell lines than the mature, fully processed protein. To our knowledge, this is the first report of enhanced biological activity of an FGF as a consequence of naturally occurring, proteolytic cleavage.

Results

Two Distinct FGF3 Alleles Are Present in the Xenopus Genome.
The mouse Fgf-3 gene has the capacity to encode two primary translation products: a Mr 28,000 product initiating at a conventional AUG codon and a Mr 31,000 product initiating at an upstream CUG (20 , 23) . The CUG codon appears to be the primary initiation start site of mouse FGF3, producing a form of the protein that partitions between the secretory pathway and the cell nucleus, whereas the AUG-initiated form is directed to the secretory pathway via a typical signal peptide (20 , 23 , 34) . In an attempt to determine whether these unusual features of mouse FGF3 are evolutionarily conserved, we have isolated and characterized FGF3-related cDNA clones from Xenopus laevis. A 290-bp genomic DNA fragment, encompassing the second exon of mouse Fgf-3, was used to screen a {lambda}gt10 cDNA library prepared from Xenopus RNA at embryonic stage 17. From a total of 3 x 105 recombinant phages hybridized under low stringency conditions, three positive clones were recovered after plaque purification (designated {lambda}B, {lambda}C, and {lambda}L). When the same library was subsequently screened with probes derived from these cDNA clones, one additional phage was recovered (designated {lambda}17). Although {lambda}17 and {lambda}C represent the same sequence in their region of overlap, the 5' EcoRI fragment recovered in {lambda}B differed at 10 residues relative to {lambda}17. As indicated in Fig. 1aCitation , three of these differences change the predicted amino acid sequence.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. a, nucleotide sequence of Xfgf3 cDNA. The 725-bp 5' EcoRI fragment of {lambda}17 is shown with national translation of the open reading frame in single-letter amino acid code. The in-frame termination codons in the 5' untranslated region are boxed, and the internal EcoRI and the 5' EcoRI cloning sites are underlined. Single nucleotides and amino acids in boldface identify differences noted in the 5' fragment from {lambda}B and in the PCR products from genomic Xenopus DNA. Arrowed lines, oligonucleotide primers used for the PCR analyses. b, conservation of amino acid sequences in Xenopus, Zebrafish, and mouse FGF3. The predicted amino acid sequences of FGF3 from X. laevis (Xl), based on {lambda}17, Zebrafish (Br), and Mus musculus (Mm) are aligned in single-letter code with identity between the sequences indicated by shading. The NH2 termini of the gp31 and gp27 XFGF3 products, as described in the text, are indicated by the downward arrows. The region spanned by double arrows is the so-called "bridge" domain. Regions set in parentheses delineate the peptides recognized by the monoclonal antibody MSD-1 and the XFGF3-specific COOH-terminal polyclonal serum {alpha}X3.

 
Notional translation of {lambda}17 revealed an open reading frame for a 237-amino acid product, initiating at nucleotide 304 and terminating at 1015. The presumed AUG initiation codon is in a reasonably favorable context according to the consensus for the ribosome scanning model (35) but is preceded by an AUG codon in the +1 reading frame (Fig. 1a)Citation . In this respect, the situation is analogous to that in the mouse, human, and zebrafish FGF3 genes and suggests that translation of XFGF3 is tightly regulated (19 , 24 , 25 , 36) . However, there is no possibility that the Xenopus gene can encode an NH2-terminally extended form of FGF3 initiated from a CUG because there are numerous in-frame stop codons within the 150 nucleotides upstream of the AUG (Fig. 1aCitation ; Ref. 25 ).

The predicted XFGF3 product can be readily aligned with the sequence of mouse and Zebrafish FGF3 (Fig. 1b)Citation with 81 and 82% identity, respectively, over the central region of 170 amino acids (residues 42 to 212), and the similarity is >90%, allowing for substitution of chemically similar amino acids. The "bridge" region between the two blocks of homology, which varies in different FGFs (reviewed in Ref. 3 ), is characteristic for FGF3 (Fig. 1bCitation , arrows). However, it is the length rather than the sequence of this bridge region that appears to be critical, because the mouse, Zebrafish, and Xenopus forms of FGF3 show considerable variations in sequence across this part of the molecule (Fig. 1b)Citation . The three sequences also diverge completely at the COOH terminus, downstream of residue 212 in the Xenopus protein (Fig. 1b)Citation .

The most striking difference between the Xenopus and Zebrafish FGF3 proteins on the one hand and the mouse and human proteins on the other is the insertion of 18 amino acids immediately after the signal peptide cleavage site (Fig. 1b)Citation . The presence of this additional domain raised the possibility that it is encoded by a separate exon that has been lost from or never acquired by the mammalian FGF3 genes. Alternatively, it remained possible that the cDNAs recovered from the embryonic stage 17 library represented only one of the two genome equivalents in pseudo-tetraploid Xenopus cells (37 , 38) and that a direct equivalent of the mammalian proteins could be encoded by the other allele. To address this issue, two oligonucleotide primers based on sequences in the 5' untranslated region of the {lambda}17 cDNA were used in conjunction with a reverse primer in the conserved coding region to amplify the intervening sequences in Xenopus genomic DNA by PCR. The resultant products, 480 and 230 bp, respectively, indicated that the {lambda}17 and genomic DNA are colinear in this region and that the additional 18 amino acids in Xenopus FGF3 are not encoded by a separate exon. As further confirmation, the PCR products were cloned into plasmid vectors, and representative clones were sequenced in each case. Of the two 480-bp clones sequenced, one was identical to {lambda}17, whereas the second was identical to {lambda}B. The two 230-bp clones also corresponded to {lambda}B. Because one of the base changes in {lambda}B (a C-to-T transition) destroys a BamHI site just downstream of the start of translation, an additional 10 clones were tested for the presence of this BamHI site. Of these, two had retained the site, whereas eight had lost the site. Because these clones were derived from genomic DNA, they presumably reflect different alleles of the gene.

Detection of XFGF3 in the Secretory Pathway and Extracellular Matrix.
As reported previously, biosynthesis of XFGF3 proceeds via signal peptide cleavage at A21, glycosylation at N83, and a second proteolytic cleavage at R45. As a result, two glycosylated products, gp31 and gp27, accumulate in the ECM and can be displaced into the medium by addition of soluble heparin (25) . Alternatively, heparin may stabilize the growth factor in the supernatant. These findings are recapitulated in Fig. 2aCitation , which compares the steady-state levels of the different XFGF3-related proteins in cell extracts, medium, and ECM from COS-1 cells transfected with the expression plasmid Xfgf3.1. This plasmid, in which expression is driven by the SV40 early promoter, contains the full coding domain of XFGF3 optimized for efficient translation as described previously (25) . Xfgf3.1 was introduced into COS-1 cells by electroporation, and total cell extracts, ECM, and conditioned medium were fractionated by SDS-PAGE, transferred onto nitrocellulose membranes, and probed with the MSD-1 monoclonal antibody (see Fig. 1bCitation for the epitope recognized by this antibody). Note that both forms of the protein are secreted into the ECM and can be released into the medium upon the addition of soluble heparin and that most of the smaller cell-associated protein is displaced by heparin, suggesting that it is already bound on the cell surface.



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 2. a, secretion and ECM association of XFGF3. COS-1 cells transfected with Xfgf3.1 or with the control vector pKC3 were removed from the dish with 0.5% Triton X-100 and processed separately from the ECM, which remains on the surface of the dish. Samples of the cell extracts (equivalent to 1 x 104 cells), ECM (equivalent to 3 x 104 cells), and the culture medium (equivalent to 3 x 104 cells) were fractionated on SDS-PAGE and immunoblotted with the monoclonal MSD-1 antibody. The immune complexes were visualized by ECL (Amersham) using a specific antimouse secondary antibody. The size of the XFGF3-related proteins gp31 and gp27 were estimated relative to standards. The + and - indicate whether the cells were grown in the presence or absence of 5 µg/ml heparin. b, intracellular localization of XFGF3 by immunofluorescence microscopy. COS-1 cells transfected with pKC3, Xfgf3.1, and pKC3.2 (encoding mouse FGF3 optimized for AUG initiation) were grown on coverslips for 48 h and fixed in 4% paraformaldehyde. The coverslips were then stained with a rabbit polyclonal antibody {alpha}X3 against XFGF3 or with a rabbit polyclonal antibody against mouse FGF3. The immune complexes were visualized using goat antirabbit immunoglobulin-tagged with Texas red. In the lower panel, the stained cells were examined by confocal microscopy with appropriate filters.

 
When COS-1 cells expressing Xfgf3.1 were analyzed by immunofluorescence, using a polyclonal rabbit antiserum {alpha}X3 raised against the COOH terminal peptide of XFGF3, the staining pattern was predominantly reticular with a superimposed juxtanuclear staining, typical of a secreted protein (39) , with most of the signal concentrated in the endoplasmic reticulum. A similar staining pattern was obtained with the MSD-1 antibody, using confocal microscopy (Fig. 2b)Citation . Significantly, the confocal images were clearly different from those observed with the secreted form of mouse FGF3 (expressed from the pKC3.2 plasmid), which has been shown previously to accumulate in the Golgi complex of transfected COS-1 cells (Fig. 2bCitation ; Ref. 22 ).

NH2- and COOH-Terminal Processing of XFGF3.
We established previously that the smaller form of XFGF3, gp27, is generated by cleavage at R45 that occurs within an RQRR motif, typical of processing sites in protein precursors (40) . To enable us to detect any further processing, for example at the COOH terminus, and to identify where in the cell gp27 is generated, we constructed a version of the XFGF3 cDNA, designated Xfgf3.6, in which a FLAG epitope (DYKDDDDK) was introduced immediately distal to the cleavage site (Fig. 3)Citation . This strategy has been successfully applied to other processed proteins (41) . Cleavage at the RQRR motif will create an NH2-terminal FLAG epitope. The monoclonal antibody M1 selectively recognizes the FLAG tag as a free NH2-terminal epitope and will therefore specifically detect tagged XFGF3 that has been cleaved at R45. In addition, a sequence encoding an epitope of human MYC was appended to the COOH terminus, allowing detection of the XFGF3 cleavage products with the monoclonal antibody 9E10 (42) . COS-1 cells were transiently transfected with Xfgf3.6 or the pKC3 vector control and grown in the presence of heparin. The FLAG- and MYC-tagged XFGF3 products were analyzed by immunoblotting and immunofluorescence microscopy.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. FLAG epitope- and MYC epitope-tagged XFGF3. COS-1 cells transfected with Xfgf3.6 or the vector pKC3 were harvested after 48 h, and the culture fluid was recovered. Samples of cell extracts and culture medium were fractionated by SDS-PAGE and immunoblotted with different antibodies recognizing the free NH2-terminal FLAG epitope (M1), the MYC epitope (9E10), the COOH-terminal peptide of XFGF3 ({alpha}X3), or an FGF3-specific epitope (MSD-1). The immune complexes were detected with species-specific antibodies and ECL.

 
As expected, the size of the detected proteins had been increased about the molecular weight of the incorporated FLAG and MYC epitopes. The FGF3-specific antibodies, MSD-1 and {alpha}X3, detected three major products of Mr 34,000, Mr 32,500, and Mr 29,500 in the conditioned medium from Xfgf3.6-transfected cells (Fig. 3)Citation . A minor Mr 31,000 band was also faintly visible with MSD-I, just below the major Mr 32,500 product. Because the Mr 34,000 form was also recognized by 9E10, but not by M1, it presumably corresponds to the glycosylated form of XFGF3 after signal peptide cleavage (i.e., gp31 plus the extra residues from the epitope tags). Surprisingly, the smaller Mr 32,500 form was not detected with either 9E10 or M1, suggesting that it had lost the COOH-terminal MYC tag but had not undergone NH2-terminal cleavage at R45. Both the minor Mr 31,000 form and the more prominent Mr 29,500 product were detected by the M1 FLAG antibody, indicating that they had been NH2-terminally processed. Because the Mr 31,000 form was also visible with 9E10, it most likely corresponds to a product that has been cleaved at R45 but has not undergone the COOH-terminal cleavage to remove the MYC epitope. In line with this interpretation, the fully processed Mr 29,500 product was not detected with 9E10. Interestingly, another RQRR motif occurs very close to the COOH terminus of XFGF3 (see Fig. 1bCitation ) and would be a likely target for the additional processing observed in this experiment. Cleavage at R235 would remove two amino acid residues from the COOH terminus of XFGF3, and this would explain why the gp27 form of protein often appears as a doublet in SDS-PAGE. Although these two residues are included in the peptide used to generate the {alpha}X3 polyclonal antiserum, the fully processed form of the protein is still recognized by this antiserum (Fig. 3)Citation .

Processing of XFGF3 Occurs in the Secretory Pathway and Extracellular Space.
The distribution of gp27 among cells, ECM, and medium (see Fig. 2aCitation ) suggested that it may be generated primarily in the extracellular space. However, data obtained with the epitope-tagged versions of XFGF3 indicated that at least some of the mature form could be detected in the cell extract (not shown). To assess the steady-state distribution of the various processed forms of XFGF3, COS-1 cells were transfected with Xfgf3.6 and grown in the presence of heparin to displace protein from the cell surface. The cells were then fixed and permeabilized for immunofluorescence microscopy (Fig. 4,a and b)Citation . Under these conditions, the staining patterns obtained with M1 and {alpha}X3 were quite similar, showing prominent reticular and paranuclear staining. The specificity of the signal was confirmed using cells transfected with the empty vector (not shown). In the presence of heparin to displace protein from the cell surface, the lack of immunofluorescence with M1 or {alpha}X3 if the cells were not permeabilized prior to staining indicates that the substantial signal detected with the M1 antibody after permeabilization of the cells was in fact attributable to intracellular localized (Fig. 4, c and d)Citation . Thus, the staining pattern of the processed forms of XFGF3, cleaved at R45, is consistent with their localization in the Golgi compartment.



View larger version (133K):
[in this window]
[in a new window]
 
Fig. 4. Intracellular detection of the NH2-terminally processed forms of XFGF3 by immunofluorescence microscopy. Xfgf3.6 was introduced into COS-1 cells by electroporation. The cells grew in the presence of heparin, and 48 h later, the subcellular distribution of the epitope-tagged XFGF3 products were analyzed by immunofluorescence. The upper panels (a and b) were stained with {alpha}X3, and the lower panels (c and d) were stained with M1. In a and c, the cells were permeabilized prior to staining, whereas in b and d, the cells were fixed but not permeabilized.

 
However, because the Mr 34,000 and Mr 32,500 forms of tagged XFGF3 are prominent in the ECM, some of the nonprocessed growth factor must also be secreted into the extracellular space. In the absence of heparin, only a fraction of the total XFGF3 is freely soluble in the medium, and most of the extracellular protein is bound to the ECM or to heparin sulfate proteoglycans on the cell surface. Although the unprocessed form (gp31) normally predominates in the ECM (see Fig. 2Citation ), displacement with soluble heparin causes a dramatic increase in the proportion of the mature form (gp27), suggesting that processing of XFGF3 can occur also in the extracellular compartment.

Processing of XFGF3 by Plasmin.
Cleavage at the RQRR motif would be consistent with processing by members of the PC family, some of which are resident in the trans-Golgi network, or by extracellular trypsin-like proteases such as plasmin. To test this latter possibility, we asked whether exogenous plasminogen (as a source of active plasmin) could promote the processing of XFGF3 in conditioned medium. Xfgf3.1-transfected cell extracts, which were used as a source of nonprocessed gp31, and cell supernatants, as a source of gp27, were mixed with conditioned medium containing 0.1% FCS and 5 µg/ml heparin, from COS-1 cells transfected with the empty vector. Increasing concentrations of plasminogen were then added, and after a 60-min incubation, the protein samples were analyzed by SDS-PAGE and immunoblotting. As shown in Fig. 5Citation , addition of 0.1 unit/ml of plasminogen was enough to convert gp31 protein into gp27. No residual gp31 persisted at higher concentrations of plasminogen. Because the COOH terminus of XFGF3 contains several potential plasmin cleavage sites within and NH2-terminal of the {alpha}X3 recognition motif (see Fig. 1bCitation ), cleavage at such sites would result in loss of the immunoreactivity of the truncated forms. However, under these conditions, the secreted gp27 was remarkably resistant to plasminogen digestion (Fig. 5)Citation . These data confirmed that gp27 is a derivative of gp31 and is the more stable form in tissue culture fluid.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5. NH2-terminal cleavage of XFGF3 by plasminogen. Samples of cell extracts and conditioned medium from COS-1 cells transfected with Xfgf3.1 were incubated with increasing concentrations of human plasminogen. The samples were then fractionated by SDS-PAGE and immunoblotted with the polyclonal antiserum {alpha}X3, and the immune complexes were detected with 125I-labeled protein A.

 
Transforming Potential and Mitogenic Activity of the XFGF3 Isoforms.
Because limited endoproteolysis of polypeptide precursors can be used to generate functional diversity, we wanted to determine whether NH2-terminal processing of XFGF3 influenced its biological activity. Two mutant versions of Xfgf3 cDNA were generated in which the RQRR/D motif was changed to RQRKD (designated Xfgf3.7) or to RQGLE (designated Xfgf3.8). Given the preference for R in the common cleavage motif RQRR motif by some members of the PC family (40) , these changes were expected to reduce or prevent intracellular processing of gp31 at R45 (Fig. 6)Citation . To assess the influence of the sequence between the signal peptide and the second cleavage motif, a deletion mutant of this region was introduced into the Xfgf3.1 vector to generate plasmid Xfgf3.9. Thus, COS-1 cells transfected with Xfgf3.7 or Xfgf3.8 contained gp31, plus a trace of the smaller form that presumably reflects cleavage at R235. In the absence of heparin, there was no evidence for an NH2-terminally processed form of XFGF3 in either the cell extracts or the medium (Fig. 6a)Citation . The medium from Xfgf3.7-transfected cells was therefore used to test the biological activity of unprocessed XFGF3. However, in presence of heparin, NH2-terminally processed products were detected in the conditioned medium from cells expressing both Xfgf3.7 and Xfgf3.8 (Fig. 6b)Citation . Because these forms were not observed in the cell extracts, they presumably arose by extracellular cleavage of the already secreted proteins and may be attributable to conformational changes induced by heparin, favoring the cleavage by proteases at this specific site. The mutations would not have prevented cleavage by trypsin-like activities in the medium.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 6. Expression and secretion of Xenopus proteins mutated at the NH2terminal processing site. Three mutant forms of XFGF3 were generated by introducing point mutations into the presumed cleavage motif RQRR RQRR and by deleting most of the NH2-terminal sequence preceding the RQRR motif. a, the relevant part of the NH2-terminal amino acid sequence of the mutant proteins are depicted compared with the wild-type sequence. COS-1 cells were transfected with the four recombinant plasmids and grown for 48 h in DMEM containing 0.1% calf serum. The cell extracts and the conditioned medium were recovered, and equivalent samples were fractionated by SDS-PAGE and immunoblotted with MSD-1. b, in the presence of heparin, substantial gp27related forms could be detected in the medium from Xfgf3.7- and Xfgf3.8-transfected COS-1 cells.

 
The conditioned media from Xfgf3.1- and Xfgf3.7-transfected COS-1 cells, containing equivalent amounts of XFGF3-related products as judged by immunoblotting, were tested for their ability to cause transient morphological transformation of NIH3T3 cells, as reported previously (25) . Whereas a 1:5 dilution of the Xfgf3.1 conditioned medium produced visible transformation within 24 h, the Xfgf3.7 conditioned medium was inactive in this assay (Fig. 7a)Citation , even when used undiluted (not shown). The same was true for the Xfgf3.8 conditioned medium (Fig. 7a)Citation . In contrast, the deletion mutant where most of the part between the signal peptide cleavage site and the RQRR motif were deleted was highly transforming on NIH3T3 cells (Fig. 7a)Citation .



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 7. Modulation of XFGF3 activity by mutation of the NH2-terminal cleavage site. a, samples of the conditioned medium from COS-1 cells transfected with Xfgf3.1, Xfgf3.7, Xfgf3.8, Xfgf3.9, and pKC3 vector were diluted 1:5 with DMEM containing 10% FCS serum and placed on near-confluent NIH3T3 cells. The cells were stained 24 h later with Giemsa and photographed. b and c, samples of the conditioned medium from the transfected COS-1 cells were also tested for their mitogenic activity on quiescent HC11 cells (b) and C57MG cells (c) as described in "Materials and Methods." Ten µl (left striped columns), 50 µl (stippled columns), or 100 µl (right striped columns) of the culture medium were added in a total of 250 µl of DMEM containing 0.1% calf serum. The mean value of at least triplicate determinations is shown; bars, SD.

 
As a further functional comparison, we tested samples of conditioned medium for their ability to stimulate thymidine incorporation in quiescent C57MG cells and HC11 cells. Whereas NIH3T3 cells express the IIIc isoforms of mouse FGFR1 and FGFR2, HC11 cells are known to express the IIIb isoforms of FGFR 1, 2, and 3, and C57MG cells express the IIIc isoforms of these receptors (32 , 33) . Both the Xfgf3.1- and Xfgf3.7-conditioned media were highly mitogenic on HC11 cells (Fig. 7b)Citation , but there was a marked difference in their activity on C57MG cells (Fig. 7c)Citation . Although the medium from Xfgf3.1-transfected COS-1 cells caused a dose-dependent increase in [3H]thymidine incorporation in quiescent C57MG cells (Fig. 7c)Citation , the Xfgf3.7-conditioned medium achieved <10% of the maximal incorporation observed with the wild-type protein. However, medium from COS-1 cells transfected with the deletion mutant Xfgf3.9 were highly mitogenic on both cell lines. Taken together, these data imply that the unprocessed form of XFGF3 might be impaired in its ability to interact with the receptor isoforms expressed on C57MG cells.

Receptor Binding Analysis on COS-1 Cells Expressing Xenopus FGF Receptors.
To further explore receptor binding, we used the Xfgf3.1, Xfgf3.7, and Xfgf3.9 conditioned media to purify the respective cleaved and uncleaved forms of XFGF3 on heparin-Sepharose. The proteins were eluted using a discontinuous NaCl gradient, and fractions containing the XFGF3-related proteins were identified by immunoblotting. The relative amounts of XFGF3 in the recovered fractions were determined by immunoblotting of serially diluted samples, and equivalent amounts were then tested for their ability to bind to different Xenopus FGFR isoforms. COS-1 cells were transfected with pKC3-based expression vectors encoding XFGFR1 (IIIc{alpha}), XFGFR2 (IIIbß), and XFGFR2(IIIcß). Because FGF1 binds with high affinity to all known FGFRs a competition assay was established in which the different ligands were used to compete with 125I-labeled FGF1 for binding to each receptor isoform (32 , 33 , 43) . Thus, COS-1 cells expressing the different FGFRs and the vector-only control were incubated with 125I-labeled FGF1 in the presence or absence of the different forms of purified XFGF3 or with unlabeled FGF1 as competitor. After covalent cross-linking, the labeled receptor-ligand complexes were fractionated by SDS-PAGE and detected by autoradiography (Fig. 8a)Citation . In the absence of competitor, appropriate bands were detected corresponding to the two immunoglobulin loop, IIIb and IIIc isoforms of XFGFR2 at Mr 170,000 and to the three immunoglobulin loop form of XFGFR1 at Mr 150,000. In the presence of unlabeled FGF1, there was no detectable binding of 125I-labeled FGF1 to any of the receptors. Although mature XFGF3, purified from Xfgf3.1-transfected cells, competed for binding to all three receptor isoforms, the uncleaved form of XFGF3 recovered from Xfgf3.7-transfected cells was clearly less effective in this assay.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 8. a, competition between 125I-labeled FGF1 and XFGF-related proteins for binding to Xenopus FGF receptors. COS-1 cells expressing the XFGFR1(IIIc), XFGFR2(IIIb), or XFGFR2(IIIc), as indicated, were incubated with 125I-labeled FGF1 in the absence or the presence of a 10-fold excess of unlabeled XFGF3 or mutant XFGF3 proteins. The reporter/ligand complexes were cross-linked and analyzed by SDS-PAGE, as described in "Materials and Methods." b, competition of 125I-labeled FGF1 binding by XFGF3 and mutant XFGF3. COS-1 cells expressing XFGFR1(IIIc) or the IIIb and IIIc isoforms of Xenopus FGFR2 were incubated with 125Ilabeled FGF1 in the presence of increasing concentrations of XFGF3-related proteins. Cells were then washed and lysed, and specific binding was determined as described previously (32 , 43) . The mean values of duplicate determinations is shown; bars, SD. The inset shows the competition of 125I-labeled FGF1 binding to the Xenopus FGF receptors by cold FGF1 as competitor.

 
To extend these findings, the competition assays were performed with increasing concentrations of the partially purified forms XFGF3. Half-maximal competition was achieved with 9 ng/ml (ID50, 0.5 nM) of the mature XFGF3 on both the XFGFR2 isoforms, whereas 20 ng/ml (ID50, 1.0 nM) were required for XFGFR1(IIIc). In comparison, half-maximal competition was obtained with 7 ng/ml (ID50, 0.4 nM) of the NH2-terminal deletion form XFGF3.9 on both FGFR2 isoforms and approximately four times more of the uncleaved protein from Xfgf3.7 (ID50 FGFR2IIIb, 1.4 nM; ID50 FGFR2IIIc, 2.0 nM) transfected cells had to be used to achieve a similar degree of competition (Fig. 9b)Citation .



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 9. a, secreted mouse FGF3 is also NH2-terminally processed. The structure of pKC3.2 and pKC4.12{nabla}15 is shown schematically to indicate the six amino acids separating the signal peptide and the RLRR motif and the position of the space sequence in pKC4.12{nabla}15. b, the different plasmids were introduced into COS-1 cells by electroporation. Samples of the cell extracts and conditioned medium were fractionated by SDS-PAGE and immunoblotted with the polyclonal antimouse FGF3-specific antibody (upper panel). Secreted mouse FGF3-related products from pKC3.2- and pKC4.12{nabla}15-transfected COS-1 cells were immunoprecipitated, and the immune complexes were digested with N-glycanase (N-gly) plus neuraminidase (Neu). The digested products were then separated by SDS-PAGE and detected by immunoblotting with a FGF3 specific COOH-terminal antipeptide serum (lower panel).

 
NH2-Terminal Trimming of Mouse FGF3 at a Conserved Sequence Motif.
Interestingly, the NH2-terminus of mouse FGF3 contains a very similar cleavage motif as identified in Xenopus FGF3. The motif RLRR is part of a bipartite nuclear signal sequence that is necessary for a balanced targeting of FGF3 into the secretion pathway as well the nucleus. The subcellular fate of mouse FGF3 is determined by a NH2-terminal sequence preceding an internal signal peptide necessary for secretion and a close to the signal peptide cleavage site, identified by NH2-terminal sequencing-located bipartite motif. COS-1 cells were transfected with the plasmid pKC3.2 designed for translation start at the signal peptide and for generation of exclusively secreted products. Three intracellular isoforms of FGF3 have been identified; two major glycosylated species of Mr 31,500 and Mr 30,500 (gp31.5 and gp30.5) and one much less abundant nonglycosylated form Mr 28,500 (Fig. 9)Citation . The higher molecular weight species of the glycosylated forms and the nonglycosylated protein were shown previously to still retain the signal peptide, suggesting that the signal peptide cleavage of FGF3 is less efficient. Similar different intracellular forms resulting from glycosylated FGF3 forms before and after signal peptide cleavage can be detected with plasmids containing the wild-type cDNA encoding the CUG initiated NH2-terminally extended form. However, only a single form of FGF3 (gp32.5), which is endopeptidase H resistant, is secreted. Because in their normal context the signal peptide cleavage site and the RLRR motif are separated by only six residues and FGF3 undergoes further carbohydrate modification in the secretion pathway, it is difficult to demonstrate cleavage at the RLRR by comparing the molecular size of the secreted form. Therefore, to be able to confirm a NH2-terminal trimming of the mouse FGF3, we used a mutant cDNA with a spacer of 15 amino acids of random structure between the two cleavage signals. The insertion had the effect that all of the FGF3 protein is targeted into the secretion pathway (23) . COS-1 cells were transfected with pKC3.2 and pKC4.12{nabla}15. Cell extracts and supernatant of the transfected cells were analyzed by SDS-PAGE and immunoblotting using a specific COOH-terminal antipeptide serum against mouse FGF3. No FGF3-related proteins were detected in cells transfected with the vector alone, whereas the pKC3.2 vector generated the expected major FGF3 products. With the vector containing the mutant cDNA, the predominant intracellular products were about Mr 32,000–33,000, as expected for the nonglycosylated and noncleaved form and the glycosylated form after signal peptide cleavage. Small amounts of Mr 35,000 and Mr 30,000 species were also observed, which we interpret as the noncleaved glycosylated form and the cleaved but not gylcosylated form of FGF3{nabla}15. Analysis of the medium revealed that with both plasmids, only a product of the same size was present in the supernatant. Because the antibody was directed against the COOH-terminal 15 amino acids, this result suggests that the secreted product of FGF3{nabla}15 must have undergone additional processing at its NH2-terminus. To show that the protein backbone of both secreted FGF3 forms have the same size, FGF3 products were therefore recovered from pKC3.2- and pKC412{nabla}15-transfected COS-1 cell conditioned medium by immunoprecipitation with the mouse FGF3-specific polyclonal serum and treated with neurominidase and N-glycanase to remove the carbohydrate. The products were then fractionated by SDS-PAGE and detected by immunoblotting. Digestion with the glycosidases reduced the size of the secreted products to exactly the same size, confirming the NH2-terminal trimming of 4.12{nabla}15 (Fig. 9)Citation .

Discussion

We previously described the isolation and characterization of cDNAs encoding the Xenopus homologue of FGF3, but there were several unresolved issues relating the pseudotetraploid nature of the Xenopus genome (37) . In X. laevis embryos, two major transcripts can be detected from the early gastrula stage onward (44) . These RNAs could be generated from a single gene by differential promoter usage and polyadenylation, as documented for the mouse Fgf-3 gene (11 , 12 , 16) or represent transcripts from separate genes. Given the relatively low abundance of these RNAs in stage 17 embryos (44) , only four independent cDNAs were identified in the original library screen and because none of them contained a polyadenylation site, it was not possible to relate them to different transcripts. However, DNA sequencing and PCR analysis of genomic DNA clearly indicate that the cDNAs represent separate alleles (see Fig. 1Citation ).

In view of this, it became important to establish whether either of the alleles was capable of encoding XFGF3 isoforms more closely resembling the mouse counterpart. Mouse Fgf-3 encodes two primary translation products that initiate either at a CUG codon or at a downstream, conventional AUG codon (20 , 23) . The sequence of human FGF3 predicts a similar situation (36) . Whereas the AUG-initiated form of mouse FGF3 is exclusively directed into the secretory pathway, the fate of the CUG-initiated form is determined by competition between signals for nuclear localization and secretion (23 , 34) . Overexpression of the nuclear form inhibits cell proliferation and leads to a G1-phase cell cycle arrest (45) , whereas secreted FGF3 is mitogenic for cells expressing the appropriate receptors (21 , 33) . Significantly, none of the Xenopus cDNAs characterized here encoded an NH2-terminally extended form of the protein because the presumed AUG initiation codon is preceded by multiple in-frame termination codons (Fig. 1a)Citation . A similar situation prevails in Zebrafish FGF3, suggesting that the nuclear form of mouse FGF3 evolved after the divergence of mammals and lower vertebrates (43) . However, the Zebrafish gene and both of the Xenopus alleles specify an additional segment of 18 amino acids that are not present in mouse and human FGF3.

Because the Xenopus homologue of FGF3 is more widely expressed and can interact with a broader range of receptors than its mammalian counterparts (15 , 25 , 32 , 44 , 46) , it is interesting to consider whether mechanisms for generating biological diversity from a single ligand, such as endoproteolytic cleavage, have been supplanted during evolution by the creation of separate genes with more specialized roles. In this study, we provide unequivocal evidence that XFGF3 is subject to NH2- and COOH-terminal cleavage that is reminiscent of the processing of active proteins from their inactive or less active precursors. Thus, the cleavage occurs after arginine residues that conform to the general consensus (R/K)-Xn-(R/K). Such sites can be found in the precursors of a variety of proteins, including polypeptide hormones (e.g., prorenin, proinsulin, and pro-parathyroid hormone), growth factors (e.g., BMP-4, pro-TGFß, pro-NGF, and pro-neurotensin 3), and growth factor receptors (e.g., insulin receptor; Refs. 40 and 47 ). Using a FLAG-tagged mutant of XFGF3, where the recognition epitope is directly after the presumed RQRR cleavage motif, we demonstrated the existence of intracellular forms of XFGF3 that were detectable with the M1 monoclonal antibody, which only recognizes the FLAG epitope as a free NH2 terminus.

By analogy to other processed proteins, intracellular cleavage of XFGF3 is likely to occur in the Golgi, and the FLAG-tagged version of gp27 is clearly detectable in this compartment (Fig. 5)Citation . In mammalian cells, a number of serine proteases have been identified, termed PCs, that are related to the yeast protein kexin and cleave precursors adjacent to pairs of basic residues (48 , 49) . Whereas PC1 and PC2 recognize simple pairs of basic residues, others, such as furin and PC7 which reside in the trans-Golgi network of most cell types, prefer to cleave after the general motif (R)-X-(R/K)-R (40 , 50) . These or related enzymes are therefore strong candidates for the intracellular processing of XFGF3, which occurs adjacent to NH2- and COOH-terminal RQRR motifs.

Despite clear evidence for intracellular processing of XFGF3, a considerable amount of the uncleaved gp31 protein is exported into the extracellular space (Figs. 2Citation and 5)Citation . Although this form can persist in the ECM, displacement into the medium after addition of soluble heparin results in efficient processing to gp27. Using plasminogen as a source of active plasmin (51) , we were able to formally demonstrate the precursor-product relationship of gp31 and gp27. Plasmin exhibits a broad trypsin-like substrate specifity and degrades several ECM components such as fibronectin, laminin, and the protein core of proteoglycans (52) . It has also been shown to play a major role in the mobilization of FGFs from ECM, and cleavage of the gp31 isoform of XFGF3 may be part of this release process (53) . Alternatively, because plasmin activates secreted latent TGF-ß1, we considered the possibility that the conversion of the secreted gp31 to gp27 might potentiate its biological activity.

By altering the RQRR motif, we produced mutant forms of XFGF3 that did not undergo intracellular cleavage, and by growing cells in the absence of heparin, were able to obtain conditioned medium containing the uncleaved protein. This form of XFGF3 proved significantly less active than mature gp27 in its ability to induce morphological transformation of NIH3T3 cells and in its mitogenic activity on quiescent C57MG cells but did not appear to be functionally compromised when tested on HC11 cells. This presumably reflects the different receptor isoforms expressed by different cells types because C57MG cells express predominantly the FGFR1 IIIc receptor isoform, whereas HC11 express mainly the IIIb isoform of FGFR2 (31 , 33 , 54 , 55) . Recent studies have shown that although mouse, Zebrafish, and Xenopus FGF3 show the same high affinity for FGFR2(IIIb), Xenopus FGF3 also binds with high affinity to FGFR2(IIIc) and with substantially lower affinity to the FGFR1(IIIc) isoform (32) . By comparison to the wild-type protein, the unprocessed form of XFGF3 encoded by Xfgf3.7 had a reduced affinity for all Xenopus FGFR variants tested.

Therefore, the lower mitogenic activity on C57MG cells and lack of transforming activity on NIH3T3 cells could be explained by a threshold effect rather than a distinct receptor specificity for the unprocessed form. Interestingly, proteolytic processing of the TGF-ß precursor at a similar motif R-H-R-R as those found in the Xenopus FGF3 protein resulted in a 5-fold increase in its biological activity (56) . Furthermore, blocking the proteolytical activation of BMP-4 a member of the TGF-ß family during early Xenopus embryonic development phenocopies the lost of BMP-4 activity (47) . It was reported recently that NH2-terminal truncation of FGF4, which removes the single N-linked glycosylation site, caused a marked increase in receptor binding activity (57) . The authors argued that the NH2-terminal region of FGF4 may have a flexible and disordered structure, as suggested by the analysis of the three-dimensional structure of FGF1 and FGF2, and that removal of the NH2-terminus results in a more organized form contributing to the stability of the ligand-receptor interaction (57) . Significantly, the NH2-terminal trimming of Xenopus and mouse FGF3 removes in each case a putative turn-coiled structure, supporting this interpretation. Therefore, regulation of precursors by proteolytic processing appears to be not a matter of switching from an inactive form to an active form rather than from a less active to a more active growth factor isoform. During evolution, the reason for the NH2-terminal processing may have changed. Whereas in Xenopus isoforms of FGF3 with different affinities or stability may be necessary because of a restricted set of different FGFs, in mammals FGF3 had gained a new function as a nuclear signalling factor via a sophisticated NH2-terminal architecture of nuclear and secretion pathway targeting motifs that made necessary an NH2-terminal trimming of the secreted form.

Taken together, as we have demonstrated previously for mouse, Zebrafish, and Xenopus FGF3 that their COOHterminal domain governs the receptor specificity (24 , 25) , here, we provide the first evidence that the NH2-terminal processing appears to be essential for high receptor binding affinity.

Materials and Methods

Isolation and Characterization of Xfgf3 cDNA Clones.
A stage 17 X. laevis embryo library, originally constructed in the laboratory of D. Melton, was screened by hybridization with a 290-bp AluI fragment that encompasses the second exon of mouse Fgf-3 genomic DNA (58) . A total of 3 x 105 phage plaques, immobilized on Hybond N filters (Amersham), were hybridized at 37°C for 16 h in 4 x SSC (1x SSC is 0.15 M NaCl and 0.015 M sodium citrate), 40% formamide, 0.04% each of bovine serum albumin, Ficoll and polyvinylpyrrolidone, and 50 µg/ml yeast tRNA. The filters were washed at 50°C in 2x SSC and 0.1% SDS, and the signals were detected by autoradiography. Phage DNA was recovered from liquid lysates by standard procedures, and individual EcoRI fragments were transferred into plasmid vectors for further analysis and DNA sequencing. DNA sequencing was accomplished by chain-termination procedures using double-stranded DNA templates and Sequenase protocols as recommended by the supplier.

PCR Amplification of Genomic DNA.
Samples (1 µg) of high molecular weight DNA from the blood of a single adult X. laevis were subjected to amplification by PCR using primers derived from the Xfgf3 cDNA sequence. The 5' primers were based on nucleotides 38–64 and 286–306 in the sequence shown in Fig. 1Citation . The 3' primer corresponded to a highly conserved region in the first exon (nucleotides 487–508). Amplification was performed as follows: 95°C for 2 min, 55°C for 2 min, and 72°C for 3 min. The products were analyzed by electrophoresis in a 1% agarose gel and visualized by staining with ethidium bromide.

Cell Culture and DNA Transfection.
COS-1 cells were maintained in DMEM containing 10% FCS and passaged every 7 days at a ratio of 1:10. For DNA transfection, 20 µg of CsCl purified plasmid DNA were introduced into 5 x 105 COS-1 cells by electroporation using a Bio-Rad Gene-Pulser set at 450V/250 µF. Cells were grown in 90-mm Petri dishes, and between 48 and 72 h after transfection, they were harvested for protein analysis. In some experiments, heparin was added 12 h after transfection at a concentration of 5 µg/ml of the culture medium.

Construction of Plasmids.
Vectors expressing mouse FGF3 (pKC3.2) and Xenopus FGF3 (Xfgf3.1) in an SV40-based expression vector (pKC) have been described previously (19 , 25) . Synthetic oligonucleotides were used as primers for amplification and modification of the plasmid Xfgf3.1 by PCR. As a first step, a new SacII site was created by PCR, which changed codons 41 and 42 (from CCCAGG to CCGCGG) but not the encoded amino acids. For plasmid Xfgf3.7, a second PCR product was amplified that had this SacII site as well as an altered codon 45 (CGA to AAA) to replace R with K. In Xfgf3.6, the 5' primer (5'-CCGCGGCAGAGACGAGATTATAAGGATGACGATGACAAAGATGCTGGGGGACGTGG-3') was designed to introduce the FLAG epitope DYKDDDDK adjacent to the SacII site (underlined). The 3' primer (5'-CTGCAGTCACAGGTCCTCCTCGCTGATCAGCTTCTGCTCCTGTCCTCGTCTTTGTCTTCCGCTCGGTTT-3') was designed to include 10 codons encoding an epitope from human c-MYC recognized by the monoclonal antibody 9E10 and a unique PstI site immediately adjacent to the translational stop codon. The PCR fragment was fused to the 5' fragment of Xfgf3.1 using the newly created SacII site. The reassembled cDNA was then ligated between the XbaI and PstI sites in the SV40-based expression vector, pKC3. For Xfgf3.8, primers were designed to separately amplify the 5' and 3' sequences of Xfgf3.1 and create a new, unique XhoI site at codons 45 and 46. The reverse primer for the NH2-terminal segment was CTCGAGTCCCTGCCTGGGGTCGCA, and the forward primer for the carboxy-terminal segment was CTCGAGGCTGGGGGACGTGGA. The PCR products were ligated through the new XhoI site, resulting in a changed amino acid sequence from RQRRD to RQGLE. In Xfgf3.9, the Leu24 codon in Xfgf3.1 changed from CTG to CTC to create a unique XhoI site, and a 3' fragment of Xfgf3.1 was amplified using the 5' primer CTCGAGCCCAGGCAGAGACGAGAT and fused to the 5' fragment through the new XhoI site to delete codon 26 up to codon 40.

Purification of Xenopus FGF3-related Proteins.
COS-1 cells were transfected with Xfgf3.1 or Xfgf3.7, and after 12 h, the medium was replaced with DMEM containing 0.1% FCS. Approximately 48 h later, the conditioned medium was recovered, and phenylmethylsulfonyl fluoride was added to a final concentration of 1 mM. 0.5 ml of a 50% slurry of heparin-Sepharose beads (Pharmacia) was added to the medium and mixed slowly overnight at 4°C. The beads were then poured into a column (Bio-Rad PolyPrep) and washed with 10 ml of PBS. The bound protein was eluted with a step gradient from 0.5 to 2.0 M NaCl in PBS. Fractions were collected, and the XFGF3-related protein-containing fractions were determined by immunoblotting. The amount of the mutant XFGF3 proteins was estimated against a defined amount of XFGF3 by serial dilution and by immunoblotting using the MSDI monoclonal antibody, which recognizes all naturally occurring XFGF3 variants and all recombinant XFGF3 proteins.

Thymidine Incorporation Assay.
C57MG mammary epithelial cells were grown routinely in DMEM containing 10% newborn calf serum. HC11 cells were grown in RPMI 1640 supplemented with 10% FCS, 5 µg/ml insulin, and 10 ng/ml epidermal growth factor (59) . For mitogenicity assays, cells were transferred to 48-well tissue culture plates in 500 µl of medium. After 24 h, the medium was replaced by DMEM containing 0.1% serum, and after an additional 72 h, the cells were treated with the test samples in fresh DMEM containing 0.1% serum. DNA synthesis was assayed 12 h later by labeling the cells with 2 µCi of [3H]thymidine/well for a further 4 h and measuring the incorporation of label into acid-insoluble material. Cells were washed three times in PBS, twice in methanol for 5 min, and dehydrated in water before fixing in cold 5% trichloroacetic acid for 20 min. The cells were finally dissolved in 300 µl of 0.3 M NaOH, and the residual 3H-labeled material was quantified by liquid scintillation counting.

Immunoblotting and Immunofluorescence.
The procedures used for preparing cell lysates, ECM, and conditioned medium have been described in detail elsewhere (21) . Samples from equivalent numbers of cells were fractionated by SDS-PAGE in 12.5% gels, transferred to nitrocellulose membranes (Schleicher and Schuell), and then processed with the monoclonal antibody (9E10), which recognizes the MYC tag, the anti-FLAG monoclonal antibodies M1 and M2, the polyclonal COOH-terminal antibody {alpha}X3, or the monoclonal antibody (MSDI), which recognizes an epitope in Xenopus FGF3. Immune complexes were detected with 125I-labeled protein-A (Amersham) as described (21) or by ECL as described by the manufacturer. For immunofluorescence microscopy, transfected COS-1 cells were grown on glass coverslips and fixed in 4% paraformaldehyde in PBS for 20 min. The cells were then permeabilized with 0.2% Triton X-100 for 4 min and treated with 3% BSA in PBS (BSA-PBS). The coverslips were then exposed to primary antibodies, and fluorescently labeled secondary antibodies were diluted in BSA-PBS. Confocal images were taken on a Zeiss confocal laser scan microscope.

Iodination.
FGF1 (TEBU) was iodinated by the chloramine-T method as described (32) . The labeled proteins were purified by heparin-sepharose chromatography as described previously (43) .

FGFR Competition Binding Assay.
Vectors for the expression of Xenopus FGFR1(IIIC), FGFR2(IIIb), and FGFR2(IIIc) cDNAs in COS-1 cells have been described previously (32) . COS-1 cells were transfected with the appropriate Xenopus FGFRs and seeded at 5 x 104 cells/well into 48-well plates pretreated with poly-L-lysine (Sigma) as recommended by the manufacturer. After 48 h, the cells were washed twice with the ice-cold binding medium (DMEM containing 50 mM HEPES, pH 7.4, and 1 mg/ml BSA) and incubated for 3 h at 4°C with the indicated amounts of 125I-labeled FGF1 in binding medium. Competition binding was performed in the presence of excess of unlabeled ligands. The cells were then rinsed twice with cold binding medium, solubilized in 0.1% SDS, 0.3 M NaOH for 30 min at 37°C, and the associated gamma radiation was counted. To determine the specific binding, the radioactivity bound to cells transfected with empty vector was subtracted from that of cells receiving FGFRs.

Cross-Linking of Receptors and FGFs.
COS-1 cells were transfected with different Xenopus FGFRs and were cultured for 48 h in 60-mm culture dishes. The assay was essentially performed as described previously (32 , 43) . Briefly, the cell monolayers were washed twice with ice-cold binding medium and incubated for 2 h at 4°C with binding medium containing iodinated FGF1 in the presence or absence of unlabeled ligand or vector alone. After washing, the cells were treated for 20 min at 4° with 0.3 mM disuccinimidyl suberate (Pierce) in PBS. After cross-linking, the cells were washed and lyzed. The extracts were then analyzed by SDS-PAGE on 7.5% gels, and the receptor-ligand complexes were detected by autoradiography.

Footnotes

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Heinrich-Heine-Universität Düsseldorf Medizinische Fakultät, IHTM Moorenstrasse 5, D-40225 Düsseldorf, Germany. Phone: 49-211-811-8793; Fax.: 49-211-811-6649; E-mail: kiefer{at}med.uni-duesseldorf.de Back

2 The abbreviations used are: FGF, fibroblast growth factor; ECM, extracellular matrix; FGFR, FGF receptor; ID50, 50% displacement; PC, proprotein convertase; TGF, transforming growth factor. Back

Received for publication 6/ 7/00. Revision received 9/19/00. Accepted for publication 9/25/00.

References

  1. Baird A., Klagsbrun M. The fibroblast growth factor family. Cancer Cells, 3: 239-243, 1991.[Medline]
  2. Klagsbrun M., Baird A. A dual receptor system is required for basic fibroblast growth factor activity. Cell, 67: 229-231, 1991.[Medline]
  3. Goldfarb M. The fibroblast growth factor family. Cell Growth Differ., 1: 439-445, 1990.[Medline]
  4. Basilico C., Moscatelli D. The FGF family of growth factors and oncogenes. Adv. Cancer Res., 59: 115-65, 1992.[Medline]
  5. Mason I. The ins and outs of fibroblast growth factors. Cell, 78: 547-552, 1994.[Medline]
  6. Klein S., Roghani M., Rifkin D. Fibroblast growth factors as angiogenesis factors: new insights into their mechanism of action. Exper. Suppl. (Basel), 79: 159-192, 1997.
  7. Szebenyi G., Fallon J. Fibroblast growth factors as multifunctional signaling factors. Int. Rev. Cytol., 185: 45-106, 1999.[Medline]
  8. Peters G., Brookes S., Smith R., Placzek M., Dickson C. The mouse homolog of the hst/k-FGF gene is adjacent to int-2 and is activated by proviral insertion in some virally induced mammary tumors. Proc. Natl. Acad. Sci. USA, 86: 5678-5682, 1989.[Abstract/Free Full Text]
  9. MacArthur C., Shankar D., Shackleford G. Fgf-8, activated by proviral insertion, cooperates with the Wnt-1 transgene in murine mammary tumorigenesis. J. Virol., 69: 2501-2507, 1995.[Abstract]
  10. Jakobovits A., Shackleford G., Varmus H., Martin G. Two proto-oncogenes implicated in mammary carcinogenesis, int-1 and int-2, are independently regulated during mouse development. Proc. Natl. Acad. Sci. USA, 83: 7806-7810, 1986.[Abstract/Free Full Text]
  11. Mansour S., Martin G. Four classes of mRNA are expressed from the mouse int-2 gene, a member of the FGF gene family. EMBO J., 7: 2035-2041, 1988.[Medline]
  12. Smith R., Peters G., Dickson C. Multiple RNAs expressed from the int-2 gene in mouse embryonal carcinoma cell lines encode a protein with homology to fibroblast growth factors. EMBO J., 7: 1013-1022, 1988.[Medline]
  13. Wilkinson D., Peters G., Dickson C., McMahon A. Expression of the FGF-related proto-oncogene int-2 during gastrulation and neurulation in the mouse. EMBO J., 7: 691-695, 1988.[Medline]
  14. Stamp G., Fantl V., Poulsom R., Jamieson S., Smith R., Peters G., Dickson C. Nonuniform expression of a mouse mammary tumor virus-driven int-2/Fgf-3 transgene in pregnancy-responsive breast tumors. Cell Growth Differ., 3: 929-938, 1992.[Abstract]
  15. Wilkinson D., Bhatt S., McMahon A. Expression pattern of the FGF-related proto-oncogene int-2 suggests multiple roles in fetal development. Development (Camb.), 105: 131-136, 1989.[Abstract]
  16. Grinberg D., Thurlow J., Watson R., Smith R., Peters G., Dickson C. Transcriptional regulation of the int-2 gene in embryonal carcinoma cells. Cell Growth Differ., 2: 137-143, 1991.[Abstract]
  17. Murakami A., Grinberg D., Thurlow J., Dickson C. Identification of positive and negative regulatory elements involved in the retinoic acid/cAMP induction of Fgf-3 transcription in F9 cells. Nucleic Acids Res., 21: 5351-5359, 1993.[Abstract/Free Full Text]
  18. Murakami A., Thurlow J., Dickson C. Retinoic acid-regulated expression of fibroblast growth factor 3 requires the interaction between a novel transcription factor and GATA-4. J. Biol. Chem., 274: 17242-17248, 1999.[Abstract/Free Full Text]
  19. Dixon M., Deed R., Acland P., Moore R., Whyte A., Peters G., Dickson C. Detection and characterization of the fibroblast growth factor-related oncoprotein INT-2. Mol. Cell. Biol., 9: 4896-4902, 1989.[Abstract/Free Full Text]
  20. Acland P., Dixon M., Peters G., Dickson C. Subcellular fate of the int-2 oncoprotein is determined by choice of initiation codon. Nature (Lond.), 343: 662-665, 1990.[Medline]
  21. Kiefer P., Peters G., Dickson C. The Int-2/Fgf-3 oncogene product is secreted and associates with extracellular matrix: implications for cell transformation. Mol. Cell. Biol., 11: 5929-5936, 1991.[Abstract/Free Full Text]
  22. Kiefer P., Peters G., Dickson C. Retention of fibroblast growth factor 3 in the Golgi complex may regulate its export from cells. Mol. Cell. Biol., 13: 5781-5793, 1993.[Abstract/Free Full Text]
  23. Kiefer P., Acland P., Pappin D., Peters G., Dickson C. Competition between nuclear localization and secretory signals determines the subcellular fate of a single CUG-initiated form of FGF3. EMBO J., 13: 4126-4136, 1994.[Medline]
  24. Kiefer P., Mathieu M., Mason I., Dickson C. Secretion and mitogenic activity of zebrafish FGF3 reveal intermediate properties relative to mouse and Xenopus homologues. Oncogene, 12: 1503-1511, 1996.[Medline]
  25. Kiefer P., Mathieu M., Close M., Peters G., Dickson C. FGF3 from Xenopus laevis.. EMBO J., 12: 4159-4168, 1993.[Medline]
  26. Johnson D., Williams L. Structural and functional diversity in the FGF receptor multigene family. Adv. Cancer Res., 60: 1-41, 1993.[Medline]
  27. Werner S., Duan D., de Vries C., Peters K., Johnson D., Williams L. Differential splicing in the extracellular region of fibroblast growth factor receptor 1 generates receptor variants with different ligand-binding specificities. Mol. Cell. Biol., 12: 82-88, 1992.[Abstract/Free Full Text]
  28. Dell K., Williams L. A novel form of fibroblast growth factor receptor 2. Alternative splicing of the third immunoglobulin-like domain confers ligand binding specificity. J. Biol. Chem., 267: 21225-21229, 1992.[Abstract/Free Full Text]
  29. Chellaiah A., McEwen D., Werner S., Xu J., Ornitz D. Fibroblast growth factor receptor (FGFR) 3. Alternative splicing in immunoglobulin-like domain III creates a receptor highly specific for acidic FGF/FGF-1. J. Biol. Chem., 269: 11620-11627, 1994.[Abstract/Free Full Text]
  30. Vainikka S., Partanen J., Bellosta P., Coulier F., Birnbaum D., Basilico C., Jaye M., Alitalo K. Fibroblast growth factor receptor-4 shows novel features in genomic structure, ligand binding and signal transduction. EMBO J., 11: 4273-4280, 1992.[Medline]
  31. Miki T., Bottaro D., Fleming T., Smith C., Burgess W., Chan A., Aaronson S. Determination of ligand-binding specificity by alternative splicing: two distinct growth factor receptors encoded by a single gene. Proc. Natl. Acad. Sci. USA, 89: 246-250, 1992.[Abstract/Free Full Text]
  32. Mathieu M., Kiefer P., Mason I., Dickson C. Fibroblast growth factor (FGF) 3 from Xenopus laevis (XFGF3) binds with high affinity to FGF receptor 2. J. Biol. Chem., 270: 6779-6787, 1995.[Abstract/Free Full Text]
  33. Mathieu M., Chatelain E., Ornitz D., Bresnick J., Mason I., Kiefer P., Dickson C. Receptor binding and mitogenic properties of mouse fibroblast growth factor 3. Modulation of response by heparin. J. Biol. Chem., 270: 24197-24203, 1995.[Abstract/Free Full Text]
  34. Antoine M., Reimers K., Dickson C., Kiefer P. Fibroblast growth factor 3, a protein with dual subcellular localization, is targeted to the nucleus and nucleolus by the concerted action of two nuclear localization signals and a nucleolar retention signal. J. Biol. Chem., 272: 29475-29481, 1997.[Abstract/Free Full Text]
  35. Kozak M. The scanning model for translation: an update. J. Cell Biol., 108: 229-241, 1989.[Abstract/Free Full Text]
  36. Brookes S., Smith R., Casey G., Dickson C., Peters G. Sequence organization of the human int-2 gene and its expression in teratocarcinoma cells. Oncogene, 4: 429-436, 1989.[Medline]
  37. Hughes M., Hughes A. Evolution of duplicate genes in a tetraploid animal, Xenopus laevis.. Mol. Biol. Evol., 10: 1360-1369, 1993.[Abstract]
  38. Shuldiner A., Phillips S., Roberts C., Jr., LeRoith D., Roth J. Xenopus laevis contains two nonallelic preproinsulin genes. cDNA cloning and evolutionary perspective. J. Biol. Chem., 264: 9428-9432, 1989.[Abstract/Free Full Text]
  39. Dorner A., Kaufman R. Analysis of synthesis, processing, and secretion of proteins expressed in mammalian cells. Methods Enzymol., 185: 577-596, 1990.[Medline]
  40. Seidah N., Chretien M. Eukaryotic protein processing: endoproteolysis of precursor proteins. Curr. Opin. Biotechnol., 8: 602-607, 1997.[Medline]
  41. Molloy S., Thomas L., VanSlyke J., Stenberg P., Thomas G. Intracellular trafficking and activation of the furin proprotein convertase: localization to the TGN and recycling from the cell surface. EMBO J., 13: 18-33, 1994.[Medline]
  42. Evan G., Lewis G., Ramsay G., Bishop J. Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. Cell. Biol., 5: 3610-3616, 1985.[Abstract/Free Full Text]
  43. Kiefer P., Strahle U., Dickson C. The zebrafish Fgf-3 gene: cDNA sequence, transcript structure and genomic organization. Gene (Amst.), 168: 211-215, 1996.[Medline]
  44. Tannahill D., Isaacs H., Close M., Peters G., Slack J. Developmental expression of the Xenopus int-2 (FGF-3) gene: activation by mesodermal and neural induction. Development (Camb.), 115: 695-702, 1992.[Abstract]
  45. Kiefer P., Dickson C. Nucleolar association of fibroblast growth factor 3 via specific sequence motifs has inhibitory effects on cell growth. Mol. Cell. Biol., 15: 4364-4374, 1995.[Abstract]
  46. Lombardo A., Isaacs H., Slack J. Expression and functions of FGF-3 in Xenopus development. Int. J. Dev. Biol., 42: 1101-1107, 1998.[Medline]
  47. Cui Y., Jean F., Thomas G., Christian J. BMP-4 is proteolytically activated by furin and/or PC6 during vertebrate embryonic development. EMBO J., 17: 4735-4743, 1998.[Medline]
  48. Seidah N., Chretien M., Day R. The family of subtilisin/kexin like pro-protein and pro-hormone convertases: divergent or shared functions. Biochimie, 76: 197-209, 1994.[Medline]
  49. Seidah N., Hamelin J., Mamarbachi M., Dong W., Tardos H., Mbikay M., Chretien M., Day R. cDNA structure, tissue distribution, and chromosomal localization of rat Pc7, a novel mammalian proprotein convertase closest to yeast kexin-like proteinases. Proc. Natl. Acad. Sci. USA, 93: 3388-3393, 1996.[Abstract/Free Full Text]
  50. Jones B., Thomas L., Molloy S., Thulin C., Fry M., Walsh K., Thomas G. Intracellular trafficking of furin is modulated by the phosphorylation state of a casein kinase II site in its cytoplasmic tail. EMBO J., 14: 5869-5883, 1995.[Medline]
  51. Mignatti P., Rifkin D. Biology and biochemistry of proteinases in tumor invasion. Physiol Rev., 73: 161-195, 1993.[Free Full Text]
  52. Werb Z., Bainton D., Jones P. Degradation of connective tissue matrices by macrophages. III. Morphological and biochemical studies on extracellular, pericellular, and intracellular events in matrix proteolysis by macrophages in culture. J. Exp. Med., 152: 1537-1553, 1980.[Abstract/Free Full Text]
  53. Saksela O., Rifkin D. Release of basic fibroblast growth factor-heparan sulfate complexes from endothelial cells by plasminogen activator-mediated proteolytic activity. J. Cell. Biol., 110: 767-775, 1990.[Abstract/Free Full Text]
  54. Ruta M., Burgess W., Givol D., Epstein J., Neiger N., Kaplow J., Crumley G., Dionne C., Jaye M., Schlessinger J. Receptor for acidic fibroblast growth factor is related to the tyrosine kinase encoded by the fms-like gene (FLG). Proc. Natl. Acad. Sci. USA, 86: 8722-8726, 1989.[Abstract/Free Full Text]
  55. Bottaro D., Rubin J., Ron D., Finch P., Florio C., Aaronson S. Characterization of the receptor for keratinocyte growth factor. Evidence for multiple fibroblast growth factor receptors. J. Biol. Chem., 265: 12767-12770, 1990.[Abstract/Free Full Text]
  56. Dubois C. M., Laprise M. H., Blanchette F., Gentry L. E., Leduc R. Processing of transforming growth factor ß1 precursor by human furin convertase. J. Biol. Chem., 270: 10618-10624, 1995.[Abstract/Free Full Text]
  57. Bellosta P., Talarico D., Rogers D., Basilico C. Cleavage of K-FGF produces a truncated molecule with increased biological activity and receptor binding affinity. J. Cell. Biol., 121: 705-713, 1993.[Abstract/Free Full Text]
  58. Moore R., Casey G., Brookes S., Dixon M., Peters G., Dickson C. Sequence, topography and protein coding potential of mouse int-2: a putative oncogene activated by mouse mammary tumour virus. EMBO J., 5: 919-924, 1986.[Medline]
  59. Ball R., Friis R., Schoenenberger C., Doppler W., Groner B. Prolactin regulation of ß-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J., 7: 2089-2095, 1988.[Medline]



This article has been cited by other articles:


Home page
BioinformaticsHome page
Y. Kliger, E. Gofer, A. Wool, A. Toporik, A. Apatoff, and M. Olshansky
Predicting proteolytic sites in extracellular proteins: only halfway there
Bioinformatics, April 15, 2008; 24(8): 1049 - 1055.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antoine, M.
Right arrow Articles by Kiefer, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antoine, M.
Right arrow Articles by Kiefer, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation