CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Escalante-Alcalde, D.
Right arrow Articles by Covarrubias, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Escalante-Alcalde, D.
Right arrow Articles by Covarrubias, L.
Cell Growth & Differentiation Vol. 11, 527-539, October 2000
© 2000 American Association for Cancer Research


Articles

Expression of E6 and E7 Papillomavirus Oncogenes in the Outer Root Sheath of Hair Follicles Extends the Growth Phase and Bypasses Resting at Telogen1

Diana Escalante-Alcalde2, Felix Recillas-Targa2,3, Concepción Valencia, Jesús Santa-Olalla, Pedro Chávez, Alberto Marroquín, Lourdes Gutiérrez-X, Patricio Gariglio and Luis Covarrubias4

Departamento de Genética y Fisiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca Mor. 62250 [D. E-A., F. R-T., C. V., J. S-O., L. C.]; Centro de Investigación en Ciencia Aplicada y Tecnología Avanzada, Mexico, D.F. 11500 [P. G., L. C.]; Departamento de Genética, Centro de Investigación y Estudios Avanzados del Instituto Politécnico Nacional, Mexico, D.F. 07360 [P. C., A. M., P. G.]; and Departamento de Virus y Cáncer, Instituto Nacional de Salud Pública, Cuernavaca, Mor. 62508 [L. G-X.], Mexico

Abstract

Hair follicle growth cycle proceeds through a series of stages in which strict control of cell proliferation, differentiation, and cell death occurs. Transgenic mice expressing human papillomavirus type 16 E6/E7 papillomavirus oncogenes in the outer root sheath (ORS) display a fur phenotype characterized by lower hair density and the ability to regenerate hair much faster than wild-type mice. Regenerating hair follicles of transgenic mice show a longer growth phase (anagen), and although bulb regression (catagen) occurs, rest at telogen was not observed. No abnormalities were detected during the first cycle of hair follicle growth, but by the second cycle, initiation of catagen was delayed, and rest at telogen was again not attained, even in the presence of estradiol, a telogen resting signal. In conclusion, expression of E6/E7 in the ORS delays entrance to catagen and makes cells of the ORS insensitive to telogen resting signals bearing to a continuous hair follicle cycling in transgenic mice.

Introduction

Proliferation and death are essential cellular processes during the development of different animal structures. Proliferation is required to produce as many cells as needed to form the tissues of a specific structure, and its inhibition allows terminal differentiation. On the other hand, cell death is essential both to eliminate cells within tissues that have to achieve the right size and form and to eliminate unnecessary tissues in the mature structure. In recent years, many signals that control proliferation, differentiation, and cell death have been characterized, several of which are shared, showing the intimate interactions between these processes (1 , 2) .

Hair follicle development (reviewed in Ref. 3 ) is an appropriate model to study how proliferation, differentiation, and cell death coordinate to give rise to a complex structure. Hair follicles originate late in embryogenesis from the epidermis by a process involving thickening and down-growth of the epithelial tissue at specific sites; the dermal mesenchyme tissue underneath, whose cells aggregate to form the dermal papilla, determines these sites. The plug of epithelial tissue formed, which is always in intimate contact with the dermal papilla, is initially constituted of what is known as the ORS,5 which will later differentiate into the cells of the hair matrix at the base of the follicle. Hair follicle growth results from differentiation and migration of cells from the hair matrix, giving rise to the inner root sheath and the shaft. After growth, the base of a hair follicle degenerates up to one-third of its maximum size. The follicle at this stage is composed of nonproliferating cells, which include the putative stem cells responsible for hair regeneration in the adult.

The hair growth cycle appears to start from a population of stem cells located in a special part of the ORS, just below the bulge (4 , 5) . Every cycle is characterized by three phases: (a) anagen, the stage of active cell proliferation during which the follicle is regenerated, and a new hair is produced; (b) catagen, the stage during which hair elongation ceases, and active cell death causes hair follicle regression; and (c) telogen, the stage during which the follicle is at rest, and cell activity is minimal. At this latter stage, the stem cells are ready to start a new cycle.

Experimental modifications of hair follicle development may contribute to the understanding of how different regulatory pathways act within the epidermis. To modify the patterns of proliferation, differentiation, and cell death in a variety of renewable stratified epithelia, including the ORS of hair follicles, we have used the K6 promoter to direct the expression of HPV-16 E6/E7 oncogenes. E7 binds and inactivates molecules, such as pRB, that are key regulators of the cell cycle and thus promotes cell proliferation (6 , 7) . On the other hand, E6 induces p53 degradation through a coupling molecule (6 , 7) . This tumor suppressor protein negatively regulates cell cycle progression by transcriptional activation of the gene coding for p21, a cyclin-dependent kinase inhibitory protein, and it also participates in the control of apoptosis (8) . Transgenic mice expressing E6/E7 oncogenes under the control of the K6 promoter show lower hair density by 2 months of age. However, hair growth after depilation was clearly faster in transgenic animals than in wild-type animals. Histological analysis shows that the hair follicle growth cycle in transgenic mice had a longer growth phase and lacked a resting phase. Furthermore, hair follicles of transgenic mice did not respond to topical applications of estradiol, a molecule capable of arresting follicles at telogen (9) . Therefore, the hair follicles of transgenic mice proceed through all stages of the growth cycle, with an extended anagen phase, and bypass the resting at telogen.

Results

Expression of E6/E7 Oncogenes in Transgenic Mice.
We used 9.8 kb of the bK6 promoter to drive expression of E6/E7 coding sequences of HPV-16 in transgenic mice (Fig. 1)Citation . Five founder mice were generated, four of which showed a similar phenotype in their fur characterized by a low hair density (see below), which was obvious from 2 months of age. Two founders died unexpectedly; therefore, progeny was only produced from the remaining two animals, giving rise to the lines named Tg(bK6-E6/E7)M8 and Tg(bK6-E6/E7)H1. Matings between wild-type CD-1 and hemizygous transgenic mice from these two lines produced litters of normal size, comparable that of the CD-1 wild-type strain (about 10 pups/litter), and transgene from both lines segregated in a Mendelian fashion (Table 1)Citation ; therefore, few or no transgenic mouse died during embryonic life, and a single integration site was expected. Sex distribution was determined after weaning, and among the transgenic mice produced, sex distribution was normal within line Tg(bK6-E6/E7)M8 but abnormal within line Tg(bK6-E6/E7)H1, in which females prevailed (Table 1)Citation ; in this latter case, some males may be within the population of mice that died before weaning (see below).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of the bK6-E6/E7 transgene construct and the expected E6/E7 transcription products. A fragment (0.8 kb) containing the HPV-16 E6 and E7 oncogenes was inserted between a 9.8-kb fragment of the bK6 gene promoter and regulatory region and a fragment containing the SV40 polyadenylation signal. Once this construct is inserted in the mouse genome, a primary transcript would be expected to be produced, which could be alternatively processed using one splicing donor (SD) and two splicing acceptor (SA) sites, all contained within the E6 coding region. The three mRNA species, named E6/E7, E6*I/E7, and E6*II/E7, are depicted below the construct representation (the gray segment represents the E6 coding region, and the dark dashed segment represents the E7 coding region). The sizes of the products amplified with the primers used in this work (a, forward E6/E7; b, reverse E6 and; c, reverse E6/E7) are indicated in bp.

 

View this table:
[in this window]
[in a new window]
 
Table 1 bK6-E6/E7 transgene and abnormal fur phenotype segregation in two transgenic mouse lines

 
Transgenic mice born from both lines, which were propagated as hemizygous for the transgene, were not completely healthy. Mice got sick and died at different stages of adult life. A few died before weaning, but most lived longer than 2 months and died before 1 year of age (Table 1)Citation . Males were predominately affected, leaving almost only females among the group of animals more than 1 year of age (Table 1)Citation . The cause of death appeared to be related to a progressive disease associated with kidney degeneration (data not shown). More studies are required to understand the cause of death; however, it is unlikely that this interfered with the studies described below.

Northern blot analysis of total RNA from different tissues of mice from line Tg(bK6-E6/E7)M8 (Fig. 2A)Citation and Tg(bK6-E6/E7)H1 (data not shown) was used to determine the transgene expression pattern. In both lines, expression was observed in tissues expected to express K6 and was highest in skin and tongue and absent in liver (Fig. 2A)Citation . Accordingly, combining a specific immunoprecipitation and Western blotting, we were also able to detect the E7 protein in the skin of transgenic mice (Fig. 2B)Citation . Within the hair follicle, E6/E7 mRNA (Fig. 2C)Citation and the proteins encoded Citation (Fig. 4)Citation were detected in the ORS, in which K6 is normally present. The independent transgenic mouse line with a normal fur phenotype mentioned above did not express the transgene (data not shown), supporting the notion that abnormal fur phenotype is due to transgene expression.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 2. Detection of E6/E7 transcripts and E7 protein in transgenic mouse tissues. A, Northern blot analysis of samples from the Tg(bK6-E6/E7)M8 transgenic line. Total RNA was isolated from the organs indicated. The E6/E7 probe detected one major transcript (3 kb; arrow) and some minor transcripts that are mainly detected in the skin and tongue of transgenic mice; arrowheads indicate the position of rRNAs. B, detection of E7 in protein extracts from transgenic mouse skin and liver. Proteins were extracted from skin and liver of wild-type (Wt) and Tg(bK6-E6/E7)M8 transgenic mice (Tg) and from control cell cultures of human foreskin fibroblasts (HFF; these fibroblasts do not contain any sequence of the HPV-16 genome) and the CaSki cell line (which contains more than 100 copies of the HPV-16 genome). E7 protein was specifically immunoprecipitated and then detected by Western blotting as described in "Materials and Methods." A band corresponding to the E7 protein (about 18 kDa) was detected only in extracts from CaSki cells and transgenic mouse skin; the thick band observed in all samples is the immunoglobulin light chain (lc; 23 kDa) of the antibody used for immunoprecipitation; MW, molecular weight. C, detection of E6/E7 mRNA in transgenic mouse hair follicles. In situ hybridization was performed on sections of transgenic mouse skin [line Tg(bK6-E6/E7)M8] using either a E6/E7 antisense probe (AS, left panel) or a E6/E7 sense probe (S, right panel). Note that the positive signal is restricted to the ORS of hair follicles.

 


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 3. Presence of E6/E7 transcripts and temporal gene expression in the skin and tongue of transgenic mice. A, detection of E6/E7 alternative splicing RNA products. A specific RT-PCR was carried out with 30 amplification cycles, using total RNA from the skin (S) and tongue (T) of 4-month-old transgenic mice [Tg(bK6-E6/E7)M8] and the primers depicted in Fig. 1Citation (for E6/E7 PCR products, a and c; for E6 PCR products, a and b). In tissues tested, the presence of the unprocessed (822 bp in E6/E7 PCR products; 514 bp in E6 PCR products) and processed transcripts (indicated under its corresponding size as *I and *II in both E6/E7 and E6 PCR products) is evident. The first lane was loaded with a molecular weight marker (M1: a = 2176 bp; b = 1766 bp; c = 1230 bp; d = 1033 bp; e = 653 bp; f = 517 bp; g = 453 bp; h = 394 bp; i = 298 bp; and j = 234 bp; M2: a' = 1631 bp; b' = 517 bp; c' = 396 bp; d' = 344 bp; e' = 298 bp; f' = 220 bp). B, appearance of E6*I transcripts at early postnatal ages. Total RNA was obtained from the tissues indicated and used to perform a specific RT-PCR for the E6*I transcript fragment (Fig. 1)Citation ; samples were taken after 20, 25, and 30 cycles of PCR amplification. The E6*I transcript was initially detected in tissues of mice at 1 week after birth (1W), and major changes were not observed in the tissues of older mice [2–24 weeks of age (2–24W)]. HPRT is a housekeeping enzyme used as a reference for the amount of RNA used for the PCR reaction. Controls without reverse transcriptase or using RNA from wild-type mice did not produce any PCR product.

 


View larger version (124K):
[in this window]
[in a new window]
 
Fig. 4. E6 and E7 protein distribution in the growing hair follicles. Samples of skin were taken at different postnatal ages (indicated within each panel) and then processed for immunohistochemical analysis as described in "Materials and Methods." E6 protein was initially detected at 15 days after birth (A) and then abundantly detected at 30 and 40 days after birth (B—E). Note that the signal (dark brown) is located mainly within the nuclei of cells of the ORS, at different stages and levels of the growing hair follicle, and, in several instances, in the interfollicular epidermis (E) closely associated with the follicle. The distribution pattern of the E7 protein (G and H) is very similar to that shown for E6. Particularly interesting are the positive cells identified in or close to the bulge region (BR; D and G), which is in the upper region of the follicle and associated with the pilli muscle fiber (PM). Signal regularly detected in the sebaceous gland (SG) and occasionally detected in the panniculus carnosous (PC) was mainly due to nonspecific binding of the antibodies used because it was observed in a similar fashion in samples from wild-type mice (F and I). All samples were stained with hematoxylin to remark nuclei (as seen in blue).

 
Using RT-PCR, we detected the major transcripts expected to be obtained from the E6/E7 transgene after alternative splicing within the E6 coding sequence of its primary transcript, although additional transcripts also appeared to be produced (Fig. 3A)Citation ; E6*I transcript, considered to be the main product from the papillomavirus (10) , was the most abundant. A semiquantitative RT-PCR protocol was implemented to determine the E6/E7 mRNA levels in skin and tongue samples of mice from different postnatal ages. E6/E7 mRNA was not detected in newborn transgenic mice but started to be detected 1 week after birth in both tongue and skin and remained almost constant later in life (Fig. 3B)Citation ; these data are in agreement with the expected expression pattern of the mouse K6 gene in these tissues.

Using immunohistochemistry, we determined the location of E6 and E7 proteins in the skin of transgenic mice. Fifteen days after birth, E6 protein started to be clearly detected in the ORS of hair follicles (Fig. 4A)Citation , although not many positive cells were generally found. At 30 days after birth, when hair follicles are expected to be in the early phase of the second growth cycle (see below), E6 protein was detected mainly in the "new" growing follicle, with positive cells apparently coming from around the base of the "old" follicle (Fig. 4, B and C)Citation . By 40 days after birth, many E6- and E7-positive cells were located just below the sebaceous gland in the region known as the bulge, which is characterized by the attachment of a muscle fiber to the follicle (Fig. 4, D and G)Citation , although the viral proteins were also distributed in the cells of the ORS along the whole length of the hair follicle (Fig. 4, E and H)Citation . During this growing phase, E6 and E7 proteins were also abundantly detected in the interfollicular epidermis (Fig. 4, B and G)Citation . In control animals (i.e., wild-type CD-1 mice), immunoreactivity was regularly found in the sebaceous gland (Fig. 4, F and I)Citation ; therefore, the signal in this region in samples from transgenic mice was not considered relevant.

Fur Phenotype in Tg(bK6-E6/E7)M8 Transgenic Mice.
Fur phenotype was indistinguishable between wild-type and transgenic mice until the age of 1 month. After this, lower hair density started to be noticeable in transgenic mice and became obvious in 2-month-old mice. This phenotype was always more marked in mature females than males (Fig. 5A)Citation and was maintained for the remainder of the animal’s life, with an increasing degree of manifestation in older animals and in pregnant females. Some differences in fur phenotype were observed between lines Tg(bK6-E6/E7)M8 and Tg(bK6-E6/E7)H1. In mice from line Tg(bK6-E6/E7)M8, hair density was seen as a gradient, with waves of less hair density moving rostral to caudal (Fig. 5Citation A, left). In mice from line Tg(bK6-E6/E7)H1, this gradient was not evident, and a patchy phenotype was seen instead (Fig. 5Citation A, right); in this case, each patch could represent differences in hair density or growing stage.



View larger version (97K):
[in this window]
[in a new window]
 
Fig. 5. Fur phenotype of transgenic mice expressing E6/E7 oncogenes in the ORS. A, external phenotype. Two independent transgenic lines [Tg(bK6-E6/E7)M8 and Tg(bK6-E6/E7)H1] expressing the E6/E7 oncogenes showed lower hair density, a phenotype that was more pronounced in females. B, hair growth turnover. Photograph shows fur appearance 10 days after female mice were depilated on one side (a) and painted and clipped (b) or only painted (c) on the other side. Apparent faster hair growth was observed in transgenic mice when hair growth was induced (depilated) or uninduced (painted and clipped or only painted), resulting in almost complete restoration 10 days after hair manipulation. The same result has been obtained from more than three independent experiments (see, for instance, Fig. 10Citation ). C, magnification of an area with regrown hair 10 days after depilation. The photographs shown are from an experiment that was performed with transgenic line Tg(bK6-E6/E7)M8 and was independent of the one described in B.

 
To define the cause of the lower hair density observed in transgenic mice, one dorsal side of 2-month-old mice was depilated while the other side was painted, and hairs were clipped (in some mice, only the upper half was clipped, leaving the very bottom stained hairs intact). Normally, at 2 months of age, most hair follicles have reached the resting phase of the second hair growth cycle, and depilation synchronously activates hair growth; hair growth regularly starts from rostral to caudal. Surprisingly, independently of the line to which the mice belong, hairs appeared in transgenic mice 3 days after depilation, whereas in wild-type mice, no hairs were detected on the depilated surface (data not shown). By 10 days, most of the depilated region in transgenic mice was covered with hairs of approximately normal length, whereas in control mice, new hairs were only starting to be visible (Fig. 5, B and C)Citation . On the other hand, by 10 days, stained hairs were completely lost in the clipped region and almost completely lost in the unclipped region of transgenic mice, but not in control ones (Fig. 5B)Citation , suggesting that the hair follicles of transgenic mice were not at the resting stage expected in 2-month-old mice. These data are consistent with a continuous growth of hairs in transgenic mice; therefore, we were persuaded to analyze this possibility in more detail.

Hemizygous mice from line Tg(bK6-E6/E7)M8 were selected for the studies described below because of their more even fur phenotype in defined areas of the skin and longer survival than Tg(bK6-E6/E7)H1 animals, thus allowing production of the animals required and decreasing the probability of death during the experiments. In the present work, we show results obtained mainly with females because of their longer survival, but very similar data have been achieved with males, particularly in relation to the hair growth (see Figs. 5Citation and 11Citation ).



View larger version (127K):
[in this window]
[in a new window]
 
Fig. 11. Hair plucking at different times of the hair growth cycle in wild-type and transgenic mice. Hairs of wild-type and transgenic mice at different postnatal ages were plucked using an adhesive tape; photographs show the hairs stuck to the tape. The ages selected correspond to the times hair follicles are at catagen (20 days) and telogen of first cycle (25 days) and anagen of second cycle (35 days). Note that more hairs were plucked when follicles were at telogen than when they were at anagen in the transgenic mouse, whereas hairs were plucked equally at those phases in the wild-type mouse. This experiment was repeated at least five times.

 
Hair Follicle Growth Cycle in Transgenic Mice.
To study the hair growth cycle stage affected by the E6/E7 transgene, a histological analysis was performed along the hair regrowth induced after depilation (Fig. 6)Citation . The hair follicles of transgenic and control mice behaved similarly through the anagen phase; however, follicles of control mice started follicle degeneration by about 18 days and reached the resting phase by 24 days, whereas follicles of transgenic mice showed no signs of degeneration until 30 days after depilation, with few follicles with telogen appearance. Forty-five days after depilation, wild-type follicles were still in telogen, whereas transgenic ones were again in the anagen phase (data not shown). Therefore, rather than affecting the whole hair cycle, E6/E7 transgenes appear to extend the anagen phase and prevent hairs from remaining in the resting phase. No abnormality was observed in follicle morphology through the different developmental stages.



View larger version (86K):
[in this window]
[in a new window]
 
Fig. 6. Hair growth cycle after depilation of bK6-E6/E7 transgenic and wild-type mouse follicles. A group of 2-month-old transgenic and wild-type mice was depilated, and skin fragments were processed for histology at 6, 12, 18, 24, and 30 days after depilation. As can be observed, the growth phase of transgenic hair follicles was at least 12 days longer than that of wild-type hair follicles. Wild-type follicles started catagen by 18 days postdepilation, whereas transgenic mice started it by 30 days postdepilation. Telogen is established by 24 days postdepilation in wild-type mice, and follicles remained in that state for up to 45 days postdepilation (data not shown). Telogen in transgenic mice was only transitory because follicles were already in anagen at 45 days postdepilation (data not shown).

 
We also studied the behavior of the first and second hair growth cycles, during which the growth of most fur hair follicles is normally synchronized (Fig. 7)Citation . The first growth cycle of transgenic mice hair follicles proceeded normally, reaching the telogen phase at about the expected time. However, it is important to note that at 20 days after birth, wild-type hair follicles appeared at a more advanced stage of catagen than those of transgenic mice, suggesting that the first anagen phase was slightly longer in transgenic hair follicles than in wild-type hair follicles (see below). The second growth cycle appeared to proceed normally until the end of the anagen phase, when hair follicles of wild-type mice initiated the catagen and reached the telogen phase, but the follicles of transgenic mice remained in the anagen phase or were just initiating catagen. These results are in agreement with the fact that marked differences in phenotype started to appear after the first hair growth cycle.



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 7. First and second growth cycle of transgenic and wild-type hair follicles. Skin fragments of transgenic and wild-type mice were taken at different intervals after birth and processed for histological analysis. First hair growth cycle showed no major kinetic differences between transgenic and wild-type follicles (anagen at 5 and 15 days; catagen at 20 days; telogen at 25 days), although catagen appears at a more advanced stage in wild-type skin samples. Note, however, that the anagen of the second hair growth cycle proceeded normally only until mice reached 35 days of age; after that time, hair follicles of 40-day-old wild-type animals had started catagen, whereas those of transgenic mice continued in anagen.

 
Proliferation and Cell Death in the Hair Follicles of Transgenic Mice.
Anagen phase is characterized by profuse cell proliferation, whereas catagen phase is distinguished by abundant cell death. Hair follicles in telogen are in a quiescent state. In wild-type mice, 5 days after birth, hair follicles were in anagen of the first cycle, showing many cells positive for the PCNA proliferation marker in the matrix and ORS (Fig. 8)Citation ; a similar result was obtained in the hair follicles of mice 35 days after birth, when they were also in anagen but in the second hair growth cycle (Fig. 8)Citation . Thirty days after birth, the initial stages of anagen of the second cycle were occurring, and many PCNA-positive cells were found in the growing hair follicle. By day 40, follicles with catagen morphology were observed, but some PCNA-positive cells were still detected (Fig. 8)Citation . In transgenic mice, hair follicles at 5 and 35 days after birth were at a similar stage of anagen as wild-type mice; the location of PCNA-positive cells in these follicles was similar to that observed in wild-type mice (Fig. 8)Citation . In contrast, at 30 days after birth, anagen in transgenic hair follicles was at an earlier stage than that in wild-type ones, showing abundant proliferating cells (Fig. 8)Citation . This observation is in agreement with the histological data described above, indicating that anagen of the first cycle was longer for transgenic follicles, resulting in a delay in the initiation of the second cycle. Additionally, at 40 days after birth, when hair follicles of wild-type animals were initiating catagen, the PCNA staining pattern in transgenic follicles corresponded to that observed in the normal anagen phase (Fig. 8)Citation . Proliferation in hair follicles was also evaluated at several time points after depilation (data not shown). In general, as occurred in the experiments described above, the PCNA staining pattern observed during the initial stages of anagen (6–12 days after depilation) was essentially similar between wild-type and transgenic follicles; however, in agreement with an extended anagen phase, the PCNA staining in the hair matrix and the ORS characteristic of follicles in anagen was preserved in transgenic follicles, even when wild-type follicles had reached the telogen phase. It is important to note that although we were not able to detect a significantly larger number of PCNA-positive cells in transgenic hair follicles as compared with wild-type ones at a single similar stage, more PCNA-positive cells are obviously produced in transgenic hair follicles than in wild-type hair follicles because the former have a prolonged anagen phase.



View larger version (90K):
[in this window]
[in a new window]
 
Fig. 8. Cell proliferation during hair follicle growth cycle of transgenic and wild-type mice. Cross-sectioned samples of the experiment described in Fig. 6Citation were used for immunohistochemical detection of PCNA. A large number of PCNA-positive cells were found during the anagen phase in hair follicles of both wild-type (Wt; age, 5, 30, and 35 days) and transgenic (Tg; age, 5, 30, 35, and 40 days) mice. Most positive cells were located in the ORS and the hair matrix (M), characteristic of the growing follicle. Note that at 40 days of age, few positive nuclei were observed in the hair matrix and the ORS of wild-type follicles, in agreement with their being in the catagen stage, but the follicles of transgenic mice at this time show a pattern of PCNA-positive cells similar to those in the anagen phase (compare with 30 and 35 days of age). At 30 days of age, the different PCNA pattern observed when transgenic and wild-type mouse samples were compared is likely due to a difference in the initiation time of the second hair follicle growth cycle (see "Results"). Marked differences between wild-type and transgenic mice in the number of PCNA-positive cells during anagen were not detected.

 
In wild-type mice, at the time the catagen phase was initiated, cell death was clearly detected at the base of the degenerating hair follicle (Fig. 9A)Citation . During the anagen phase, cell death was detected in the most internal cell layer of the inner root sheath and is probably related to the formation of the hair shaft (Fig. 9C)Citation . Cell death in transgenic mice hair follicles at the time of catagen initiation in wild-type mice (18 days after depilation) was located in regions identical to those of the hair follicles of wild-type mice in anagen (Fig. 9, B and D)Citation . This pattern did not change dramatically until the time at which catagen-like follicles were observed in transgenic mice. At this later stage, massive cell death was found in some transgenic mouse follicles with telogen-like morphology, a pattern never seen in follicles of wild-type mice (Fig. 9E)Citation . At the beginning of a new cycle, cell death was not detected, and only proliferating cells were observed.



View larger version (120K):
[in this window]
[in a new window]
 
Fig. 9. Detection of cell death during the hair growth cycle in wild-type and transgenic animals. Terminal deoxynucleotidyl transferase-mediated nick end labeling performed with sections from wild-type (A and C) and transgenic (B, D, and E) tissues 12 (C), 18 (A, B, and D), and 30 (E) days postdepilation. At the time catagen was initiated in the wild-type mice, an abundant number of dying cells (arrowhead) were found at the base of the degenerating follicles (A, bar = 50 µm); a higher magnification of the degenerating area is shown in the inset (bar = 25 µm). During anagen phase (12 and 18 days postdepilation in wild-type and transgenic mice, respectively), cell death was detected in the middle portion of the most internal layer of the inner root sheath and in the shaft (arrowheads) in both wild-type (C, bar = 50 µm) and transgenic (B, bar = 100 µm; D, bar = 50 µm) mice; note that at the base of the follicles, cell death is undetectable (B). Massive degeneration was found in a few follicles of transgenic mice with telogen morphology (E, bar = 50 µm).

 
Response of Transgenic Hair Follicles to a Telogen Resting Signal.
To establish whether the hair follicles of transgenic mice responded to 17ß-estradiol, a signal that prevents hair follicles from exiting the telogen phase (9) , the right and left dorsal sides of 6-week-old transgenic mice were clipped and stained, and one side was treated with estradiol (Fig. 10)Citation . As expected, hair growth was blocked by 17ß-estradiol in wild-type mice, an effect that was obvious 39 days after treatment. In contrast, the hairs of transgenic mice grew much faster, and no response to 17ß-estradiol was observed. These data are in agreement with E6/E7 transgenes being able to skip a hair follicle resting signal at telogen.



View larger version (107K):
[in this window]
[in a new window]
 
Fig. 10. The effect of estrogen on the hair follicle cycle of wild-type and transgenic mice. Mice were topically treated with 17ß-estradiol as described in "Materials and Methods." Observe that hair growth was blocked by estradiol in wild-type mice (Wt), but not in transgenic mice (Tg), as indicated by the areas with growing white hairs. The same result was obtained in three independent experiments. E, estrogen treatment; C, control treatment.

 
Hair Structure and Shedding during Follicle Growth Cycle.
Hair itself did not appear to be affected in transgenic mice. Major hair types, awl/auchene and zigzag, were present in transgenic mice, and each type made a similar contribution to the pelage as seen in wild-type animals, except in young females, in which the contribution by the awl/auchene hair type was increased in transgenic mice in comparison with wild-type mice (Table 2)Citation . Differences in hair length were observed (0.96 ± 0.12 cm in wild-type mice versus 0.72 ± 0.09 cm in transgenic mice) that might contribute to the fur aspect.


View this table:
[in this window]
[in a new window]
 
Table 2 Distribution of hair types in transgenic and wild-type mice at two different ages

 
Although we demonstrated in the experiments described above that hair growth cycle is affected in transgenic mice, this cannot be directly associated with the lower hair density. We then considered that increased hair shedding was a likely cause of the lower hair density observed in transgenic mice. To determine whether hair shedding occurs more easily in transgenic mice than in wild-type mice, and whether it is associated with the follicle growth cycle, we used an adhesive tape to pluck hairs at different postnatal ages that correspond to the anagen, catagen, or telogen phases. We found that hairs were more easily plucked in transgenic mice than in wild-type mice, but this was more obviously detected when follicles were at the first telogen phase (Fig. 11)Citation or second telogen phase (data not shown). Therefore, lower hair density may be due to increased shedding occurring mainly at the telogen phase.

Discussion

We have expressed HPV-16 E6/E7 oncogenes in the ORS of hair follicles using the K6 promoter. K6 is expressed in several stratified epithelia such as those of the skin, tongue, esophagus, forestomach, and cervix (11) . In the skin, K6 expression is restricted mainly to the ORS of the hair follicle (12) , and the protein product has been initially observed in this tissue by 2 weeks after birth (13) , although we detected significant K6 promoter activity before this time (Fig. 3)Citation . Expression in suprabasal layers of the epidermis is detected only after injury or in response to activators such as phorbol esters or retinoids (14, 15, 16, 17, 18, 19) . In all cases, expression of K6 is coincident with hyperproliferative cells and is also up-regulated in tumor cells derived from epithelial tissues (20 , 21) . Therefore, the K6 promoter is a suitable tool to direct expression of genes to proliferative layers of epithelia in transgenic mice (22, 23, 24, 25, 26) . Thus, the effects of a transgene with its expression directed by the K6 promoter on hair growth should be caused by direct activity of transgene in cells of the ORS and not indirectly through its activity in cells of the epidermis. In this sense, use of the K6 promoter may be more advantageous than other promoters that share constitutive specificity to the ORS and suprabasal layers of the epidermis (e.g., K14 promoter; Ref. 27 ).

It has been proposed that every hair regeneration cycle starts from the activation of a slowly dividing cell population of stem cells located in the ORS (4 , 5) . Electron microscopy data suggest that these cells do not contain intermediate filaments (4 , 5) . If the hypothesis for hair regeneration involving these stem cells is correct, then our data indicate that the K6 promoter should be active in this slowly dividing cell population. Interestingly, E6 and E7 antibodies detected cells that are located in the zone proposed to contain this stem cell population in the growing follicle (Fig. 4)Citation . Furthermore, at the initial growth stages, oncoproteins are abundantly present in the newly forming follicle, with positive cells apparently coming from a region close to the base of the "parent" follicle (Fig. 4, B and C)Citation . Although the viral oncogenes may not be abundantly expressed in the quiescent stem cells, oncogene expression appeared to be induced when follicle regeneration was initiated. Therefore, E6 and E7 oncogenes in our transgenic mice may be acting directly in the stem cell population responsible for hair follicle regeneration. However, it still remains to be demonstrated whether the more differentiated cells of the ORS, which express K6, are capable of initiating follicle regeneration.

E6 and E7 are both able to immortalize cells in culture (28, 29, 30, 31) , but the oncogenes have different effects in transgenic mice. For example, in the eyes of transgenic mice with directed expression of E7, E6, or both, E7 can promote apoptosis of lens (32) and photoreceptor (33) cells, an effect that is at least partially dependent on p53 expression. E6 expression, on the other hand, reduces natural cell death in developing lenses and inhibits terminal differentiation of lens fiber cells (32) . However, E7 can promote proliferation and tumor formation when p53 is absent (33 , 34) or E6 is coexpressed (32) , probably by reducing its apoptotic activity. As described below, most of the effects on hair follicle growth observed in the present work can be interpreted as being due to an interference by E6/E7 oncogenes with the control of cell proliferation rather than to a prevention or promotion of cell death. Therefore, our data are in agreement with the expression of both oncogenes in transgenic mouse hair follicles.

In general, cell differentiation during hair follicle regeneration appears to be unaffected in our transgenic mice. The previous conclusion is derived from the presence of the major hair types with typical morphology (data not shown) and, in general, normal proportion awl/auchene versus zigzag in transgenic mice (Table 2)Citation . Furthermore, the expression pattern of cytokeratins in transgenic hair follicles displayed using a broad spectrum antibody resembled the pattern observed in wild-type animals (data not shown). Similarly, the patterns of proliferation (Fig. 7)Citation and cell death (Fig. 8)Citation were not greatly affected, and hair follicle morphogenesis along the growth cycle appeared normal. Therefore, the effects of E6/E7 oncogenes should be regulatory, which could change the initiation or end of phases during the hair growth cycle. Nonetheless, shorter hair in transgenic mice might be due to delayed differentiation resulting from the promotion of cell proliferation by the oncogenes during the extended anagen phase.

From the growth regulatory point of view, the hair follicle has two relevant tissues, the ORS and the dermal papilla (3) . The ORS is an epithelial layer of cells in continuity with the epidermis and may be equivalent to the epithelial tissue invaginated early during primary hair follicle formation. It is from the ORS that the hair matrix forms and other tissues, such as those giving rise to the hair shaft, are subsequently originated. At the telogen phase, the ORS is the most important tissue left after catagen, because the putative stem cells reside in this compartment.

The dermal papilla and its precursor cells are key tissues producing relevant regulatory molecules. For instance, hair formation is initiated by a mesenchymal signal (first dermal message) acting on the epidermis, and proliferation of hair matrix cells is stimulated later by a signal from the dermal papilla (second dermal message). These two kinds of signals seem to be used continuously during cycling, with the first signal allowing the follicle to exit from telogen and begin the formation of a new hair follicle and the second signal regulating the anagen phase. Therefore, cross-talk between the dermal papilla and the ORS should be expected during hair follicle development. Disturbances in this communication should result in serious consequences on hair growth, as might be happening in the follicles of our bK6-E6/E7 transgenic mice (see below).

Two critical regulatory points can be viewed during the hair follicle growth cycle: (a) initiation of growth; and (b) initiation of regression (also the end of the growth phase). Initiation of growth could result from both a decrease in negative signals and an increase in positive signals. Resting at telogen would be expected to be due to a higher concentration of negative signals and a lower concentration of positive signals. Cells at telogen are in a quiescent state; consequently, a transition from stages G1 to G0 of the cell cycle would be expected to establish the resting phase (35) . Regression could also require two types of signals, one inhibiting proliferation and/or differentiation of the ORS and hair matrix cells, and the other activating cell death in the lower region of the grown hair follicle.

Our results suggest that E6/E7 oncogenes were able to interfere with the G1->G0 transition in cells of the ORS at telogen, thus explaining why these cells could not respond to negative signals (i.e., estradiol) and why the long resting phase is never established; it is likely that in the presence of these oncogenes, positive signals to initiate growth (e.g., a first dermal-like signal) are not required. Similarly, our data indicate that E6/E7 oncogenes, by blocking the response to inhibitors of cell proliferation and consequently allowing the G1->S transition of the cell cycle in cells of the ORS (e.g., as the second dermal-like signal may be doing), were able to extend the growth phase (i. e., anagen), thus delaying the initiation of follicle regression. We propose that a balance between signals promoting cell proliferation and cell death defines the time at which catagen starts.

How could the effects on the hair follicle cycle by the E6 and E7 oncogenes produce lower hair density and more rapid hair growth? Cell death at the time of follicle degeneration may have been affected by the E6/E7 transgene as shown (Fig. 9E)Citation , but fur phenotype is more likely to be associated with the uncovered inability of hair follicles of transgenic mice to enter the long-lasting resting phase characteristic after the second cycle of hair growth. Under this view, the apparent faster hair growth in transgenic mice as compared with wild-type mice after depilation could result from incomplete plucking, because the hairs of some already growing follicles might be under the skin surface at the time of plucking in transgenic mice. Alternatively, because transgenic hair follicles were more likely in the anagen phase at the time of plucking, hair differentiation could occur earlier in transgenic mice follicles than it does in wild-type mice follicles, which were at telogen at the time of plucking. On the other hand, lower hair density in transgenic mice could be due to easier shedding, because hair holding by the club, a structure specifically formed at the telogen phase, could never be established in transgenic mice. This latter hypothesis is in agreement with the easier hair plucking precisely at the telogen phase in transgenic mice as compared with wild-type animals (Fig. 11)Citation . Recently, mutant mice were generated that are unable to form the club and then attach the hair to the follicle (36) . These mice lose their hair in bands moving in an antero-posterior direction just after the first growth cycle. The mice characterized in the present work appear to behave similarly to those mutant mice in some respects, although it is not expected they would lose their hair completely due to the continuous growth promoted by the oncogenes; bands of growth were not regularly seen, but sometimes they were conspicuous (Fig. 5A)Citation . Grooming could influence this atypical hair shedding but could not define the cause of the fur phenotype because it was not identical in the two transgenic lines analyzed.

Some signaling molecules acting during hair follicle formation and cycling have been characterized as peptide growth factors or molecules such as steroid hormones or retinoic acid (37 , 38) . Nonetheless, a specific role for these molecules has been established in only a few cases. Steroid hormones, such as estradiol and testosterone, have been shown to act indirectly through the dermal papilla to arrest hair follicles at telogen (9 , 39) . Because these molecules act negatively on growth, it is possible that they repress the expression of those positive signals synthesized by the dermal papilla. In our transgenic mice, we propose that the inability to respond to estradiol is because, due to the expression of E6 and E7 oncogenes, initiation of growth is independent of these positive signals, and consequently arrest at telogen is never established.

On the basis of the expression patterns observed in hair follicles, candidate molecules regulating growth could be members of the transforming growth factor ß (40 , 41) and the FGF (42 , 43) gene families. Overexpression of members of these families blocks hair growth and/or formation (44 , 45) . Relevant to the present work is the phenotype observed in mice lacking fgf-5, which have a phenotype identical to the angora strain of mice and characterized by abnormally long hair (46) . Histological analysis of these mice revealed an extended anagen phase, which the authors interpreted as the cause of the long hair. Interestingly, our transgenic mice also have an extended anagen phase, but hair length was even shorter than normal. Therefore, an extended anagen phase seems insufficient to cause an increase in the hair length; consequently, fgf-5 might have an additional function in controlling hair growth. Alternatively, we might not have observed long hairs because hair growth is delayed by the effects of oncogenes on cell differentiation, as mentioned above.

A contrasting phenotype to the one displayed by our bK6-E6/E7 transgenic mice was the presented in a recent report (47) . Authors show that transgenic mice that express bcl-xL in the ORS have hair follicle growth cycles with a shorter anagen phase and a longer telogen phase when compared with those of wild-type mice. Although the authors attribute this hair growth cycle behavior to increased survival of ORS cells able to express fgf-5, they do not show a direct comparative measurement of cell death. Furthermore, crosses between K14-bcl-xL transgenic and fgf-5-deficient mice display a similar effect on hair growth cycle when compared with the original fgf-5-deficient mice, hampering an obvious conclusion from these studies. Recent reports have shown that Bcl-2 family members, in addition to their antiapoptotic function, have the ability to delay entry to the S phase of cell cycle (48 , 49) . Therefore, it is possible that the antiproliferative activity of Bcl-xL in hair follicles of the K14-Bcl-xL transgenic mice shortens anagen and makes the exit from telogen difficult. This latter interpretation would be in agreement with the data presented here, which highlight the critical role of cell cycle regulators as major determinants of hair growth cycle dynamics.

Materials and Methods

Animal Procedures.
Mouse strain CD-1 was used in this study. Transgenic mice were produced by pronuclear injection of recombinant DNA following standard protocols (50) . Depilation was performed by wax stripping of about 3 cm2 of mid-dorsal skin on anesthetized mice. A regular permanent hair stain was used to determine hair growth and shedding; in some cases, hair staining was performed after clipping. Estradiol (50 µM; Sigma) was topically applied (50 µl/cm2) every 2 days on a dorsal skin area with hair previously clipped and stained. Hair types were analyzed following the characteristics described by Sundberg and Hogan (51) .

Construction of Recombinant DNA.
E6/E7 open reading frames were amplified by PCR using as a template a plasmid carrying the complete genome of HPV-16. A ClaI recognition site was added to the 5' end of the specific E6/E7 sequences (nucleotides 80–101 and 864–886 for E6/E7–5' and E6/E7–3' oligonucleotides, respectively; GenBank accession number U89348). The oligonucleotides had the following specific sequence: (a) E6/E7–5', 5'-CTCATCGATTTTTATGCACCAAAAGAGAACTG-3'; and (b) E6/E7–3', 5'-CTCATCGATTACCTGCAGGATCAGCCATG-3'. The PCR product cut with ClaI was inserted into the ClaI site of pBluescript KS+ (Stratagene), and the E6/E7 fragment of several resulting recombinant plasmids was sequenced. One plasmid (pKS-E6/E7) with the correct desired sequence was selected to be used as a source of the E6/E7 ClaI fragment. This latter fragment was inserted into the unique ClaI site of an expression vector carrying 9.5 kb of the bK6 (also called CIV*) promoter and 5' upstream regulatory sequences (44) . The resulting plasmid (bK6-E6/E7) was the source of the NotI 13.8-kb vector-free fragment used for pronuclear injection.

RNA Purification, Northern Blot, cDNA Synthesis, and PCR Procedures.
RNA was purified from tissue of either wild-type or transgenic animals using a modified version of the method published by Chomczynski and Sacchi (52) . Briefly, transgenic or CD-1 wild-type mice were sacrificed by cervical dislocation, and multiple organs and tissues were dissected and frozen immediately. Tissue fragments were crushed in liquid nitrogen, lysed cells were mixed with 1 ml of 6 M urea/3 M LiCl solution, incubated at -20 °C overnight, and centrifuged at 10,000 x g for 10 min, and the pellet was resuspended in 500 µl of GuSCN solution [4 M guanidinium isothiocyanate, 25 mM sodium citrate (pH 7.0), 0.5% sarcosyl, and 0.1 M 2-mercaptoethanol]. Two M sodium acetate (1:10; pH 4.0), phenol (1:1), and chloroform (1:20) were then added. Chloroform is a 24:1 mixture of chloroform and isoamyl alcohol. The suspension was vortexed for 1 min, kept on ice for 15 min, and centrifuged at 10,000 x g for 20 min. The aqueous phase was collected and precipitated with an equal volume of isopropanol at -20°C. The pellet was resuspended in 150 µl of GuSCN and reprecipitated. The RNA was washed with 75% ethanol and dissolved in 100 µl of water. For Northern blot analysis, samples (10 µg of total RNA) were loaded on a 1% agarose-formaldehyde gel, electrophoresed, transferred to Hybond-N+ membrane (Amersham), and hybridized with a 32P-labeled random-primed DNA probe corresponding to the E6/E7 coding region using standard protocols. For RT-PCR, 1 µg of total RNA was used for cDNA synthesis using Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) in a 30-µl final reaction volume according to the manufacturer’s recommendations. Three µl of the cDNA reaction mixture were routinely used in a PCR reaction containing 2.5 units of Taq DNA polymerase (Roche), 200 µM deoxyribonucleoside-5'-triphosphates, and 1.86 mM MgCl2 in the buffer provided and 30 pmol each of forward and reverse primers; all reactions were carried out in a programmable heating block (Hybaid). The PCR protocols for HPRT (a housekeeping enzyme), E6, and E6/E7 were 93°C for 1 min, 57°C for 1 min, 72°C for 1 min for 20, 25, and 30 cycles, respectively; in all cases, PCR was ended with 10 min at 72°C. Oligonucleotide primers were as follows: (a) HPRT, CCTGCTGGATTACATTAAAGCACTG (forward) and GTCAAGGGCATATCCAACAACAAAC (reverse); (b) E6 and E6/E7, TTTTATGCACCAAAAGAGAACTG (forward); (c) E6, GTATCTCCATGCATGATTACAG (reverse); and (d) E6/E7, TACCTGCAGGATCAGCCATG (reverse). All PCR products were of the expected size, and their identity was confirmed by digestion with several restriction endonucleases.

In Situ Hybridization.
Skin fragments of transgenic mice were fixed in 4% paraformaldehyde in PBS (pH 7.0) for 18–24 h at 4°C, dehydrated in ethanol, and embedded in paraffin; 5-µm sections were mounted on poly-L-lysine-treated slides. After paraffin removal and rehydration, the sections were pretreated with proteinase K (1 µg/ml) for 7 min at room temperature and washed sequentially in PBS, 0.2% glycine in PBS, PBS, TEA (0.1 M triethanolamine and 0.25% acetic anhydride), and PBS, for 3 min each. Sections were dehydrated in ethanol and dried for 1–2 h at room temperature. Prehybridization was performed by incubation in 100 µl of hybridization solution [4x SSC (1x SSC = 150 mM NaCl, 15 mM sodium citrate (pH 7.0), 10% dextran sulfate, 1x Denhardt’s solution (0.02% Ficoll 400, 0.02% polyvinylpyrrolidone, and 0.02% BSA), 2 mM EDTA, 50% deionized formamide, and 0.5 mg/ml herring sperm DNA] at 42°C for 2 h. E6/E7 riboprobe was synthesized from the pKS-E6/E7 plasmid using DIG-labeled UTP and T7 RNA polymerase (sense) or SP6 RNA polymerase (antisense). Two to 5 µl of DIG-labeled RNA (200 ng/ml, final concentration) were added to 100 µl of hybridization solution, loaded on the sample, and incubated at 42°C for 16 h. The slides were washed once in 2x SSC at 37°C for 5 min, washed three times in 60% formamide/0.2x SSC at 37°C for 5 min, and washed twice in 2x SSC at room temperature for 5 min. Detection of hybridized DIG-labeled RNA was performed with an alkaline phosphatase-conjugated anti-DIG antibody (Roche) and developed with the nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate substrate solution in the presence of 2 mM fresh levamisole for 16 h in the dark at room temperature.

Immunoprecipitation/Western Blot and Immunohistochemistry Procedures.
Detection of E7 protein was performed by a combined immunoprecipitation/Western blot procedure. Total protein from mouse skin was extracted in radioimmunoprecipitation assay buffer as described previously by Arbeit et. al. (53) . Briefly, 500 µg of total protein were immunoprecipitated with rabbit polyclonal antibody C6563 (generated in our laboratory). Immunoprecipitated protein was separated in a 12% SDS-PAGE gel and transferred to Immobilon P membranes (polyvinylidene difluoride; 0.45 µm; Millipore, Bedford, MA) as described by Towbin et al. (54) . Filters were blocked with Tris-buffered saline [20 mM Tris-HCl (pH 7.4) and 150 mM NaCl] containing 5% skim milk for 2 h at 4°C and then incubated with the same rabbit polyclonal antibody used for the immunoprecipitation. Specific antibody binding was detected by using horseradish peroxidase-linked goat antirabbit IgG (Dako) and visualized by the enhanced chemiluminescence detection system (Amersham Pharmacia Biotech). For detection of viral proteins by immunohistochemistry, HPV-16 E7 and HPV-16 E6 monoclonal antibodies (1:100 dilution, Santa Cruz Biotechnology) were used. Tissues were fixed and embedded in paraffin as indicated for in situ hybridizations. For immunohistochemistry, the antibody was incubated for 2 h with the sample and detected using the Vectastain Elite ABC Kit (Vector Laboratories catalogue number PK 6102) according to manufacturer’s instructions.

Histological Analysis.
Tissues were fixed in 4% paraformaldehyde and embedded in paraffin. Sections of 5–10 µm were stained with H&E according to standard procedures. Photography was performed on an Axioscope microscope (Zeiss, Germany) using Kodacolor 100 film.

Detection of Cell Proliferation and Death.
Four percent paraformaldehyde-fixed, paraffin-embedded, 10-µm sections of skin fragments were used to determine the pattern of cell proliferation and death. An antibody specific for PCNA (Vector-Novocastra) was used to visualize proliferating cells following a standard immunohistochemistry procedure. The terminal deoxynucleotidyl transferase-mediated nick end labeling (55) method for detection of fragmented DNA using fluoresceinated dUTP (Roche) was performed according to the manufacturer’s instructions. Serial sections were analyzed by Nomarski’s optic using a Diaphot Nikon microscope or by confocal microscopy using a MRC-600 confocal laser scanning system equipped with a krypton/argon laser (Bio-Rad) coupled to an Axioscope microscope. Representative prints are shown.

Acknowledgments

We are grateful to Elizabeth Mata, Sergio González, Graciela Cabeza, Paul Gaytán, Eugenio López, and Xochitl Alvarado for technical assistance; Melanie Simpson for careful reading of the manuscript; and Rob Smart for advice on hair type analysis.

Footnotes

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Consejo Nacional de Ciencia y Tecnología (Grants 1163 M/9209 and 31730-N), Programa de Naciones Unidas para el Desarrollo (pnud/mex/93/019) and Dirección General de Asuntos del Personal Académico de la Universidad Nacional Autónoma de México (IN 208697). P. G. acknowledges The International Union Against Cancer for a sabbatical fellowship sponsored by Novartis. Back

2 These authors contributed equally to this work. Back

3 Present address: Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Ciudad Universitaria, México, D.F., México. Back

4 To whom requests for reprints should be addressed, at Departmento de Genética y Fisiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México, AP 510-3, Cuernavaca, Mor. 62250, Mexico. Phone: 52-5-622-7636/7631; Fax: 52-73-17-2388; E-mail: covs{at}ibt.unam.mx Back

5 The abbreviations used are: ORS, outer root sheath; HPV, human papillomavirus; K6, keratin 6; bK6, bovine K6; RT-PCR, reverse transcription-PCR; PCNA, proliferating cell nuclear antigen; FGF, fibroblast growth factor; HPRT, hypoxanthine phosphoribosyl transferase; DIG, digoxygenin. Back

Received for publication 5/18/00. Revision received 6/13/00. Accepted for publication 8/31/00.

References

  1. King K. L., Cidlowski J. A. Cell cycle and apoptosis: common pathways to life and death. J. Cell. Biochem., 58: 175-180, 1995.[Medline]
  2. Amati B., Land H. Myc-Max-Mad: a transcription factor network controlling cell cycle progression, differentiation and death. Curr. Opin. Genet. Dev., 4: 102-108, 1994.[Medline]
  3. Hardy M. H. The secret life of the hair follicle. Trends Genet., 8: 55-61, 1992.[Medline]
  4. Cotsarelis G., Sun T. T., Lavker R. M. Label-retaining cells reside in the bulge area of pilosebaceous unit: implications for follicular stem cells, hair cycle, and skin carcinogenesis. Cell, 61: 1329-1337, 1990.[Medline]
  5. Rochat A., Kobayashi K., Barrandon Y. Location of stem cells of human hair follicles by clonal analysis. Cell, 76: 1063-1073, 1994.[Medline]
  6. Münger K., Scheffner M., Huibregtse J. M., Howley P. M. Interactions of HPV E6 and E7 oncoproteins with tumour suppressor gene products. Cancer Surv., 12: 197-217, 1992.[Medline]
  7. Tommasino M., Crawford L. Human papillomavirus E6 and E7: proteins which deregulate the cell cycle. Bioessays, 17: 509-518, 1995.[Medline]
  8. Bates S., Vousden K. H. p53 in signaling checkpoint arrest or apoptosis. Curr. Opin. Genet. Dev., 6: 12-18, 1996.[Medline]
  9. Oh H. S., Smart R. C. An estrogen receptor pathway regulates the telogen-anagen hair follicle transition and influences epidermal cell proliferation. Proc. Natl. Acad. Sci. USA, 93: 12525-12530, 1996.[Abstract/Free Full Text]
  10. Hsu E. M., McNicol P. J., Guijon F. B., Paraskevas M. Quantification of HPV-16 E6–E7 transcription in cervical intraepithelial neoplasia by reverse transcriptase polymerase chain reaction. Int. J. Cancer, 55: 397-401, 1993.[Medline]
  11. Quinlan R. A., Schiller D. L., Hatzfeld M., Achtstätter T., Moll R., Jorcano J. L., Magin T. M., Franke W. W. Patterns of expression and organization of cytokeratin intermediate filaments. Ann. N. Y. Acad. Sci., 455: 282-306, 1985.[Abstract]
  12. Stark H. J., Breitkreutz D., Limat A., Bowden P., Fusenig N. E. Keratins of the human hair follicle: hyperproliferative keratins consistently expressed in outer root sheath cells in vivo and in vitro. Differentiation, 35: 236-248, 1987.[Medline]
  13. Soler A. P., Gilliard G., Megosh L. C., O’Brien T. G. Modulation of murine hair follicle function by alterations in ornithine decarboxylase activity. J. Invest. Dermatol., 106: 1108-1113, 1996.[Medline]
  14. Heyden A., Lützow-Holm C., Clausen O. P., Brandtzaeg P., Huitfeldt H. S. Expression of keratins K6 and K16 in regenerating mouse epidermis is less restricted by cell replication than the expression of K1 and K10. Epithelial Cell Biol., 3: 96-101, 1994.[Medline]
  15. Mansbridge J. N., Knapp A. M. Changes in keratinocyte maturation during wound healing. J. Invest. Dermatol., 89: 253-263, 1987.[Medline]
  16. Molloy C. J., Laskin J. D. Specific alterations in keratin biosynthesis in mouse epidermis in vivo and in explant culture following a single exposure to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate. Cancer Res., 47: 4674-4680, 1987.[Abstract/Free Full Text]
  17. Eichner R., Kahn M., Capetola R. J., Gendimenico G. J., Mezick J. A. Effects of topical retinoids on cytoskeletal proteins: implications for retinoid effects on epidermal differentiation. J. Invest. Dermatol., 98: 154-161, 1992.[Medline]
  18. Rosenthal D. S., Griffiths C. E., Yuspa S. H., Roop D. R., Voorhees J. J. Acute or chronic topical retinoic acid treatment of human skin in vivo alters the expression of epidermal transglutaminase, loricrin, involucrin, filaggrin, and keratins 6 and 13 but not keratins 1, 10, and 14. J. Invest. Dermatol., 98: 343-350, 1992.[Medline]
  19. Ramírez A., Vidal M., Bravo A., Larcher F., Jorcano J. L. A 5'-upstream region of a bovine keratin 6 gene confers tissue-specific expression and hyperproliferation-related induction in transgenic mice. Proc. Natl. Acad. Sci. USA, 92: 4783-4787, 1995.[Abstract/Free Full Text]
  20. Trask D. K., Band V., Zajchowski D. A., Yaswen P., Suh T., Sager R. Keratins as markers that distinguish normal and tumor-derived mammary epithelial cells. Proc. Natl. Acad. Sci. USA, 87: 2319-2323, 1990.[Abstract/Free Full Text]
  21. Kopan R., Fuchs E. The use of retinoic acid to probe the relation between hyperproliferation-associated keratins and cell proliferation in normal and malignant epidermal cells. J. Cell Biol., 109: 295-307, 1989.[Abstract/Free Full Text]
  22. Werner S., Weinberg W., Liao X., Peters K. G., Blessing M., Yuspa S. H., Weiner R. L., Williams L. T. Targeted expression of a dominant-negative FGF receptor mutant in the epidermis of transgenic mice reveals a role of FGF in keratinocyte organization and differentiation. EMBO J., 12: 2635-2643, 1993.[Medline]
  23. Guo L., Yu Q. C., Fuchs E. Targeting expression of keratinocyte growth factor to keratinocytes elicits striking changes in epithelial differentiation in transgenic mice. EMBO J., 12: 973-986, 1993.[Medline]
  24. Robles A. I., Larcher F., Whalin R. B., Murillas R., Richie E., Gimenez-Conti I. B., Jorcano J. L., Conti C. J. Expression of cyclin D1 in epithelial tissues of transgenic mice results in epidermal hyperproliferation and severe thymic hyperplasia. Proc. Natl. Acad. Sci. USA, 93: 7634-7638, 1996.[Abstract/Free Full Text]
  25. Keough R., Powell B., Rogers G. Targeted expression of SV40 T antigen in the hair follicle of transgenic mice produces an aberrant hair phenotype. J Cell Sci., 108: 957-966, 1995.[Abstract]
  26. Bailleul B., Surani M. A., White S., Barton S. C., Brown K., Blessing M., Jorcano J., Balmain A. Skin hyperkeratosis and papilloma formation in transgenic mice expressing a ras oncogene from a suprabasal keratin promoter. Cell, 62: 697-708, 1990.[Medline]
  27. Coulombe P. A., Kopan R., Fuchs E. Expression of keratin K14 in the epidermis and hair follicle: insights into complex programs of differentiation. J. Cell Biol., 109: 2295-2312, 1989.[Abstract/Free Full Text]
  28. Münger K., Phelps W. C., Bubb V., Howley P. M., Schlegel R. The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. J. Virol., 63: 4417-4421, 1989.[Abstract/Free Full Text]
  29. Halbert C. L., Demers G. W., Galloway D. A. The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol., 65: 473-478, 1991.[Abstract/Free Full Text]
  30. Demers G. W., Halbert C. L., Galloway D. A. Elevated wild-type p53 protein levels in human epithelial cell lines immortalized by the human papillomavirus type 16 E7 gene. Virology, 198: 169-174, 1994.[Medline]
  31. Reznikoff C. A., Belair C., Savelieva E., Zhai Y., Pfeifer K., Yeager T., Thompson K. J., DeVries S., Bindley C., Newton M. A., et al Long-term genome stability and minimal genotypic and phenotypic alterations in HPV16 E7-, but not E6-, immortalized human uroepithelial cells. Genes Dev., 8: 2227-2240, 1994.[Abstract/Free Full Text]
  32. Pan H., Griep A. E. Altered cell cycle regulation in the lens of HPV-16 E6 or E7 transgenic mice: implications for tumor suppressor gene function in development. Genes Dev., 8: 1285-1299, 1994.[Abstract/Free Full Text]
  33. Howes K. A., Ransom N., Papermaster D. S., Lasudry J. G., Albert D. M., Windle J. J. Apoptosis or retinoblastoma: alternative fates of photoreceptors expressing the HPV-16 E7 gene in the presence or absence of p53. Genes Dev., 8: 1300-1310, 1994.[Abstract/Free Full Text]
  34. Pan H., Griep A. E. Temporally distinct patterns of p53-dependent and p53-independent apoptosis during mouse lens development. Genes Dev., 9: 2157-2169, 1995.[Abstract/Free Full Text]
  35. Wilson C., Cotsarelis G., Wei Z. G., Fryer E., Margolis-Fryer J., Ostead M., Tokarek R., Sun T. T., Lavker R. M. Cells within the bulge region of mouse hair follicle transiently proliferate during early anagen: heterogeneity and functional differences of various hair cycles. Differentiation, 55: 127-136, 1994.[Medline]
  36. Koch P. J., Mahoney M. G., Cotsarelis G., Rothenberger K., Lavker R. M., Stanley J. R. Desmoglein 3 anchors telogen hair in the follicle. J. Cell Sci., 111: 2529-2537, 1998.[Abstract]
  37. Stenn K. S., Prouty S. M., Seiberg M. Molecules of the cycling hair follicle: a tabulated review. J. Dermatol. Sci., 7(Suppl.): S109-S124, 1994.
  38. Peus D., Pittelkow M. R. Growth factors in hair organ development and the hair growth cycle. Dermatologic Clinics, 14: 559-572, 1996.[Medline]
  39. Obana N., Chang C., Uno H. Inhibition of hair growth by testosterone in the presence of dermal papilla cells from the frontal bald scalp of the postpubertal stumptailed macaque. Endocrinology, 138: 356-361, 1997.[Abstract/Free Full Text]
  40. Paus R., Foitzik K., Welker P., Bulfone-Paus S., Eichmüller S. Transforming growth factor-ß receptor type I and type II expression during murine hair follicle development and cycling. J. Invest. Dermatol., 109: 518-526, 1997.[Medline]
  41. Wollina U., Lange D., Funa K., Paus R. Expression of transforming growth factor ß isoforms and their receptors during hair growth phases in mice. Histol. Histopathol., 11: 431-436, 1996.[Medline]
  42. du Cros D. L. Fibroblast growth factor and epidermal growth factor in hair development. J. Invest. Dermatol., 101: 106S-113S, 1993.[Medline]
  43. Rosenquist T. A., Martin G. R. Fibroblast growth factor signalling in the hair growth cycle: expression of the fibroblast growth factor receptor and ligand genes in the murine hair follicle. Dev. Dyn., 205: 379-386, 1996.[Medline]
  44. Blessing M., Nanney L. B., King L. E., Jones C. M., Hogan B. L. Transgenic mice as a model to study the role of TGF-ß-related molecules in hair follicles. Genes Dev., 7: 204-215, 1993.[Abstract/Free Full Text]
  45. Guo L., Degenstein L., Fuchs E. Keratinocyte growth factor is required for hair development but not for wound healing. Genes Dev., 10: 165-175, 1996.[Abstract/Free Full Text]
  46. Hébert J. M., Rosenquist T., Götz J., Martin G. R. FGF5 as a regulator of the hair growth cycle: evidence from targeted and spontaneous mutations. Cell, 78: 1017-1025, 1994.[Medline]
  47. Pena J. C., Kelekar A., Fuchs E. V., Thompson C. B. Manipulation of outer root sheath cell survival perturbs the hair-growth cycle. EMBO J., 18: 3596-3603, 1999.[Medline]
  48. O’Reilly L. A., Huang D. C., Strasser A. The cell death inhibitor Bcl-2 and its homologues influence control of cell cycle entry. EMBO J., 15: 6979-6990, 1996.[Medline]
  49. Huang D. C., O’Reilly L. A., Strasser A., Cory S. The anti-apoptosis function of Bcl-2 can be genetically separated from its inhibitory effect on cell cycle entry. EMBO J., 16: 4628-4638, 1997.[Medline]
  50. Hogan, B., Beddington, R., Constantini, F., and Lacy, E. Manipulating the Mouse Embryo. Plainview, NY: Cold Spring Harbor Laboratory Press, 1994.
  51. Sundberg J. P., Hogan M. E. Hair types and subtypes in the laboratory mouse Sundberg J. P. eds. . Handbook of Mouse Mutations with Skin and Hair Abnormalities: Animal Models and Biomedical Tools, : 57-68, CRC Press Boca Raton, FL 1994.
  52. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159, 1987.[Medline]
  53. Arbeit J. M., Münger K., Howley P. M., Hanahan D. Neuroepithelial carcinomas in mice transgenic with human papillomavirus type 16 E6/E7 ORFs. Am. J. Pathol., 142: 1187-1197, 1993.[Abstract]
  54. Towbin H., Staehelin T., Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA, 76: 4350-4354, 1979.[Abstract/Free Full Text]
  55. Gavrieli Y., Sherman Y., Ben-Sasson S. A. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol., 119: 493-501, 1992.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow