CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruiz-Lozano, P.
Right arrow Articles by Gualberto, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruiz-Lozano, P.
Right arrow Articles by Gualberto, A.
Cell Growth & Differentiation Vol. 10, 295-306, May 1999
© 1999 American Association for Cancer Research

p53 Is a Transcriptional Activator of the Muscle-specific Phosphoglycerate Mutase Gene and Contributesin Vivo to the Control of Its Cardiac Expression1

Pilar Ruiz-Lozano, Mary L. Hixon, Mark W. Wagner, Ana I. Flores, Shuntaro Ikawa, Albert S. Baldwin, Jr., Kenneth R. Chien and Antonio Gualberto2

Departments of Physiology and Biophysics [P. R-L., M. W. W., A. I. F., A. G.] and Genetics [M. L. H.], Case Western Reserve University School of Medicine, Cleveland, Ohio 44106; Department of Medicine and Center for Molecular Genetics, University of California at San Diego, California 92093 [P. R-L., K. R. C.]; Department of Cell Biology, IDAC, Tohoku University, Sendai, Japan 980 [S. I.]; and Lineberger Comprehensive Cancer Center and Department of Biology, University of North Carolina at Chapel Hill, North Carolina 27599 [A. S. B.]


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The role that the p53 tumor suppressor gene product plays in cellular differentiation remains controversial. However, recent evidence indicates that p53 is required for proper embryogenesis. We have studied the effect of p53 on the expression mediated by the promoter of the rat muscle-specific phosphoglycerate mutase gene (M-PGAM), a marker for cardiac and skeletal muscle differentiation. Experiments involving transient transfection, mobility shift assay, and site-directed mutagenesis demonstrated that p53 specifically binds and transactivates the M-PGAM promoter. The p53-related proteins p51A and p73L also transactivated M-PGAM. Moreover, stable expression of a p53 dominant mutant in C2C12 cells blocked the induction of M-PGAM expression during the myoblast to myotube transition and the ability of p53, p51A, and p73L to transactivate the M-PGAM promoter. In addition, impaired expression of M-PGAM was observed in a subset of p53-null animals in heart and muscle tissues of anterior-ventral location. These results demonstrate that p53 is a transcriptional activator of M-PGAM that contributes in vivo to the control of its cardiac expression. These data support previous findings indicating a role for p53 in cellular differentiation.


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The differentiation of cardiac muscle cells is a process that is beginning to be understood in detail. Cardiogenesis begins with a commitment of mesodermally derived progenitor cells to the myocyte lineage in response to endodermal signals, followed by the formation of the primordial heart tube (1 , 2) . Organogenesis then proceeds through a series of involutions of the heart tube and the onset of septation, chamber formation, and the acquisition of regional-specific properties of atrial, ventricular, and conduction system cells (3) . This process progresses during the embryonic life and is completed early after birth. Each step in cellular differentiation is characterized by the expression of a specific set of molecular markers. The transcriptional control of these genes depends upon the synchronized action of cardiac-specific and ubiquitous transcription factors (3) .

We isolated previously the rat M-PGAM3 subunit (4 , 5) . M-PGAM encodes a dimeric metabolic enzyme and resembles the MCK gene in its timing and pattern of developmental expression (6) . It is, therefore, not surprising that both genes contain similar DNA regulatory elements that control their specific expression in skeletal and cardiac muscle (4 , 5) . Previous studies have shown that MCK also contains p53-responsive elements (7, 8, 9, 10) . An MCK p53 site was shown to mediate p53-responsiveness when subcloned into a heterologous minimal promoter (8) . Transactivation of MCK by p53 can be inhibited by MDM2 (11) , a protein frequently amplified in human sarcomas (12) . Importantly, although it has been shown that p53 binds and transactivates the MCK promoter, little is presently known about the role of p53 in the activation of this or other muscle-specific genes during myocyte differentiation.

We have investigated the ability of p53 to regulate transcription from the M-PGAM promoter in rat neonatal cardiocytes, C2C12 cells, and SAOS cells. We show that p53 and p53-related proteins transactivate the rat M-PGAM promoter. Moreover, we identified a p53-responsive element in the M-PGAM promoter. This DNA element contains a consensus p53 DNA binding site that is highly homologous (86% identity) to that located in the MCK enhancer. Mobility shift assays detected binding of endogenous rat cardiac p53 and purified human p53 to the M-PGAM p53 site. In addition, mutagenesis of the M-PGAM p53 site blocked the transactivation of the M-PGAM promoter by p53 in C2C12 cells and decreased its expression in rat neonatal cardiocytes. Importantly, reduced M-PGAM expression was observed by in situ hybridization and Northern analysis in a subset of p53-null animals. Strikingly, differences were observed specifically in muscle tissues of anterior and ventral location, such as tongue or heart. These results demonstrate that p53 directly interacts with and transactivates the M-PGAM promoter and support a role for this protein as a regulator of gene expression during muscle differentiation.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
p53 Transactivates the Rat M-PGAM Gene Promoter.
To test the effect of p53 on the transcription mediated by the M-PGAM promoter, we transfected primary rat neonatal cardiocytes, C2C12 cells, and SAOS cells with a reporter plasmid containing -400- to +5-bp sequences of the M-PGAM promoter subcloned upstream of the CAT gene (plasmid M-PGAM CAT). We have previously shown that this promoter fragment accounts for most of the M-PGAM promoter strength and mediates its muscle-specific expression (5) . M-PGAM CAT was cotransfected in combination with CMV-driven expression vectors containing no insert, human wild-type p53, or a dominant mutant p53 cDNA sequences in normal rat neonatal cardiocytes, C2C12 cells, or SAOS cells. C2C12 is a myoblast cell line that carries wild-type p53 (13) , whereas SAOS is a human osteosarcoma cell line that lacks both p53 alleles (14) . Cells were then incubated for 48 h, harvested, and processed for the assay of CAT enzyme activity. Fig. 1ACitation shows that the basal expression mediated by M-PGAM was higher in neonatal cardiocytes than in C2C12 or SAOS cells. Cotransfection of M-PGAM CAT with the wild-type p53 expression vector did not alter M-PGAM CAT expression in neonatal cardiocytes. However, cotransfection of M-PGAM CAT with the mutant p53 expression vector in neonatal cardiocytes originated a 60% decrease in CAT activity. In contrast, cotransfection of M-PGAM CAT with the wild-type p53 expression vector in C2C12 and SAOS cells resulted in strong activation of M-PGAM CAT activity. No transactivation was observed when M-PGAM CAT was cotransfected with a mutant p53 expression plasmid in C2C12 and SAOS cells (Fig. 1A)Citation . Titration experiments indicated that maximal transactivation by p53 was reached using 3 µg of the CMV-p53 expression plasmid (Fig. 1B)Citation . As a whole, these data indicated that the transcriptional activity mediated by the M-PGAM promoter is regulated by p53. The lack of transactivation of M-PGAM by wild-type p53 in neonatal cardiocytes suggested that the level of endogenous p53 protein in neonatal cardiocytes saturates a putative M-PGAM p53-responsive promoter element. The inhibition of M-PGAM CAT activity obtained by the overexpression of the mutant p53 form supported this hypothesis. It has previously been shown that structural p53 mutant proteins may work as dominant negative mutants, inhibiting the transcriptional activity of the wild-type protein (8 , 15, 16, 17) . Intriguingly, although C2C12 cells contain wild-type p53, M-PGAM was transactivated by cotransfection with the CMV-p53 vector in these cells. These results suggested that endogenous p53 is not transcriptionally active in C2C12 cells at basal conditions. Cotransfection of wild-type p53 with a -2 kb to +5 bp M-PGAM CAT construct in C2C12 cells did not result in a higher level of transcriptional activation by p53, indicating that upstream sequences are not required for full transactivation of the M-PGAM promoter by this protein (data not shown). Also, the presence of wild-type p53 protein in neonatal cardiocytes and C2C12 was confirmed by immunoprecipitation with antibody PAb 246 (data not shown).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1. p53 transactivates the M-PGAM promoter. A, effect of wild-type and mutant p53 on the transcriptional activity mediated by the M-PGAM promoter. Neonatal rat cardiocytes (NRC), C2C12 cells, and SAOS cells were cotransfected by lipofection with 10 µg of a -415, +5 M-PGAM reporter vector, 1 µg of CMV-Luc, and 3 µg of CMV-driven expression vectors containing wild-type p53 sequences (53) , the p53 structural mutant 143A (53m), or no insertion (v). Cells were incubated for 48 h, and CAT activity measured as indicated in "Materials and Methods." CAT activity is expressed as a percentage of acetylated chloramphenicol. Columns, means of three independent experiments; bars, SD. B, effect of p51A and p73L on the transcriptional activity mediated by the M-PGAM promoter. C2C12 cells were cotransfected with 10 µg of the -415, +5 M-PGAM reporter vector, 1 µg of CMV-Luc, and 0, 0.1, 0.3, 1, 3, or 10 µg of CMV-driven expression vectors containing wild type p53 (p53), p51A (p51A) or p73L (p73L) sequences. Total amount of vectors was adjusted using a CMV empty vector. Incubations and CAT assays were as above. Columns, means of three independent experiments; bars, SD. C, effect of wild-type and mutant p53 on the transcriptional activity mediated by the MLC2v and ANF promoters. Neonatal rat cardiocytes (NRC) were cotransfected with 1 µg of RSV2-ßGAL, 10 µg of luciferase reporter vectors containing a 639-bp ANF or 250-bp MLC2v promoter fragments, and 3 µg of CMV control (v), wild type (53) , or 143A mutant (53m) p53 expression plasmids. Cells were incubated for 48 h and processed for luciferase and ßGAL assays. Promoter activity is represented as the ratio between luciferase and ß-galactosidase activities. Columns, means of two independent experiments; bars, SD. D and E, identification of the wild-type p53-responsive area in the M-PGAM promoter. SAOS (D) and C2C12 (E) cells were cotransfected by lipofection with 10 µg of the indicated stepwise deleted fragments of the M-PGAM promoter subcloned upstream of a CAT reporter gene plasmid, 1 µg of CMV-Luc and 3 µg the control (v), wild-type (53) , or 143A mutant (53m) p53 expression plasmids. Cells were incubated for 48 h and processed for CAT activity assay. Other details were as in A. Columns, means of three independent experiments; bars, SD.

 
It has been recently shown that members of a family of proteins, referred as p51, p63, or p73, which show significant sequence similarity with p53, are able to transactivate p53 gene targets such as the p21cip, Bax, MDM2, cyclin G, GADD45, and IGF-BP3 promoters as well as p21 and RGC p53 site reporter constructs (18, 19, 20, 21, 22, 23, 24, 25) . We investigated the ability of two members of this family, p51A (p51A/p63{gamma}) and p73L (p63{alpha}/p51B/p73L), to transactivate the M-PGAM promoter in C2C12 cells. Fig. 1BCitation shows that p51A and, at a lower intensity, p73L were able to transactivate M-PGAM. These experiments supported further the hypothesis that M-PGAM is a p53 gene target. Although the regulation of M-PGAM expression by multiple members of this family of proteins deserves further investigation, here we have focused our attention on the regulation of M-PGAM by p53, the best-characterized member of this family.

As an experimental control, we tested the ability of p53 to transactivate two muscle-specific reporter constructs containing a 639-bp ANF promoter (26) or a 250-bp MLC2v promoter (27) . A repression of the transcription mediated by these promoters was observed (Fig. 1C)Citation . Thus, the activation of M-PGAM by p53 was specific.

The Rat M-PGAM Gene Promoter Contains a Wild-Type p53-responsive Element.
To identify an M-PGAM promoter element that could mediate the effects of p53, we assayed a series of M-PGAM CAT deletion mutants by cotransfection with the wild-type p53 expression vector. Because the effect of p53 on M-PGAM in primary neonatal cardiocytes may be masked by the presence of endogenous p53 protein, these assays were performed in SAOS cells. The result of these experiments is shown in Fig. 1DCitation . The M-PGAM CAT deletion mutants defined a promoter fragment between -172- and -87-bp sequences that mediates responsiveness to p53. Similar results were obtained with C2C12 cells (Fig. 1E)Citation . Inspection of the -172- to -87-bp promoter sequences revealed the presence of a consensus p53 binding site at positions -116- to -90-bp. Interestingly, this site is strikingly homologous to the MCK and RGC p53 sites (Fig. 2)Citation and contains two TGCCT (pentamers) motifs (28, 29, 30) . Also, an additional imperfect pentamer, TGCCA, was found five nucleotides upstream of this site (data not shown). This finding strongly suggested that p53 directly interacts with the M-PGAM promoter.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Consensus p53 sites in the M-PGAM, MCK, and RGC genes. M-PGAM sequences were from the rat M-PGAM gene positions -116 to -90 bp. MCK and RGC sequences were as described previously (8 , 15) .

 
p53 Directly Interacts with the M-PGAM Gene Promoter.
A specific interaction of p53 with the M-PGAM promoter was investigated by EMSA using the oligonucleotide probe (duplex) tcgacTGCCACTGGTTGCCTGCCTCTGCCTG (M-PGAM, pentamer motifs underlined) and nuclear extracts prepared from neonatal rat hearts. One major nucleoprotein complex band was observed that was effectively competed by a mass excess of an oligonucleotide containing the p53 MCK site but not by oligonucleotides containing Sp1- or nuclear factor {kappa}B-binding sites (Fig. 3ACitation , p53, arrowhead). Thus, the formation of this complex was p53 site specific. The presence of p53 in this band was then confirmed using anti-p53 monoclonal antibodies. A supershift was observed with the addition to the EMSA reactions of the anti-p53 antibodies PAb 421 (31) and DO-1 (32) , which recognize wild-type p53 associated with DNA (Ref. 33 ; Fig. 3BCitation ). However, PAb 240, a monoclonal antibody that recognizes mutant p53 (34) , had no effect (Fig. 3B)Citation . In summary, these experiments demonstrated that endogenous rat heart p53 binds specifically to the M-PGAM p53 consensus site. A small amount of nucleoprotein complex was not supershifted by the PAb 421 and DO-1 antibodies. This result suggested that either some of the p53 in the complex was not recognized by the antibodies, as has been shown by others (33) , or other proteins were present in this band. However, because most of the complex was supershifted by the anti-p53 antibodies, we can conclude that, at least in neonatal cardiac cells, p53 is the major factor binding the M-PGAM p53 consensus site.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3. p53 binds the rat M-PGAM promoter. A, EMSA showing the binding of neonatal rat heart p53 to an M-PGAM promoter probe. Nuclear extracts were prepared from rat neonatal cardiocytes as indicated in "Materials and Methods." Five µg of nuclear extracts were assayed by EMSA using 0.2 ng of a M-PGAM p53 site oligonucleotide probe and 10 µg of poly (dI · dC):(dI · dC) in buffer B. Extracts were incubated for 30 min with 40 ng of the indicated oligonucleotides prior to the addition of the M-PGAM probe. B, supershift assay identifying p53 bound to an M-PGAM probe. EMSA reactions were as above. One µg of the respective antibodies was added to the reaction, and extracts were incubated for 1 h at 37°C. C, EMSA of purified human baculovirus expressed human p53 using a series of DNA probes. Binding reactions were prepared as in A. D, EMSA of purified human baculovirus-expressed human p53 using 0.2 ng of the M-PGAM probe and 0, 0.1, 1, or 10 ng of the indicated oligonucleotide competitor. For a description of these oligonucleotides probes and other experimental details, see "Materials and Methods." Figures show experiments that are representative of at least two assays.

 
In addition, the direct interaction of p53 with M-PGAM promoter sequences was investigated by EMSA using a purified baculovirus-expressed human p53 protein. Fig. 3CCitation shows that human p53 binds to the rat M-PGAM probe with a similar affinity than to other oligonucleotide probes containing consensus p53 sites from the RGC or MCK genes. Moreover, binding of p53 to the M-PGAM probe was competed by a mass excess of an oligonucleotide containing a consensus p53 site (MCK) but not by an unrelated sequence (Fig. 3D)Citation . In summary, these experiments confirmed that p53 specifically interacts with the M-PGAM promoter.

p53 Is Required for Full Activation of the M-PGAM Promoter in Rat Cardiocytes.
To determine whether the M-PGAM p53 consensus binding site was responsible for the transactivation of the M-PGAM promoter by wild-type p53, we created an M-PGAM reporter construct with point mutations at the two consensus p53 pentamer motifs, namely {Delta}p53 M-PGAM CAT. The native and mutant M-PGAM CAT plasmids were transfected in rat neonatal cardiocytes and cells incubated and processed for the assay of CAT activity. Mutation of the consensus pentamer motifs decreased the transcriptional activity mediated by the M-PGAM promoter in neonatal cardiocytes by {approx}65% (Fig. 4A)Citation . In addition, we cotransfected C2C12 cells with the native or mutant M-PGAM CAT reporters and wild-type or mutant p53 expression vectors. The results of these experiments, shown in Fig. 4BCitation , indicated that mutagenesis of the M-PGAM p53 binding site blocks the transactivation of this promoter by wild-type p53. Thus, these experiments confirmed that the M-PGAM promoter contains a consensus p53 binding site that mediates the transactivation of this promoter by p53. Moreover, these experiments demonstrate that the M-PGAM-responsive element is constitutively active in primary rat neonatal cardiocytes but not in C2C12 myoblasts.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4. Mutagenesis of the M-PGAM p53 binding site blocks p53 transactivation of the M-PGAM promoter. A, transient transfection assay showing the effect of the mutagenesis of the p53 site on the transcription mediated by the M-PGAM promoter in rat neonatal cardiocytes. Cells were transfected with 1 µg of CMV-Luc and 10 µg of plasmids M-PGAM CAT (WT) or M-PGAMp53{Delta} CAT ({Delta}53), incubated for 48 h and processed for the assay of CAT activity as indicated in "Materials and Methods." B, transient transfection assay showing the effect of the mutagenesis of the p53 site on the transactivation of M-PGAM by p53. C2C12 cells were cotransfected with 1 µg of CMV-Luc, 10 µg of reporter plasmids M-PGAM CAT (WT), or M-PGAMp53{Delta} CAT ({Delta}53) and 3 µg of expression plasmids CMV (CMV), CMV-p53 (CMV-p53), or CMV-p53 143 A (CMV-p53m). Cells were incubated for 48 h and processed for the assay of CAT activity, as indicated in "Materials and Methods." Column, means of three experiments; bars, SD.

 
p53 Regulates the Expression of the M-PGAM Gene Promoter in Vivo.
The experiments described above suggested that p53 function might be important for the regulation of M-PGAM expression in vivo. To begin to elucidate the role that p53 may play in the transcriptional control of M-PGAM in vivo, we investigated the effect of the expression of a dominant mutant p53 protein on M-PGAM expression in C2C12 cells. For that purpose, we generated a cell line of mutant p53-expressing C2C12 cells by the stable transfection of these cells with a retroviral-based vector containing a selectable marker and p53 143A cDNA sequences. Control cells were generated by the stable transfection of an empty vector. Metabolic labeling and immunoprecipitation using an anti-mutant p53 specific antibody demonstrated stable expression of the mutant p53 protein in C2C12 cells (Fig. 5A)Citation . A similar procedure was employed previously by Soddu et al. (13) to demonstrate the requirement of wild-type p53 function for the transcriptional activity of a reporter plasmid containing multiple copies of the p53 RGC site. Control and mutant p53-expressing C2C12 cells were then induced to differentiate by incubation for 2–4 days in low serum medium supplemented with insulin and transferrin (13) . The results of these experiments, shown in Fig. 5BCitation , demonstrate that mutant p53 blocks the induction of endogenous M-PGAM expression during myocyte differentiation. As an experimental control, the expression of MCK and ANF in these RNA extracts was also investigated. A modest effect of mutant p53 on MCK expression was observed only at early incubation times (Fig. 5C)Citation , suggesting the existence of some differences in the control of the expression of M-PGAM and MCK during muscle differentiation (35) . ANF expression was barely detectable in these extracts and was not affected by mutant p53 (data not shown).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5. Expression of a mutant p53 form blocks the increase in M-PGAM expression during the terminal differentiation of C2C12 cells. A, immunoprecipitation of mutant p53 with antibody PAb 240 in C2C12 cells infected with vector pBabe (no insert, pBabe) or vector pBabe p53 143A (p53143A). Cells were incubated with radiolabeled methionine, harvested, and lysed; PAb 240-reactive p53 was immunoprecipitated; and immunoprecipitates were resolved by SDS-PAGE and exposed to a PhosphorImager screen (Molecular Dynamics). B, Northern analysis of M-PGAM expression in C2C12 stable transfected with plasmids pBabe (pBabe, no insert) or pBabe p53 143A (p53143A). Cells (3 x 104 cells/cm2) were incubated in serum-free DMEM supplemented with 10 µg/ml insulin and 5 µg/ml transferrin for 2–4 days (13) . RNA was isolated and processed for Northern analysis, as indicated in "Materials and Methods." RNA integrity was verified by reprobing with a GAPDH sequence (American Type Culture Collection). The figure is representative of two experiments. C, Northern analysis of MCK expression in the C2C12 RNA extracts used in part B. MCK sequence probe was from American Type Culture Collection. D, effect of the mutagenesis of the p53 M-PGAM site on the activation of M-PGAM CAT during the terminal differentiation of C2C12 cells. C2C12 cells were cotransfected with 1 µg of CMV-Luc and 10 µg of reporter plasmids M-PGAM CAT (WT) or M-PGAMp53{Delta} CAT ({Delta}53). Cells were incubated for 72 h in DMEM with 10% fetal bovine serum (10% Serum) or in serum-free DMEM supplemented with 10 and 5 µg/ml transferrin (No Serum), harvested, and processed for the assay of CAT activity as indicated in "Materials and Methods." Column, means of three experiments; bars, SD.

 
Moreover, when C2C12 myoblasts were transfected with the native or {Delta}53 mutant M-PGAM CAT reporters and then induced to differentiate as above, the mutagenesis of the p53 site originated a dramatic decrease in the induction of CAT expression (Fig. 5D)Citation . These results demonstrated that interaction of p53 or p53-related proteins with M-PGAM is required for the induction of the activity of this promoter during the myoblast to myotube transition in C2C12 cells. However, experiments of gel shift assay showed no changes in protein binding to the M-PGAM p53 site during this period (data not shown). Thus, other processes, such as protein-protein interaction, may be implicated in the regulation of M-PGAM transactivation by p53 and related factors during myocyte differentiation.

Subsequent experiments investigated the role that p53 plays in the control of M-PGAM expression in vivo using Northern analysis and in situ hybridization of gene transcripts. Control and p53 null mouse embryos at day 13.5 p.c. were employed in these studies. This stage was selected because it represents the period of maximal expression of p53 in mouse embryonic development (36, 37, 38) . Crosses between mice heterozygous for a targeted mutation in exon 5 of p53 on the inbred 129/sv genetic background (129/Sv-Trp53tmlTyj mice) yielded 17% homozygous mutant offspring (6 of 34 embryos). A preliminary Northern analysis revealed no significant differences in the level of whole-animal M-PGAM expression between a control and a p53-null embryos (data not shown). M-PGAM expression was then investigated by in situ hybridization. This technique was used because it provided the advantage to study M-PGAM expression in an individual and tissue-specific fashion. Fig. 6ACitation shows a typical muscle-specific distribution of M-PGAM transcripts found in control embryos. M-PGAM mRNA was enriched in heart cavities, eluding the valvular system, and diaphragm, whereas no expression was found in bone or lung. Similarly, M-PGAM transcripts accumulated at tongue, limb, and intercostal muscles (data not shown). Control experiments using a sense M-PGAM riboprobe resulted in background hybridization levels over these tissue sections (data not shown). The expression of M-PGAM in p53-null mice was characterized by a similar muscle-specific distribution, indicating that p53 does not affect the tissue specificity of this transcript (Fig. 6, B–DCitation , and data not shown). Three of five p53-null embryos studied had no alterations in M-PGAM expression (60%). However, in two of these embryos (40%), reduced M-PGAM expression was detected. Strikingly, lower levels of M-PGM expression were evidenced in muscle organs of anterior-ventral but not in lateral locations. Although a small reduction (<30%) in M-PGAM expression was observed in embryonic hindlimb muscles (Fig. 6, B and E)Citation , M-PGAM hybridization was reduced by 40 and 65%, respectively, at heart and tongue muscles related to their wild type p53 littermates (Fig. 6, C, D, and F)Citation . This defective pattern of M-PGAM expression was not observed in any of the control embryos studied (six in total; data not shown). Importantly, the lower M-PGAM expression in these p53 null animals was not due to organ hypoplasia. Nuclei counts per optical field were similar in day 13.5 p.c. hearts and tongues of control and p53 null embryos with low M-PGAM expression (not shown). In addition, M-PGAM expression was first detected in control animals at day 11 p.c. in heart and tail muscles (Fig. 6E)Citation . This localized expression spread to lateral muscles by day 13.5 p.c. (Figure 6B)Citation . Therefore, because all p53-null animals demonstrated relatively normal M-PGAM expression in hindlimb muscles, it is highly unlikely that a defective M-PGAM expression in heart was originated by deferred development.



View larger version (102K):
[in this window]
[in a new window]
 
Fig. 6. In situ hybridization of M-PGAM transcripts in normal and p53-null embryos. Homozygous p53 +/+ and -/- null mouse embryos were generated from heterozygous, 129-Trp53 p53 (+/-) intercrosses and identified by PCR genotypic analysis using primers designed against the neo gene, as described by Jacks et al. (52) . Day 13.5 p.c. embryos were sacrificed, fixed in cold 4% paraformaldehyde, dehydrated through graded ethanol series, and embedded in paraffin wax. Seven-µm-thick paraffin sections were processed, as indicated in "Materials and Methods." Plasmid Sm2 containing M-PGAM cDNA sequences was digested with NcoI and an 35S-UTP-labeled riboprobe was generated using T3 RNA polymerase. In situ hybridizations were carried out for 16 h at 60°C. Slides were washed and exposed to autoradiographic emulsion for 5 weeks, developed in D19 Kodak solution, counterstained with toluidine blue solution, and mounted in Permount. A, top, representative microphotograph (x40) of a p53 +/+ saggital embryo section showing in situ hybridization of cardiac M-PGAM transcripts; bottom, dark-field microphotograph. b, bone; aw, upper airways; l, lung; h, heart. B, in situ hybridization of M-PGAM transcripts in coronal sections hindlimbs of p53 +/+ (left) and p53 -/- (right) mouse embryos. s, skin. C, in situ hybridization of M-PGAM transcripts in coronal heart sections of p53 +/+ (left) or p53 -/- (right) embryos. v, heart valve; w, ventricular wall; x, nonspecific blood staining. D, in situ hybridization of M-PGAM transcripts in saggital tongue sections of p53 +/+ (left) and p53 -/- (middle and right) embryos. t, tongue; s, skin. E, in situ hybridization of M-PGAM transcripts in a saggital section of an 11-day p.c. p53 +/+ embryo. F, counts of hybridization grains per optical field (Nikon Diaphot ocular grid) in tissue sections of p53 +/+ and -/- mice. Two p53 (+/+) and two p53 (-/-) embryos were analyzed. Columns, means of 10 optical fields per sample; bars, SD.

 
To confirm these results, new crosses between heterozygous 129/Sv-Trp53tmlTyj mice were carried out yielding a 16.6% homozygous mutant offspring (3 of a total of 18 embryos at day 13.5 p.c.). Northern analysis of whole embryo M-PGAM transcripts demonstrated a significant reduction in M-PGAM expression in one of three p53-null embryos obtained (Fig. 7)Citation . No change in M-PGAM expression was found in six heterozygous p53 mutant embryos studied (data not shown). In summary, these experiments showed a reduced M-PGAM expression in a subset of p53-null animals. These data demonstrated that p53 contributes to the regulation of M-PGAM expression in vivo and support previous observations that indicate a role for p53 in mouse embryogenesis (37 , 39) .



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 7. M-PGAM expression in mouse embryos. Northern analysis of M-PGAM expression in day 13.5 p.c. 129Sv-Trp53 control (+/+) and homozygous p53 null (-/-) mouse embryos. RNA was isolated from whole embryos and processed for Northern analysis as indicated in "Materials and Methods." RNA integrity was verified by reprobing with a GAPDH sequence (American Type Culture Collection). *, p53-null embryo with low M-PGAM expression and exencephaly. The figure is representative of two independent experiments.

 
The fact that partial penetrance was observed in p53 null animals whereas a more dramatic decrease in M-PGAM expression was observed in C2C12 cells that stably express a mutant p53 protein, prompted us to investigate the possibility that mutant p53, in addition to inactivate wild-type p53, may interfere with the ability of other p53-related proteins to transactivate the M-PGAM promoter. To test this hypothesis, C2C12 cells were cotransfected with the M-PGAM CAT reporter plasmids and CMV-driven expression vectors containing p53, p51A, or p73L sequences, alone or in the presence of a p53 143A expression vector. Interestingly, mutant p53 blocked in part the transactivation of M-PGAM by p53, p51A, and p73L (Fig. 8A)Citation . Moreover, these proteins failed to transactivate the M-PGAM promoter in C2C12 cells stably expressing p53 143A (Fig. 8B)Citation . These results demonstrate that, at least in transient transfection assays, mutant p53 may interfere with the ability of p51A and p73L to activate M-PGAM expression. These results are in agreement with recent data demonstrating that mutant p53 blocks the transcriptional activity of p73 isoforms (24) . These data suggest the possibility that p53-related proteins may compensate for some p53 functions in p53 null animals and may reconcile some of the differences observed between C2C12 cells expressing mutant p53 and p53-null embryos.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 8. Mutant p53 blocks p53, p51A, and p73L transactivation. A, transient transfection assay showing the effect of the expression of p53 143A on the ability of p53, p51A, and p73L to transactivate the M-PGAM CAT. C2C12 cells stable transfected with plasmid pBabe (C2C12 pBabe) were transfected with 1 µg of CMV-Luc; 10 µg of plasmid M-PGAM CAT; 1 µg of CMV (CMV), CMV-p53 (p53), CMV-p51A (p51A), or CMV-p73L (p73L); and 3 µg of CMV (C) or 3 µg of CMV-p53 143A (Mut). Cells were incubated for 48 h and processed for the assay of CAT activity, as indicated in "Materials and Methods." B, transient transfection assay showing the effect the stable expression of p53 143A on the abilities of p53, p51A, and p73L to transactivate the M-PGAM CAT. C2C12 cells stable transfected with plasmid pBabe p53 143A (C2C12 pBabe 143A) were transfected with 1 µg of CMV-Luc, 10 µg of plasmid M-PGAM CAT, and 1 µg of CMV (CMV), CMV-p53 (p53), CMV-p51A (p51A), or CMV-p73L (p73L). Cells were incubated for 48 h and processed for the assay of CAT activity as described in A.

 

    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
We have found that the expression mediated by the rat M-PGAM promoter is regulated by p53. The activation by p53 of the activity of an M-PGAM CAT reporter construct was demonstrated in C2C12 and SAOS cells (Fig. 1A)Citation . Transfection of wild-type p53 in rat neonatal cardiocytes did not alter M-PGAM CAT activity (Fig. 1A)Citation . However, the expression of a dominant mutant p53 form in these cells inhibited M-PGAM-mediated expression. The fact that some mutant p53 proteins behave in a dominant negative fashion, inhibiting the transactivation of coexpressed or endogenous wild-type p53, is well documented (40, 41, 42) . In view of these data, we interpreted that the overexpression of mutant p53 protein in neonatal cardiocytes inhibited the endogenous wild-type p53 that constitutively transactives the M-PGAM promoter. This hypothesis was supported by the reduction of the transcriptional activity mediated by the M-PGAM promoter in neonatal cardiocytes by the mutagenesis of the M-PGAM p53 site (Fig. 4Citation , see below). Moreover, current experiments in our laboratory indicate that overexpression of the p53 transcriptional inhibitor protein MDM2 (11) in neonatal cardiocytes represses M-PGAM expression in a p53 site-dependent manner (data not shown). The fact that p53 protein is expressed in neonatal cardiocytes has been shown previously (36) . Also, gel shift assays demonstrated that p53 is the major factor in neonatal hearts binding a p53 consensus site in the M-PGAM promoter (Fig. 3)Citation .

Maximal transactivation of M-PGAM in C2C12 was observed with 1–3 µg of a p53 expression vector (Fig. 1B)Citation . Similar concentrations of p51A and p73L expression vectors were required for maximal M-PGAM promoter activity. Lower amounts of p53 and p53-related proteins have been shown to transactivate p53 gene targets in other cell types (24) . However, in agreement with our results, relatively large concentrations of p53 were used by others to determine the ability of p53 to transactivate gene targets in muscle cells (7 , 8) . We have seen also that 1–3 µg of a p53 expression vector were required in C2C12 to obtain maximal transactivation of reporter plasmids containing the RGC p53 site (PG13) or a p21 promoter fragment (not shown). These results indicate that M-PGAM is as responsive to p53 transactivation as other p53 targets. We hypothesize that the differences observed with the results obtained in other cell types are originated by the lower transfection efficiency of muscle cells.

A wild-type p53-responsive promoter fragment in the M-PGAM promoter was defined by cotransfection of a wild-type p53 expression vector and a series of M-PGAM CAT deletion mutants in C2C12 and SAOS cells (Fig. 1, B and C)Citation . Inspection of this DNA sequence revealed the presence of two TGCCT pentamers motifs at positions -116 to -90 bp with an additional imperfect pentamer TGCCA 5 nucleotides upstream. This putative p53 binding site was found to be strikingly homologous to the MCK and RGC p53 sites (Fig. 2)Citation . Importantly, mutagenesis of this site decreased the activity of M-PGAM in neonatal cardiocytes and blocked the transactivation of the M-PGAM promoter by wild-type p53 in C2C12 cells (Fig. 4)Citation . These experiments demonstrated that the rat M-PGAM promoter contains a wild-type p53 consensus site that mediates the transactivation of M-PGAM by this protein. A similar sequence, with 13 of 17 identical nucleotides, was found in the human M-PGAM promoter, suggesting that this element is well conserved (data not shown). Whether the human M-PGAM promoter is also responsive to p53 should be the object of further investigation. EMSA detected the binding of endogenous rat cardiac p53 and purified baculovirus-expressed human p53 to the p53 M-PGAM site (Fig. 3)Citation . Importantly, these experiments demonstrated that p53 directly interacts with M-PGAM promoter sequences. The fact that rat and human p53 are both able to bind with high affinity the rat M-PGAM promoter in a specific manner indicated that the interaction between p53 and M-PGAM is well conserved.

Finally, a role for p53 in the transcriptional regulation of M-PGAM was demonstrated in C2C12 cells (Fig. 5)Citation and in mouse embryos (Figs. 6Citation and 7)Citation . Strikingly, a decrease in M-PGAM expression was observed in p53-null mouse embryos in heart and tongue but not at limb muscles, indicating that p53 contributes to the control of M-PGAM expression in muscle tissues of anterior-ventral location. Studies of p53 expression during mouse embryogenesis indicated high levels of p53 mRNA in all tissues (38) . At late stages of development, p53 expression becomes more pronounced in cells undergoing differentiation (38) . A similar scenario has been observed during chicken embryogenesis (43) , supporting the hypothesis that p53 plays a role in tissue-specific differentiation. Multiple studies have implicated the p53 tumor suppressor gene during differentiation in vitro (13 , 14 , 44, 45, 46, 47, 48, 49, 50) . These results were disputed by the absence of developmental alterations initially reported in p53 null animals (51 , 52) . However, recent evidence has indicated the presence of neural tube and cranio-facial malformations in a subset of p53-null animals (37 , 39 , 53) . These data underscore the fact that p53 may be important in normal development as well as in tumorigenesis. Sah et al. (37) hypothesized that, during neural tube closure, p53 could have a role in mediating cell cycle arrest to limit cell proliferation or to prepare cells for a differentiation event. Our results support the hypothesis that p53 may have a role as a positive regulator of muscle cell differentiation in vivo. These results are not in contradiction to the well-known cell cycle regulatory properties of p53. The growth suppressor properties of p53 are well substantiated by the ability of this protein to inhibit the proliferation of cultured tumor cells (54) , prevent neoplastic transformation in vitro (55, 56, 57, 58, 59) , and inhibit the formation of tumors in animal models (24) . Importantly, unlike in skeletal muscle, where cellular proliferation and a differentiated phenotype are mutually exclusive (60) , the increase in cardiac mass during embryonic life arises predominantly from the proliferation of mononucleated differentiated cardiomyocytes (61) . Terminal differentiation, with irreversible withdrawal from the cell cycle, does not take place in cardiomyocytes until shortly after birth (62) . Our results indicate that p53 may function in the heart as a regulator of a specific set of genes associated with phenotypic differentiation rather than as a growth suppressor. This conclusion is supported by recent data of Soddu et al. (13) indicating that, in the C2C12 model, inactivation of p53 function affects cell differentiation but not cell cycle arrest.

Our results represent one of the first observations in vivo of a gene expression defect gene originated by p53 inactivation. Previously, Macleod et al. (63) demonstrated that p53 is required in most tissues for the expression of p21 in response to exposure to {gamma} radiation. The fact that p53 may exert a localized developmental role may explain the limited in vivo data. The reasons for a selective pattern of transcriptional regulation by p53 are unknown. In addition, molecular redundancy could compensate for the lack of p53 function at posterior-lateral locations. Molecular redundancy has been shown to underlie the paucity of developmental alterations observed in knockout animals lacking the expression of major transcriptional regulators of muscle-specific expression (64 , 65) . As indicated above, several p53 homologs has been recently shown to transactivate p53 gene targets (18, 19, 20, 21, 22, 23, 24, 25) . We show that p51A and p73L may both transactivate the M-PGAM promoter (Fig. 1B)Citation . The results of our EMSA suggest that p53 is the major factor interacting with the M-PGAM p53 consensus site in neonatal cardiocytes (Fig. 3B)Citation . However, p53-related proteins may play a more important role in the regulation of the promoter activity of M-PGAM in other muscle tissues. Interestingly, it has been shown that p51 is expressed at high levels in skeletal muscle (19) . The physiological role of p51 is yet unknown. However, its ability to transactivate M-PGAM and other p53 targets in skeletal muscle deserves further investigation.

Finally, we have seen that a p53 mutant protein was able to block the ability of p53, p51A, and p73L to transactivate M-PGAM (Fig. 8)Citation . These results are in agreement with a recent report by Di Como et al. (24) that mutant p53 proteins may interfere with the transcriptional activity of p53-related proteins. This is not surprising, considering the high degree of sequence homology between the members of this family. As stated above, these data may reconcile some of the discrepancies observed between our C2C12 and p53 null embryo experiments (Figs. 5Citation and 6)Citation . In addition, it is well-known that mutant p53 proteins may display gain-of-function properties that cannot be completely explained by the inactivation of wild-type p53 (66) . Mutant p53 proteins may work as transcriptional activators by a mechanism that do not require the inactivation of wild-type p53 (67 , 68) . Our results and those of Di Como et al. (24) suggest a second mechanism of mutant p53 gain of function, the inactivation of p53-related proteins.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Animals.
Heterozygous 129/Sv-Trp53tmlTyj mice were purchased from The Jackson Laboratory. Control (+/+) and homozygous p53 null (-/-) mouse embryos were generated from heterozygous intercrosses and identified by PCR genotypic analysis using primers designed for the neo gene, as described previously by Jacks et al. (52) .

Cell Culture, Cell Extracts, Transfections, and Reporter Assays.
Rat neonatal cardiocyte cultures were prepared as described previously (13) . C2C12 and SAOS cells were from American Type Culture Collection (Manassas, VA). Cells were cultured in DMEM plus 10% dialyzed fetal bovine serum (Life Technologies, Inc., Grand Island, NY) with penicillin (10 units/ml) and streptomycin (10 units/ml). C2C12-pBabe and -pBabe 143A cells were generated by transfection of C2C12 cells with plasmids pBabe or pBabe p53 143A, followed by selection in medium supplemented with 3 µg/ml puromycin. Polyclonal populations at passages 1–3 were used. Nuclear extracts were prepared as described previously (68) . Extracts were aliquoted, quickly frozen in liquid N2, and stored at -80°C. For transfection, C2C12 cells were incubated as above until 80% confluency and transfected by the lipofectamine method following the recommendations of the manufacturer (Life Technologies, Inc.). Neonatal cardiocytes were transfected by the calcium phosphate method as described (5) . As a control for transfection efficiency, cells were cotransfected with 1 µg of CMV promoter-driven luciferase vector (69) . Transfection efficiency was also independently monitored using a CMV-CAT plasmid (85% CAT conversion). 48 h after transfection, cells were lysed by 5'' ultrasonic vibrations at 4°C using a Branson sonifier at a setting of 3. Equal amounts of luciferase activity units, as determined by a luminescence assay (Promega, Madison, WI), were then analyzed for CAT activity using TLC (Baker, Phillipsburg, NJ). Chromatography plates were scanned using a PhosphorImager screen and quantified using ImageQuant software (Molecular Dynamics). Alternatively, chloramphenicol acetyltransferase activity was measured using the Fluor diffusion assay (70) . CAT activity was expressed as a percentage of acetylated chloramphenicol. Luciferase and ß-galactosidase activities were measured as described previously (71) .

Plasmids.
The CAT reporter plasmids containing stepwise deleted fragments of the rat M-PGAM gene were as described previously (4) . Plasmid M-PGAM CAT contains -415 to +5 M-PGAM sequences. Site-directed mutagenesis was performed by PCR, as described previously (72) . The M-PGAMp53{Delta} CAT plasmid contains -415 to +5 bp M-PGAM sequences with the substitution (double strand, p53 sites underlined) CTGCAGCCTCGGTAC for TGCCTGCCTCTGCCT at positions -105 to -90 bp. The ANF and MLC2v reporter vectors were as described previously (26 , 27 , 73) . The CMV enhance-promoter-driven expression vectors containing wild-type p53 or the structural mutant p53 143A form; the reporter plasmid PG13, containing 13 copies of a wild type p53 consensus binding site; and the p21 promoter luciferase reporter plasmid were all gifts from Dr. B. Vogelstein (Johns Hopkins University, Baltimore, MD; Refs. 74 and 75 ). The pBabe p53 143A plasmid containing p53 mutant 143A sequences and a puromycin selectable marker was generated by the subcloning of a p53 mutant 143A cDNA fragment originated by BamHI digestion of plasmid CMV-p53 143A into the retroviral-based vector pBabe (76) . The p51A and p73L expression vectors were generated by subcloning p51A and p73L cDNA sequences into pCMV (19) .

EMSAs.
The oligonucleotide probe sequences used were as follows (double-stranded): RGC, tcgacCTTGCCTGGACTTGCCTGG, with the p53 consensus site at the ribosomal gene cluster gene (75) ; MCK, TGGCCGGGGCCTGCCTCTCTCTGCCTCTGA, with the p53 binding site at the MCK enhancer (8) ; C/EBP, tcgacAAGTTGAGAAATTTG, with the C/EBP consensus site at the 422 (aP2) promoter (77) ; Sp1I, CGGGACTGGGGAGTGGCGAGCCCTC, Sp1II, CAGGGAGGCGTGGCCTGGGCGGGACTGGGG, and {kappa}B, tcgacGCTGGGGACTTTCCAGGG, with the Sp1I, Sp1II and 3' {kappa}B sites, respectively, at the HIV1 long terminal repeat (78) . DNA oligonucleotides were prepared with an Applied Biosystems 391EP DNA synthesizer using the phosphoramidite method and purified using Sep-Pak C18 cartridges (Waters Associates, Milford, MA). Gel shift mobility assays were prepared as follows: in a 10-µl reaction volume containing buffer B [20 mM HEPES (pH 7.5), 100 mM KCl, 0.2 µM ZnCl2, 1 µM DTT, 1 µM phenylmethylsulfonyl fluoride, and 5% glycerol], 10 µg of poly(dI · dC):(dI · dC), and 5 µg of nuclear extract protein per reaction. Incubation time was 30 min at 20°C, unless otherwise indicated. Equal amounts of cardiac protein extracts were assayed in each condition as determined by the Bradford assay (Bio-Rad). When antibodies were added to the reaction mix, the total incubation time was 1 h at 20°C. Mouse monoclonal antibodies anti-p53 PAb 240, 246, 421, and 1801 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Purified baculovirus-expressed human p53 protein was as described previously (14) . Oligonucleotide probes used in the binding assays were labeled with T4 polynucleotide kinase (NEB) and [{gamma}-32P] ATP (>4500 Ci/mmol; Amersham, Piscataway, NJ). Labeled probes were purified using Pharmacia spun columns according to the directions of the manufacturer. Oligonucleotide competition experiments were carried out with a fixed concentration of probe and 200-fold excess of nonlabeled competitor. Reactions were loaded into a 5% nondenaturating polyacrylamide gels previously prerun for 15 min at 200 V. Electrophoresis was performed at 20 V/cm in 22 mM Tris-borate buffer with 0.5 mM EDTA. Gels were dried and exposed to film overnight at -70°C with an intensifying screen. Alternatively, dried gels were scanned using a PhosphorImager screen and analyzed using ImageQuant software (Molecular Dynamics, Sunnyvale, CA).

Immunoprecipitations.
Antibodies were purchased from Santa Cruz Biotechnology, except anti-ß-actin, which was from Sigma Chemical Co. (St. Louis, MO). In immunoprecipitation studies, 2 x 107 cells were washed twice for 10 min in 10 ml of methionine-free DMEM and incubated for 4 h at 37°C in 5 ml of new medium with 2.5 mCi of [35S]methionine (1175 Ci/mmol; NEN). Cells were collected by centrifugation and lysed in 1 ml of immunoprecipitation buffer: PBS containing 1% Triton X-100, 0.1% SDS, 1 mM sodium orthovanadate, 1 mM DTT, and 1 mM phenylmethylsulfonyl fluoride, followed by centrifugation at 1500 x g for 10 min. Cell lysates were incubated in the presence of 1 µg of the corresponding antibody at 4°C for 4 h followed by incubation for 1 h with protein A/G-agarose (Santa Cruz Biotechnology). Immunoprecipitates were collected by centrifugation at 5000 x g for 10 min, washed five times with 1 ml of immunoprecipitation buffer, resuspended in SDS-PAGE sample buffer, boiled for 5 min, and electrophoresed by 15% PAGE. Dried gels were exposed to a PhosphorImager screen and analyzed using ImageQuant software (Molecular Dynamics).

Northern Blot Analysis.
RNA was isolated from 13.5 p.c. mouse embryos or C2C12 cells using Trizol reagent (Life Technologies, Inc.). For Northern analysis, 30 µg of total RNA were electrophoresed in a 1.3% agarose/formaldehyde gel, visualized using ethidium bromide, transferred to nitrocellulose filters (Amersham), fixed by UV cross-linking, and baked at 80°C for 1 h. For hybridizations, 3 x 106 cpm/ml of a random primed 32P-labeled NcoI/SmaI M-PGAM cDNA fragment was used as a probe (5) . The MCK and GAPDH sequences used for the generation of probes were from American Type Culture Collection. The ANF probe was as described previously (73) . Filters were hybridized at 42°C in 40% formamide with 6x SSC, 2x Denhardt’s solution, 0.1% SDS, and 0.1 mg/ml denaturated salmon sperm DNA for 4 h, washed in 0.2x SSC at 60°C, and exposed to autoradiography film. Radioactive bands were also quantified using a PhosphorImager screen and ImageQuant software (Molecular Dynamics).

In Situ Hybridizations.
On day 13.5 p.c., embryos were sacrificed, fixed in cold 4% paraformaldehyde, dehydrated through graded ethanol series, and embedded in paraffin wax. Seven-µm-thick paraffin sections were mounted in polylysine-pretreated slides. Tissue sections were then dewaxed, rehydrated, and treated with acetic anhydride. Specimens were then dehydrated and dried. In situ hybridizations were performed according to the method described in Lyons et al. (79) . A Sm2 genomic fragment of M-PGAM (5) was digested with NcoI and a 35S-UTP-labeled riboprobe was generated using T3 RNA polymerase. Hybridizations were carried out for 16 h at 60°C. Slides were then washed and exposed to Ilford autoradiographic emulsion for 5 weeks, developed in D19 Kodak solution, counterstained with 0.2% toluidine blue solution, and mounted in Permount. Alternatively, slides were exposed for 3 days to Kodak Biomax film.


    Acknowledgments
 
We thank J. Jacobberger, J. Nagy, G. Pons, M. Rico, and B. Vogelstein for reagents and suggestions.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by American Heart Association Grant 9750205N (to A. G.) and NIH Grants AI35098 (to A. S. B.) and HL46345 (to K. R. C.). Back

2 To whom requests for reprints should be addressed, at Department of Physiology and Biophysics, Case Western Reserve University School of Medicine, 10900 Euclid Avenue, Cleveland, OH 44106-4970. Phone: (216) 368-3400; Fax: (216) 368-3658; E-mail: axg29{at}po.cwru.edu Back

3 The abbreviations used are: M-PGAM, muscle-specific phosphoglycerate mutase gene; MCK, muscle creatine kinase gene; CAT, chloramphenicol acetyltransferase; CMV, cytomegalovirus; ANF, atrial natruiretic factor gene; MLC2v, myosin light chain 2v gene; EMSA, electrophoretic mobility-shift assay; p.c., postcoitum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. Back

Received for publication 10/15/98. Revision received 2/11/99. Accepted for publication 3/ 8/99.


    References
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Schultheiss T. M., Xydas S., Lassar A. B. Induction of avian cardiac myogenesis by anterior endoderm. Development (Camb.), 121: 4203-4214, 1995.[Abstract]
  2. Sugi Y., Lough J. Anterior endoderm is a specific effector of terminal cardiac myocyte differentiation of cells from the embryonic heart forming region. Dev. Dyn., 200: 155-162, 1994.[Medline]
  3. Olson E. N., Srivastava D. Molecular pathways controlling heart development. Science (Washington DC), 272: 671-676, 1996.[Abstract]
  4. Nakatsuji Y., Hidaka K., Tsujino S., Yamamoto Y., Mukai T., Yanagihara T., Kishimoto T., Sakoda S. A single MEF-2 site is a major positive regulatory element required for transcription of the muscle-specific subunit of the human phosphoglycerate mutase gene in skeletal and cardiac muscle cells. Mol. Cell. Biol., 12: 4384-4390, 1992.[Abstract/Free Full Text]
  5. Ruiz-Lozano P., de Lecea L., Buesa C., Perez de la Osa P., LePage D., Gualberto A., Walsh K., Pons G. The gene encoding rat phosphoglycerate mutase subunit M: cloning and promoter analysis in skeletal muscle cells. Gene, 147: 243-248, 1994.[Medline]
  6. Adamson E. D. Isoenzyme transitions of creatine phosphokinase, aldolase and phosphoglycerate mutase in differentiating mouse cells. J. Embryol. Exp. Morphol., 35: 355-367, 1976.[Medline]
  7. Weintraub H., Hauschka S., Tapscott S. J. The MCK enhancer contains a p53 responsive element. Proc. Natl. Acad. Sci. USA, 88: 4570-4571, 1991.[Abstract/Free Full Text]
  8. Zambetti G. P., Bargonetti J., Walker K., Prives C., Levine A. J. Wild-type p53 mediates positive regulation of gene expression through a specific DNA sequence element. Genes Dev., 6: 1143-1152, 1992.[Abstract/Free Full Text]
  9. Tamir Y., Bengal E. p53 protein is activated during muscle differentiation and participates with MyoD in the transcription of muscle creatine kinase gene. Oncogene, 17: 347-356, 1998.[Medline]
  10. Zhao J., Schmieg F. I., Logsdon N., Freedman D., Simmons D. T., Molloy G. R. p53 binds to a novel recognition sequence in the proximal promoter of the rat muscle creatine kinase gene and activates its transcription. Oncogene, 13: 293-302, 1996.[Medline]
  11. Momand J., Zambetti G. P., Olson D. C., George D., Levine A. J. The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell, 69: 1237-1245, 1992.[Medline]
  12. Oliner J. D., Kinzler K. W., Meltzer P. S., George D. L., Vogelstein B. Amplification of a gene encoding a p53-associated protein in human sarcomas. Nature (Lond.), 358: 80-83, 1992.[Medline]
  13. Soddu S., Blandino G., Scardigli R., Coen S., Marchetti A., Rizzo M. G., Bossi G., Cimino L., Crescenzi M., Sacchi A. Interference with p53 protein inhibits hematopoietic and muscle differentiation. J. Cell Biol., 134: 193-204, 1996.[Abstract/Free Full Text]
  14. Chen P. L., Chen Y. M., Bookstein R., Lee W. H. Genetic mechanisms of tumor suppression by the human p53 gene. Science (Washington DC), 250: 1576-1580, 1990.[Abstract/Free Full Text]
  15. Kern S. E., Pietenpol J. A., Thiagalingam S., Seymour A., Kinzler K. W., Vogelstein B. Oncogenic forms of p53 inhibit p53-regulated gene expression. Science (Washington DC), 256: 827-830, 1992.[Abstract/Free Full Text]
  16. Harvey M., Vogel H., Morris D., Bradley A., Bernstein A., Donehower L. A. A mutant p53 transgene accelerates tumour development in heterozygous but not nullizygous p53-deficient mice. Nat. Genet., 9: 305-311, 1995.[Medline]
  17. Farmer G., Bargonetti J., Zhu H., Friedman P., Prywes R., Prives C. Wild-type p53 activates transcription in vitro. Nature (Lond.), 358: 83-86, 1992.[Medline]
  18. Schmale H., Bamberger C. A novel protein with strong homology to the tumor suppressor p53. Oncogene, 15: 1363-1367, 1997.[Medline]
  19. Osada M., Ohba M., Kawahara C., Ishioka C., Kanamaru R., Katoh I., Ikawa Y., Nimura Y., Nakagawara A., Obinata M., Ikawa S. Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat. Med., 4: 839-843, 1998.[Medline]
  20. Trink B., Okami K., Wu L., Sriuranpong V., Jen J., Sidransky D. A new human p53 homologue. Nat. Med., 4: 747-748, 1998.[Medline]
  21. Bian J., Sun Y. p53CP, a putative p53 competing protein that specifically binds to the consensus p53 DNA binding sites: a third member of the p53 family?. Proc. Natl. Acad. Sci. USA, 94: 14753-14758, 1997.[Abstract/Free Full Text]
  22. Jost C. A., Marin M. C., Kaelin W. G., Jr. p73 is a human p53-related protein that can induce apoptosis. Nature (Lond.), 389: 191-194, 1997.[Medline]
  23. Kaghad M., Bonnet H., Yang A., Creancier L., Biscan J. C., Valent A., Minty A., Chalon P., Lelias J. M., Dumont X., Ferrara P., McKeon F., Caput D. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell, 90: 809-819, 1997.[Medline]
  24. Di Como C. J., Gaiddon C., Prives C. p73 function is inhibited by tumor-derived p53 mutants in mammalian cells. Mol. Cell. Biol., 19: 1438-1449, 1999.[Abstract/Free Full Text]
  25. Senoo M., Seki N., Ohira M., Sugano S., Watanabe M., Inuzuka S., Okamoto T., Tachibana M., Tanaka T., Shinkai Y., Kato H. A second p53-related protein, p73L, with high homology to p73. Biochem. Biophys. Res. Commun., 248: 603-607, 1998.[Medline]
  26. Harris A. N., Ruiz-Lozano P., Chen Y. F., Sionit P., Yu Y. T., Lilly B., Olson E. N., Chien K. R. A novel A/T-rich element mediates ANF gene expression during cardiac myocyte hypertrophy. J. Mol. Cell. Cardiol., 29: 515-525, 1997.[Medline]
  27. Zhu H., Garcia A. V., Ross R. S., Evans S. M., Chien K. R. A conserved 28-base-pair element (HF-1) in the rat cardiac myosin light- chain-2 gene confers cardiac-specific and {alpha}-adrenergic-inducible expression in cultured neonatal rat myocardial cells. Mol. Cell. Biol., 11: 2273-2281, 1991.[Abstract/Free Full Text]
  28. Wang Y., Reed M., Wang P., Stenger J. E., Mayr G., Anderson M. E., Schwedes J. F., Tegtmeyer P. p53 domains: identification and characterization of two autonomous DNA-binding regions. Genes Dev., 7: 2575-2586, 1993.[Abstract/Free Full Text]
  29. Pavletich N. P., Chambers K. A., Pabo C. O. The DNA-binding domain of p53 contains the four conserved regions and the major mutation hot spots. Genes Dev., 7: 2556-2564, 1993.[Abstract/Free Full Text]
  30. Bargonetti J., Manfredi J. J., Chen X., Marshak D. R., Prives C. A proteolytic fragment from the central region of p53 has marked sequence-specific DNA-binding activity when generated from wild-type but not from oncogenic mutant p53 protein. Genes Dev., 7: 2565-2574, 1993.[Abstract/Free Full Text]
  31. Banks L., Matlashewski G., Crawford L. Isolation of human-p53-specific monoclonal antibodies and their use in the studies of human p53 expression. Eur. J. Biochem., 159: 529-534, 1986.[Medline]
  32. Vojtesek B., Bartek J., Midgley C. A., Lane D. P. An immunochemical analysis of the human nuclear phosphoprotein p53. New monoclonal antibodies and epitope mapping using recombinant p53. J. Immunol. Methods, 151: 237-244, 1992.[Medline]
  33. Hupp T. R., Meek D. W., Midgley C. A., Lane D. P. Regulation of the specific DNA binding function of p53. Cell, 71: 875-886, 1992.[Medline]
  34. Gannon J. V., Greaves R., Iggo R., Lane D. P. Activating mutations in p53 produce a common conformational effect. A monoclonal antibody specific for the mutant form. EMBO J., 9: 1595-1602, 1990.[Medline]
  35. Andres V., Cusso R., Carreras J. Distribution and developmental transition of phosphoglycerate mutase and creatine phosphokinase isozymes in rat muscles of different fiber-type composition. Differentiation, 41: 72-77, 1989.[Medline]
  36. Kim K. K., Soonpaa M. H., Daud A. I., Koh G. Y., Kim J. S., Field L. J. Tumor suppressor gene expression during normal and pathologic myocardial growth. J. Biol. Chem., 269: 22607-22613, 1994.[Abstract/Free Full Text]
  37. Sah V. P., Attardi L. D., Mulligan G. J., Williams B. O., Bronson R. T., Jacks T. A subset of p53-deficient embryos exhibit exencephaly. Nat. Genet., 10: 175-180, 1995.[Medline]
  38. Schmid P., Lorenz A., Hameister H., Montenarh M. Expression of p53 during mouse embryogenesis. Development (Camb.), 113: 857-865, 1991.[Abstract]
  39. Armstrong J. F., Kaufman M. H., Harrison D. J., Clarke A. R. High-frequency developmental abnormalities in p53-deficient mice. Curr. Biol., 5: 931-936, 1995.[Medline]
  40. Unger T., Mietz J. A., Scheffner M., Yee C. L., Howley P. M. Functional domains of wild-type and mutant p53 proteins involved in transcriptional regulation, transdominant inhibition, and transformation suppression. Mol. Cell. Biol., 13: 5186-5194, 1993.[Abstract/Free Full Text]
  41. Hachiya M., Chumakov A., Miller C. W., Akashi M., Said J., Koeffler H. P. Mutant p53 proteins behave in a dominant, negative fashion in vivo. Anticancer Res., 14: 1853-1859, 1994.[Medline]
  42. Chen J. Y., Funk W. D., Wright W. E., Shay J. W., Minna J. D. Heterogeneity of transcriptional activity of mutant p53 proteins and p53 DNA target sequences. Oncogene, 8: 2159-2166, 1993.[Medline]
  43. Louis J. M., McFarland V. W., May P., Mora P. T. The phosphoprotein p53 is down-regulated post-transcriptionally during embryogenesis in vertebrates. Biochim. Biophys. Acta, 950: 395-402, 1988.[Medline]
  44. Feinstein E., Gale R. P., Reed J., Canaani E. Expression of the normal p53 gene induces differentiation of K562 cells. Oncogene, 7: 1853-1857, 1992.[Medline]
  45. Gerwin B. I., Spillare E., Forrester K., Lehman T. A., Kispert J., Welsh J. A., Pfeifer A. M., Lechner J. F., Baker S. J., Vogelstein B., et al Mutant p53 can induce tumorigenic conversion of human bronchial epithelial cells and reduce their responsiveness to a negative growth factor, transforming growth factor ß-1. Proc. Natl. Acad. Sci. USA, 89: 2759-2763, 1992.[Abstract/Free Full Text]
  46. Kastan M. B., Radin A. I., Kuerbitz S. J., Onyekwere O., Wolkow C. A., Civin C. I., Stone K. D., Woo T., Ravindranath Y., Craig R. W. Levels of p53 protein increase with maturation in human hematopoietic cells. Cancer Res., 51: 4279-4286, 1991.[Abstract/Free Full Text]
  47. Shaulsky G., Goldfinger N., Rotter V. Alterations in tumor development in vivo mediated by expression of wild-type or mutant p53 proteins. Cancer Res., 51: 5232-5237, 1991.[Abstract/Free Full Text]
  48. Shaulsky G., Goldfinger N., Peled A., Rotter V. Involvement of wild-type p53 in pre-B-cell differentiation in vitro. Proc. Natl. Acad. Sci. USA, 88: 8982-8986, 1991.[Abstract/Free Full Text]
  49. Radinsky R., Fidler I. J., Price J. E., Esumi N., Tsan R., Petty C. M., Bucana C. D., Bar-Eli M. Terminal differentiation and apoptosis in experimental lung metastases of human osteogenic sarcoma cells by wild-type p53. Oncogene, 9: 1877-1883, 1994.[Medline]
  50. Woodworth C. D., Wang H., Simpson S., Alvarez-Salas L. M., Notario V. Overexpression of wild-type p53 alters growth and differentiation of normal human keratinocytes but not human papillomavirus-expressing cell lines. Cell Growth Differ., 4: 367-376, 1993.[Abstract]
  51. Donehower L. A., Harvey M., Slagle B. L., McArthur M. J., Montgomery C. A., Jr., Butel J. S., Bradley A. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature (Lond.), 356: 215-221, 1992.[Medline]
  52. Jacks T., Remington L., Williams B. O., Schmitt E. M., Halachmi S., Bronson R. T., Weinberg R. A. Tumor spectrum analysis in p53-mutant mice. Curr. Biol., 4: 1-7, 1994.[Medline]
  53. Kaufman M. H., Kaufman D. B., Brune R. M., Stark M., Armstrong J. F., Clarke A. R. Analysis of fused maxillary incisor dentition in p53-deficient exencephalic mice. J. Anat., 191: 57-64, 1997.
  54. Baker S. J., Markowitz S., Fearon E. R., Willson J. K., Vogelstein B. Suppression of human colorectal carcinoma cell growth by wild-type, p53. Science (Washington DC), 249: 912-915, 1990.[Abstract/Free Full Text]
  55. Vogelstein B., Kinzler K. W. p53 function and dysfunction. Cell, 70: 523-526, 1992.[Medline]
  56. Finlay C. A., Hinds P. W., Levine A. J. The p53 proto-oncogene can act as a suppressor of transformation. Cell, 57: 1083-1093, 1989.[Medline]
  57. Eliyahu D., Michalovitz D., Eliyahu S., Pinhasi-Kimhi O., Oren M. Wild-type p53 can inhibit oncogene-mediated focus formation. Proc. Natl. Acad. Sci. USA, 86: 8763-8767, 1989.[Abstract/Free Full Text]
  58. Michalovitz D., Halevy O., Oren M. Conditional inhibition of transformation and of cell proliferation by a temperature-sensitive mutant of p53. Cell, 62: 671-680, 1990.[Medline]
  59. Levine A. J., Momand J., Finlay C. A. The p53 tumour suppressor gene. Nature (Lond.), 351: 453-456, 1991.[Medline]
  60. Holtzer H., Schultheiss T., Dilullo C., Choi J., Costa M., Lu M., Holtzer S. Autonomous expression of the differentiation programs of cells in the cardiac and skeletal myogenic lineages. Ann. N.Y. Acad. Sci., 599: 158-169, 1990.[Medline]
  61. Rumyantsev P. P., Borisov A. DNA synthesis in myocytes from different myocardial compartments of young rats in norm, after experimental infarction and in vitro. Biomed. Biochim. Acta, 46: S610-S615, 1987.[Medline]
  62. Clubb F. J., Jr., Bishop S. P. Formation of binucleated myocardial cells in the neonatal rat. An index for growth hypertrophy. Lab. Invest., 50: 571-577, 1984.[Medline]
  63. Macleod K. F., Sherry N., Hannon G., Beach D., Tokino T., Kinzler K., Vogelstein B., Jacks T. p53-dependent and independent expression of p21 during cell growth, differentiation, and DNA damage. Genes Dev., 9: 935-944