Cell Growth & Differentiation Vol. 10, 279-286, April 1999
© 1999 American Association for Cancer Research
Specific Methylation Events Contribute to the Transcriptional Repression of the Mouse Tissue Inhibitor of Metalloproteinases-3 Gene in Neoplastic Cells
William D. Pennie1,
Glenn A. Hegamyer,
Matthew R. Young and
Nancy H. Colburn2
Gene Regulation Section, Laboratory of Biochemical Physiology, Building 560, National Cancer Institute, Frederick Cancer Research and Development Center, Frederick, Maryland 21702
 |
Abstract
|
|---|
The tissue inhibitor of metalloproteinases-3 (TIMP-3) gene is specifically down-regulated in neoplastic cells of the mouse JB6 progression model, suggesting a role for TIMP-3 inactivation in neoplastic progression. On the basis of 5-azacytidine reversal, the mechanism for this down-regulation appears to involve changes in the methylation state of the TIMP-3 promoter. Although total genomic methylation levels are comparable, specific differences in the methylation of the TIMP-3 promoter were observed between preneoplastic and neoplastic JB6 cells at three HpaII sites, with preneoplastic cells being less methylated. Expression of antisense methyltransferase in a neoplastic JB6 variant known to be hypermethylated in TIMP-3 resulted in reactivation of the endogenous TIMP-3 gene and restoration of hypomethylated status to the three implicated HpaII sites. Thus, hypermethylation at specific sequences in the TIMP-3 promoter appears to contribute to the silencing of the gene in neoplastic cells.
 |
Introduction
|
|---|
The identification of candidate oncogenes or tumor suppressor genes, the expression patterns of which are altered during neoplastic progression, is fundamental to understanding the mechanisms of carcinogenesis. One valuable model system in the search for such candidate genes in our laboratory and others is the murine JB6 cell culture model system, which consists of three phenotypically distinct cell variants: P-, which are resistant to tumor promoter-induced neoplastic transformation; P+, which are sensitive to such promoter action; and Tx, which are neoplastic derivatives of P+ (1)
. By using the differential display mapping technique (2)
, we have demonstrated previously that the TIMP-33
gene (3
, 4)
is down-regulated in neoplastic cells; the expression of the gene is detectable only in preneoplastic (P- and P+) JB6 phenotypes (5
, 6)
. This loss of mTIMP-3 expression in neoplastic JB6 cells does not take place by mutation of promoter sequences or gross gene rearrangements (6)
, suggesting that an epigenetic regulatory event leads to lack of expression in the neoplastic JB6 cells. The TIMP genes are a family of related but distinct genes that are natural inhibitors of metalloproteinase activity (7
, 8)
. Because the matrix metalloproteinase genes and their inhibitors have been implicated as being involved in tumor oncogenicity (9)
and invasion/metastasis (10, 11, 12)
, TIMP-3 was therefore a candidate for having a role in the neoplastic transformation process as modeled in the JB6 system. Although stable expression of TIMP-3 in neoplastic JB6 cells has been shown to be insufficient to suppress tumorigenicity (13)
, tumor growth in nude mice of DLD-1 human colon carcinoma cells is dramatically reduced when TIMP-3 is re-expressed (14)
.
We have previously identified putative transcription factor binding sites on the TIMP-3 promoter including six AP-1 sites, nine for PEA3, two for c-fos-SRE, two nuclear factor-
B sites, two p53 DNA binding motifs (imperfect), three Sp1 sites, one cMyc site, three TATA boxes (-10, -80, and -165), and a GC box TIMP-3 (6)
. The significance of AP-1 binding sites in mouse TIMP-3 has been established (15)
, as has the lack of importance of the p53 binding site (16)
. Similar analyses of transcriptional regulation have been performed for other TIMP genes (17
, 18)
. The human TIMP-3 promoter has been analyzed, and serum response elements together with strong negative regulatory regions have been delineated (19)
. In the case of mouse TIMP-3, the observation that transfected TIMP-3 promoter-reporter plasmids are transcriptionally competent in neoplastic cells where the endogenous gene is inactive indicates that lack of transcription factor activity in neoplastic cells is not the mechanism for the deregulation of TIMP-3 (Refs. 6
and 15
and this manuscript). A possible mechanism of down-regulation of TIMP-3 in neoplastic cells is differential DNA methylation. Abnormal methylation, particularly hypermethylation of tumor suppressor gene promoters, has been observed in cancer cells (20
, 21)
, and DNA methylation is known to be an important regulatory mechanism for transcription of many genes. Initial studies in JB6 cells showed that the methylation status of the methylation-sensitive HpaII restriction enzyme sites in the TIMP-3 promoter and in the TIMP-3 gene downstream of the transcription start site (as assayed by HpaII digestion of genomic DNA followed by Southern blotting) varies between JB6 phenotypes (6)
. The L variant of RT101 neoplastic cells is hypermethylated at these HpaII sites, whereas the H variant (also silenced for TIMP-3 expression) is hypomethylated. Treatment of L but not HRT101 cells with a methylase inhibitor (5-azacytidine) restored TIMP-3 transcription, suggesting that methylation events may have played a critical role in repressing transcription only in the L variant. The level of resolution of these original Southern blotting experiments did not, however, permit the identification of methylation status at specific HpaII sites. We have now extended these initial studies to map the methylation status at individual sites and report regulatory site-specific methylation events in transformed JB6 cells.
 |
Results
|
|---|
The TIMP-3 Promoter Contains a High Concentration of Possible Methylation Sites.
The CpG sites in the mouse TIMP-3 promoter are diagrammed in Fig. 1
. The concentration of these possible methylation sites is particularly striking in the vicinity of the transcriptional start site (nucleotides -250 to 300), giving weight to the suggestion that methylation events may influence the transcription of the gene. Additionally, the promoter region contains a total of 11 HpaII sites (CCGG) that facilitate analysis of the methylation status of different sites in the promoter by the use of the methylation-sensitive restriction enzyme HpaII.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1. Map of possible methylation sites on the mTIMP-3 promoter. CpG dinucleotides are marked with vertical lines, and HpaII methylation sites 111 (nucleotide positions -1938, -1818, -218, -143, -138, -108, 97, 162, 192, 222, and 457) are shown as vertical arrows. The site of initiation of transcription (+1) is marked with a horizontal arrow. The map illustrates the high concentration of possible methylated cytosines between approximately -250 to 300 nucleotides.
|
|
In Vitro Methylation of TIMP-3 Promoter Reporter Plasmids at HpaII Sites Affects Silencing of the Promoter in Preneoplastic JB6 Cells.
Total genome methylation levels between preneoplastic and neoplastic JB6 phenotypes are very similar (data not shown), indicating comparable methylase activity levels, and that large-scale global changes in methylation are unlikely to be responsible for the different phenotypes of JB6 variants. Previous work from our laboratory indicated that alterations of methylation levels by exposure to 5-azacytidine can restore expression of endogenous TIMP-3 in LRT101 variant neoplastic JB6 cells (6)
, suggesting that specific methylation events on the TIMP-3 gene may contribute to promoter silencing. As a precursor to analyzing the methylation status of endogenous TIMP-3 promoter, we asked whether TIMP-3 promoter reporter constructs were sensitive to methylation at HpaII sites. We subjected the TIMP-3 promoter-luciferase constructs shown in Fig. 2A
to HpaII methylation. Attempts to digest the in vitro methylated templates with the methylation-sensitive restriction enzyme HpaII demonstrated that the templates were effectively methylated to completion (Fig. 2B)
.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2. In vitro methylation of TIMP-3 reporter constructs. A, map of reporter constructs used in in vitro methylation and transfection experiments. HpaII methylation sites (CCGG) are indicated by the numbers along the top of each construct. Construct p2.9 TIMP3-luc contains only HpaII sites 16, 5' to the site of initiation of transcription (1; marked with an arrow). pM10TIMP3-luc contains additional 3' sequences extending beyond HpaII site 10. B, in vitro methylation of reporter constructs. Lane 1, unmethylated p2.9TIMP3-luc cut with HpaII; Lane 2, HpaII methylase-treated p2.9TIMP3-luc cut with HpaII; Lane 3, unmethylated pM10TIMP3-luc cut with HpaII; Lane 4, HpaII methylase-treated pM10TIMP3-luc cut with HpaII. Migration of marker bands (bp) are indicated.
|
|
Although the endogenous TIMP-3 gene is inactive in neoplastic cells, the unmethylated TIMP-3 luciferase reporter plasmids showed both basal and TPA-inducible activity in all JB6 variants, demonstrating that the neoplastic cells have the full repertoire of transcription factors required for TIMP-3 expression and suggesting that the deregulation of the endogenous gene in these cells takes place via epigenetic events (6)
. Comparison of methylated TIMP-3 reporter templates with mock-methylated controls in transfection assays demonstrated that methylation at the HpaII sites resulted in a dramatic loss in promoter activity in preneoplastic JB6 P+ cells (Fig. 3)
. The construct containing HpaII sites 1 through 6 (p2.9) showed 80 and 90% inhibition, respectively, of basal and TPA-induced transcriptional activity in response to complete methylation. The construct harboring sites 1 through 10 (pM10) showed 72 and 80% inhibition of basal and TPA-induced activity. The reduction in activity is being mediated by methylation events in the promoter region of the plasmids rather than in the backbone or reporter gene regions as control experiments with pCol-luc, which shares the same parental vector and luciferase reporter gene as the TIMP-3 plasmids but uses the -73 to 63 collagenase promoter (22)
, demonstrated negligible effects after exposure to HpaII methylase (data not shown). It is noteworthy that the -73 to 63 sequence of the collagenase promoter used contains no CpG sites in the sense strand. Similar inhibition due to promoter methylation was seen with P- and Tx L and H RT101 JB6 recipient cells (data not shown). These results indicate that complete methylation at only a subset of possible methylation sites (i.e., at the sequence CCGG) can significantly reduce transcriptional competence of the TIMP-3 promoter. This raises the possibility that differential methylation of these sites in vivo may be mechanistically involved in the silencing of the endogenous gene in neoplastic cells.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 3. Effect of in vitro methylation on transcriptional activity of transfected TIMP-3 promoter-luciferase reporter genes. Cells were transfected as described in "Materials and Methods," and luciferase activity was assayed as a measure of TIMP-3 promoter activity. Raw data were normalized to the activity of the unmethylated p2.9TIMP3-luc plasmid for each cell line. The error for M10TIMP-3 + TPA was less than ± 0.01; bars, SD. Results are shown for P+ cells and were similar for P- LRT101 and HRT101 cells. The possibility that the luciferase sequence might be methylation sensitive was excluded by using the control plasmid pCol-luc consisting of the collagenase promoter driving luciferase (cloned in the same vector as used for TIMP-3 sequences). No effect of methylation on pCol-luc construct activity was detected (data not shown).
|
|
PCR-based Methylation Analysis at HpaII Sites in the TIMP-3 Promoter Reveals Differential Methylation Status.
The in vitro methylation and transfection results above demonstrate that complete methylation of a discrete subset of methylation sites can significantly reduce TIMP-3 promoter activity. To establish whether differential methylation at these sites correlated with activity of the endogenous TIMP-3 gene, we attempted to map the methylation status of individual HpaII sites 211 by a PCR-based analysis. Results for each site were repeated in at least three separate experiments using independently isolated genomic DNA. To ensure that overcycling of PCR reactions was not occurring, we repeated sample reactions under identical PCR conditions except for using 5' 32P end-labeled primers and reducing the number of PCR cycles to 10. Under these conditions, we detected the same methylation as observed by the nonradioactive method outlined here (data not shown), thus ensuring a semiquantitative assay capable of distinguishing partial from complete methylation. Sample results for sites 2 and 11 (representing the most 5' and 3' sites analyzed, respectively) are shown in Fig. 4
. When compared with controls (C), site 2 was found to be fully methylated in all samples (H) as indicated by similar levels of PCR fragments. Site 11, on the other hand, showed levels of diagnostic PCR products similar to undigested controls in the Tx samples, indicating fully methylated status, but showed reduced levels (P+) or absence of PCR fragment (P-) in preneoplastic cells, indicating partially methylated and unmethylated status, respectively. The methylation status for all sites analyzed is diagrammed in Fig. 5
. It should be noted that HpaII site 1 failed to give consistent mapping results, and that the proximity of HpaII sites 5 and 4 did not allow independent analysis of the methylation status of site 5. These analyses demonstrated that sites 2, 3, 4, 8, and 9 appear to be largely fully methylated, irrespective of phenotype or activity of the endogenous TIMP-3 gene (Fig. 5)
. Sites 7, 10, and 11 showed undermethylation in preneoplastic cell lines (P- and P+) relative to neoplastic cells. It should be noted that the significant changes in methylation pattern between preneoplastic and neoplastic cells are all observed downstream of transcriptional initiation (sites 7, 10, and 11). Because we were unable to determine methylation at HpaII sites 1 and 5 and obtained only partial data for lack of methylation at site 6, it remains possible that methylation at these upstream sites may be also mechanistically important in vivo and may contribute to the silencing of the reporter constructs in the transfection experiments. It is noteworthy that HpaII sites 7, 10, and 11 are completely unmethylated in the least progressed P- cells, completely methylated in the most progressed transformed (Tx) variants, and partially methylated in the P+ cells having an intermediate progression phenotype.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 4. Mapping the methylation state of the HpaII sites in the TIMP-3 promoter. Sample PCR mapping reactions are shown for methylation at HpaII sites 2 and 11. Genomic DNA from each cell line was digested to completion with HpaII or MspI under conditions of low DNA concentration (50 ng/µl) as outlined in "Materials and Methods" and then used as a substrate for PCR reactions using primers flanking the HpaII sites. Preneoplastic (P- or P+) JB6 cells express TIMP-3, whereas neoplastic (Tx) variants (L and H RT101) do not. LRT101 cells but not HRT101 cells regain TIMP-3 expression in response to 5AzaC exposure. H, digested with methylation-sensitive HpaII; M, digested with methylation-insensitive isoschizomer MspI; C, undigested. In the H lanes, fully methylated samples (e.g., LRT101, site 11) show a characteristic PCR product, whereas unmethylated samples (e.g., 302A, site 11) do not. Samples containing some methylated and some unmethylated molecules (e.g., Cl41, Cl22, site 11) show reduced levels of the PCR product.
|
|
Cells Expressing Antisense Methyl Transferase Show Gain of TIMP-3 Expression and Specific Site Demethylation.
The results of the transfections of in vitro methylated promoter-reporters (Fig. 3)
and the in vivo HpaII methylation status mapping (Fig. 5)
suggest that methylation differences between preneoplastic and neoplastic JB6 cells may mechanistically be involved in transcriptional regulation. We next endeavored to modulate methylation on the endogenous TIMP-3 promoter by generating stable drug-resistant cell lines expressing antisense methyltransferase. The antisense methyltransferase transfectants showed no statistically significant difference in total genomic methylation levels from that seen in the vector controls by a methyl acceptor assay (data not shown). It is possible that dramatic changes in overall genomic methylation pattern would have been detrimental to growth of this cell line and were selected against. Measurement of the expression of the transfected antisense methyltransferase by RT-PCR analysis (Fig. 6a)
showed detection of antisense message in the transfectant but not in the vector-only controls, whereas a similarly sized product was detected for both antisense and vector transfected samples when the RT-PCR reaction was performed in the sense direction. P+ (C141) cells stably expressing antisense methyltransferase when treated with TPA showed only 20% of the transformation response of wild-type cells as measured by growth in soft agar whereas stably transfected LRT101 neoplastic cells showed a reproducibly elevated "basal" anchorage-independent growth (data not shown). This change in the transformation phenotype of antisense methylase transfectants is the sort of change that could arise from decreased methylation at a few sites in a few genes rather than from global changes in the methylation status of the genome.
We examined the expression of the TIMP-3 gene in antisense methylase-expressing cells by Northern blot analysis. The most striking finding from this analysis was that LRT101 Tx cells stably expressing antisense methylase (Fig. 6a)
showed a detectable level of TIMP-3 mRNA (Fig. 6b)
with transcript sizes similar to those seen in P- and P+ JB6 cells, a result that is in agreement with previous experiments using 5-azacytidine (6)
. Also in agreement with the 5-azacytidine experiments (6)
is the observation that expression of antisense methylase does not produce TIMP-3 re-expression in HRT101 cells. The HRT101 cells represent a "negative control," the TIMP-3 expression of which is known not to be inducible by inhibiting methylation. Taken together, these results suggest a necessary but insufficient role for promoter hypomethylation in activating TIMP-3 transcription. It should be noted that the detected expression level of TIMP-3 in the LRT101 transfectants was low, although clearly higher than parental neoplastic cells and estimated at 510% of the level seen in JB6 P- cells. These observations suggest that although altering methyltransferase activity can restore TIMP-3 promoter activity to some degree in the TIMP-3 hypermethylated LRT101 cells, the induced methylation changes are not sufficient to recapitulate the magnitude of transcription observed in preneoplastic cells.
The restored activity of the TIMP-3 promoter in antisense methyltransferase-expressing RT101 cells allowed us to determine whether TIMP-3 re-expression is accompanied by site-specific changes in methylation. We analyzed the methylation status of site 2 (always fully methylated in all JB6 lineages) and sites 7, 10, and 11 (show a differential methylation pattern) in these cell lines (Fig. 7)
. TIMP-3 re-expressing LRT101 cells that express antisense methyltransferase (Fig. 6)
were found to have unaltered methylation at site 2 and decreased methylation at sites 7, 10, and 11 (Fig. 7)
to a pattern more consistent with a preneoplastic active copy of the gene (Fig. 5)
. Decreased methylation at sites 7 and 11 also occurred in HRT101 cells, where TIMP-3 expression was known to be insensitive to decreases in methylation. The occurrence of re-expression of TIMP-3 in methylation-sensitive LRT101 cells simultaneously with decreased methylation at distinct sites suggests that methylation at these sites 7, 10, and 11 is mechanistically involved in gene silencing and that hypomethylation at these sites is required but insufficient to fully activate TIMP-3 transcription.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7. Methylation status of TIMP-3 promoter HpaII sites 2, 7, 10, and 11 in JB6 cells expressing antisense methyl transferase. The methylation status of individual HpaII sites in the indicated JB6 cell lines was determined as described for Fig. 5
. The methylation pattern of the parental genomic DNA is indicated by the boxes. The methylation status at each site in each cell line was confirmed in at least three separate experiments. L but not H RT101 cells regain TIMP-3 expression in response to 5-AzaC.
|
|
 |
Discussion
|
|---|
The inactivation of expression by aberrant methylation density has been demonstrated for a number of tumor suppressor genes including p16 (23, 24, 25)
, VHL (26)
, and E-cadherin (27)
. The present study extends this inquiry to now implicate specific-site methylation in the control of mouse TIMP-3 expression. The mapping of the methylation status of the HpaII sites in the TIMP-3 promoter demonstrates that sites 7, 10, and 11 (at positions 97, 222, and 457 relative to the transcriptional start) show a differential methylation status, being more heavily methylated in TIMP-3 nonexpressing cells. The possibility that site-specific differential methylation events may be mechanistically involved in the silencing of TIMP-3 expression is strengthened for the first time by the observation that LRT101 neoplastic cells expressing antisense methyltransferase have detectable TIMP-3 mRNA while adopting a more preneoplastic (reduced) methylation pattern at HpaII sites 7, 10, and 11. Re-expression of TIMP-3 has been shown to be insufficient to cause suppression of the neoplastic phenotype in JB6 cells (13)
, and indeed the antisense methyltransferase-expressing LRT101 cells show no suppression of transformed phenotype by soft agar growth assay. The fact that the HRT101 cells expressing antisense methylase showed reduced methylation at sites 7 and 11 without regaining TIMP-3 mRNA expression indicates the insufficiency of reduced methylation at these sites for up-regulating TIMP-3 expression. The recalcitrance of HRT101 cells was expected based on the previous observation that 5AzaC treatment of HRT101 cells produced no gain of TIMP-3 transcription (6)
. The L and H RT101 tumor cells may recapitulate a situation often seen in human cancer in which a tumor suppressor gene may be down-regulated by different mechanisms in different patients. In the case of the HRT101 cells, TIMP-3 may be down-regulated by a mechanism independent of methylation that supercedes changes in methylation status. The mapping of HpaII methylation of the TIMP-3 promoter in 5AzaC-treated HRT101 cells may give information on the methylation events involved in TIMP-3 transcriptional "switching" in these cells, and such experiments are presently being investigated in our laboratory.
This methylation mapping technique allows us to assay the methylation status at a subset (i.e., HpaII sites) of possible methylation events. Mapping the methylation status of other CpG sites in the TIMP-3 promoter using the high resolution sodium bisulfite sequencing (28)
may prove informative. In any case, the results presented show that the methylation status at the subset of sites analyzed here influences transcriptional activity of TIMP-3. Using other techniques for mapping possible methylation sites not included in this analysis should extend our understanding of the role of specific methylation events in the regulation of this gene.
The mechanism of the silencing of TIMP-3 in neoplastic cells by methylation is unclear. Methylation-sensitive protein interactions have been implicated in the regulatory activity of the promoters of genes such as the mouse M-Lysozyme gene and male-specific P450 (29
, 30)
. Additionally, repressor molecules have been shown to bind specifically to methylated DNA (31)
. Analysis of the effect of methylation on transcription factor binding events at the differentially methylated TIMP-3 HpaII sites by electrophoretic mobility bandshift assay should prove interesting.
Although methylation can directly interfere with transcription factor binding or transcriptional initiation, a recent report demonstrated that DNA methylation at sites downstream of the transcriptional start inhibited transcriptional elongation in a neurospora model (32)
. This is of particular relevance to the results presented here because the critical methylation events in TIMP-3 appear to be downstream of the promoter. It is thus possible that transcriptional elongation, rather than initiation, may be the mechanism by which TIMP-3 can be regulated by methylation. In addition to a role for methylation in the loss of mTIMP-3 expression in neoplastic JB6 cells, there may be an impact of other epigenetic mechanisms of transcriptional regulation. Nucleoprotein structure has been shown to have a profound effect on the transcriptional regulation of a large number of genes (33, 34, 35)
. It is interesting to consider the possibility that TIMP-3 is in a different chromatin architecture in preneoplastic and neoplastic JB6 cells, possibly due to particular methylation differences of the DNA, which contributes to the differential activity of the gene. Indeed there is evidence to suggest that methylation events may impact nucleoprotein architecture (36, 37)
.
 |
Materials and Methods
|
|---|
Cell Lines/Antisense Cell Lines.
JB6 cells were grown in Eagles minimal essential medium containing 5% FCS. All media and sera were obtained from Life Technologies, Inc. Cell doubling times for P-, P+ (Cl41 and Cl22), and Tx (RT101) are approximately 28, 24, and 16 h, respectively.
Reporter Plasmids, Luciferase Assays, and in Vitro Methylation.
TIMP-3 reporter sequences were cloned into the polylinker of pGL-2 basic (Promega). Plasmid p2.9TIMP3-luc (6)
includes HpaII sites 16 (6)
. Plasmid pM10TIMP3-luc contains extended sequence 3' to 360 and includes HpaII sites 110, generated by PCR from a 3.4-kb mTIMP-3 genomic clone template (6)
. Plasmid pCol-luc has been described previously (22)
, as have transient transfection techniques (38)
. Reporter constructs were transfected into JB6 cells, and luciferase activity was measured as described (15)
. Activity is calculated as light units/ß-galactosidase activity per µl of lysate. Plasmids used in transfection assays were methylated as follows. Ten-µg aliquots (3, 4, 5)
of each plasmid were incubated with HpaII methylase enzyme (New England BioLabs). Mock methylated control reactions omitted the HpaII methylase. After DNA purification, complete methylation was confirmed. Samples and mock-methylated controls were incubated with HpaII restriction enzyme (New England BioLabs). The samples were resolved on 1% agarose gels.
Generation of Stably-expressing Antisense Methyl Transferase Cell Lines.
JB6 cells were transfected in 12-well dishes with the plasmid p2
Met, a kind gift of Dr. Moshe Szyf (McGill University, Montreal, Quebec, Canada) which consists of the metallothionein promoter driving the methyltransferase cDNA in an antisense orientation (39)
. Cells were cotransfected with p2
Met and pSV2neo, selected with G418 supplemented media (0.5 mg/ml G418), and the colonies were pooled and expanded (maintaining drug selection) before being tested for transformation potential, genomic methylation levels, TIMP-3 expression, and methylation state at individual HpaII sites. Expression of several genes in mouse JB6 cells has been achieved using a metallothionein promoter-driven construct (13)
. Because little or no enhancement was obtained with metal induction and because metal ion exposure is toxic, basal expression was used for all experiments.
RT-PCR and Northern Blotting.
RNA isolation used RNazol solution, obtained from (TEl-Test, Friendswood, TX), and was performed as per manufacturers protocols. Total RNA (1 µg) was reverse-transcribed [as described by MacLeod and Szyf (40)
] with either a sense primer corresponding to bases 130 in the published mouse DNA MeTase cDNA sequence (41)
, 5'-GCAAACAGAAATAAAAAGCCAGTTGTGTGA-3' to detect antisense RNA or an antisense primer corresponding to bases 475451, or 5'-CCACAGCAGCTGCAGCACCACTCT-3' to detect sense DNA MeTase. RNA was reverse transcribed by adding 1 µM of primer and 200 µ of MULV RT (Boehringer Mannheim) and incubating for 10 min 25°C, 60 min 42°C, 5 min 72°C, and 5 min 50°C. The resulting cDNA was PCR using GeneAmp PCR kit from Perkin-Elmer. One-half of the reverse transcriptase product was added to the PCR reaction containing both sense and antisense primers, heated to 94° for 1.5 min, and then cycled for 1 min each at 94°C, 55°C, and 72°C for 30 cycles. For ß-actin sense primer, 5'- CCAGATCATGTTTGAGACCT and antisense primer, 5'-CTGGTTGCCAATAGTGATGA (42)
were used. PCR products were separated on a 1.2% agarose gel and visualized by ethidium bromide staining. Northern blots were performed using Zetabind membrane (Cuno, Inc., Meriden, CT). [32P]dCTP-radiolabeled TIMP-3 probe was generated by the "random priming" technique using the Rediprime kit (Amersham, Arlington Heights, IL) as described previously (6)
.
Mapping of Methylated Cytosines.
Ten µg of genomic DNA were digested with either the methylation-sensitive HpaII restriction enzyme or the methylation-insensitive isoschizomer MspI. Cleavage of purified DNA by HpaII at individual sites was determined by PCR analysis as follows. Five µl of digested (or control) DNA was incubated with 250 ng of each amplification primer, 5 µl of magnesium-free 10x PCR buffer (Boehringer Mannheim), 5 µl of 25 mM MgCl2, 1 µl of 10 mM each deoxynucleotide triphosphates, 5% (v/v) DMSO, and 2.5 units of Taq polymerase (Roche) in a total volume of 50 µl. Samples were cycled in a thermal cycler using a program of 30 cycles (94°C for 30 s, 55°C for 30 s, then 72°C for 60 s), ending with a final 10-min extension at 72°C. Twenty-five µl of each amplification reaction were loaded on an 8% nondenaturing polyacrylamide gel including appropriate molecular weight markers, electrophoresed, stained with ethidium bromide, and photographed. Completion of digestion at a given site was determined by lack of PCR amplification of the MspI-digested samples, and methylation was assessed by comparing the PCR product from HpaII-digested samples to undigested controls. In this assay, fully methylated samples are undigestable and are thus amplified across the HpaII site. They therefore give a diagnostic PCR product. Samples containing some methylated and some unmethylated molecules leave some molecules intact at the site, and in a semiquantitative assay such as this, show a reduced amount of PCR product compared with the undigested control.
 |
Acknowledgments
|
|---|
Dr. Moshe Szyf kindly provided the antisense methyl transferase expression construct p2
Met used in this work. We thank Shuning Zhan for cell culture, Tamara J. Brenner for methyl acceptor assays, and our colleagues in the Laboratory of Biochemical Physiology for constructive suggestions.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Present address: Zeneca Central Toxicology Laboratory, Alderley Park, Macclesfield, Cheshire SK10 4TJ, United Kingdom. 
2 To whom requests for reprints should be addressed, at National Cancer Institute, Laboratory of Biochemical Physiology, P.O. Box B, Building 560, Room 21-89, Frederick, MD 21702-1201. 
3 The abbreviations used are: TIMP-3, tissue inhibitor of metalloproteinases-3; 5AzaC, 5-azacytidine; TPA, 12-O-tetradecanoylphorbol-13-acetate; RT-PCR, reverse transcription-PCR. 
Received for publication 11/25/98.
Revision received 3/ 6/99.
Accepted for publication 3/ 6/99.
 |
References
|
|---|
-
Colburn N. H., Wendel E., Abruzzo G. Dissociation of mitogenesis and late-stage promotion of tumor cell phenotype by phorbol esters: mitogen resistant variants are sensitive to promotion. Proc. Natl. Acad. Sci. USA, 78: 6912-6916, 1981.[Abstract/Free Full Text]
-
Liang P., Pardee A. B. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science (Washington DC), 257: 967-971, 1992.[Abstract/Free Full Text]
-
Pavloff N., Staskus P.W., Kishnani N. S., Hawkes S. P. A new inhibitor of metalloproteinases from chicken: ChTIMP-3 a third member of the TIMP family. J. Biol. Chem., 267: 17321-17326, 1992.[Abstract/Free Full Text]
-
Leco K. J., Khokha R., Pavloff N., Hawkes S. P., Edwards D. R. Tissue inhibitor of metalloproteinases-3 (TIMP-3) is an extracellular matrix-associated protein with a distinctive pattern of expression in mouse cells and tissues. J. Biol. Chem., 269: 9352-9360, 1994.[Abstract/Free Full Text]
-
Sun Y., Hegamyer G., Colburn N. H. Molecular cloning of five mRNAs differentially expressed in preneoplastic or neoplastic mouse JB6 epidermal cells: one is homologous to human inhibitor of metalloproteinase-3. Cancer Res., 54: 1139-1144, 1994.[Abstract/Free Full Text]
-
Sun Y., Hegamyer G., Kim H., Sithanandam K., Li H., Watts R., Colburn N. H. Molecular cloning of mouse tissue inhibitor of metalloproteinases-3 (m-TIMP-3) and its promoter: specific lack of expression in neoplastic JB6 cells may reflect altered gene methylation. J. Biol. Chem., 270: 19312-19319, 1995.[Abstract/Free Full Text]
-
Khokha R., Denhardt D. T. Matrix metalloproteinases and tissue inhibitor of metalloproteinases: a review of their role in tumorigenesis and tissue invasion. Invasion Metastasis, 9: 391-405, 1989.[Medline]
-
Denhardt D. T., Feng B., Edwards D. R., Cocuzzi E. T., Malyankar U. M. Tissue inhibitor of metalloproteinases (TIMP, aka EPA): structure, control of expression and biological functions.. Pharmacol. Ther., 59: 329-341, 1993.[Medline]
-
Khokha R., Waterhouse P., Yagel S., Lala P., Overall C., Norton G., Denhardt D. T. Antisense RNA-induced reduction in murine TIMP levels confers oncogenicity on Swiss 3T3 cells. Science (Washington DC), 244: 947-950, 1989.
-
Montgomery A. M. P., Mueller B. M., Reisfeld R. A., Taylor S. M., DeClerck Y. A. Effect of tissue inhibitor of the matrix metalloproteinases-2 expression on the growth and spontaneous metastasis of a human melanoma cell line. Cancer Res., 54: 5467-5473, 1994.[Abstract/Free Full Text]
-
Witty J. P., MacDonnell S., Newell K., Cannon P., Navre M., Tressler R., Matrisian L. M. Modulation of matrilysin levels in colon carcinoma cell lines affects. Cancer Res., 54: 4805-4812, 1994.[Abstract/Free Full Text]
-
Birkedal-Hansen H., Moore W. G. I., Bodden M. K., Windsor L. J., Birkedal-Hansen B., DeCarlo A., Engler J. A. Matix metalloproteinases: a review. Crit. Rev. Oral Biol. Med., 4: 197-250, 1992.[Abstract/Free Full Text]
-
Sun Y., Kim H., Parker M., Stetler-Stevenson W. G., Colburn N. H. Lack of suppression of tumor cell phenotype by overexpression of TIMP-3 in mouse JB6 tumor cells: identification of a transfectant with increased tumorigenicity and invasiveness. Anticancer Res., 16: 1-8, 1996.[Medline]
-
Bian J., Wang Y., Smith M. R., Kim H., Jacobs C., Jackman J., Kung H-F., Colburn N. H., Sun Y. Suppression of in vivo tumor growth and induction of suspension cell death by tissue inhibitor of metalloproteinase (TIMP)-3. Carcinogenesis (Lond.), 17: 1805-1811, 1996.[Abstract/Free Full Text]
-
Kim H., Pennie W. D., Sun Y., Colburn N. H. Differential functional significance of AP-1 binding sites in the promoter of the gene encoding mouse tissue inhibitor of metalloproteinases-3. Biochem. J., 324: 547-553, 1997.
-
Bian J., Jacobs C., Wang Y., Sun Y. Characterization of a putative p53 binding site in the promoter of the mouse tissue inhibitor of metalloproteinases-3 (TIMP-3) gene: TIMP-3 is not a p53 target gene. Carcinogenesis (Lond.), 17: 2259-2562, 1996.[Abstract/Free Full Text]
-
Edwards D. R., Rocheleau H., Sharma R. R., Wills A. J., Cowie A., Hassell J. A., Heath J. K. Involvement of AP-1 and PEA3 binding sites in the regulation of murine tissue inhibitor of metalloproteinases-1. Biochem. Biophys. Acta, 1171: 41-55, 1992.[Medline]
-
Hammani K., Blakis A., Morsette D., Bowcock A. M., Schmutt C., Henriet P., DeClerck Y. A. Structure and characterization of the human tissue inhibitor of metalloproteinases-2 gene. J. Biol. Chem., 271: 25498-25505, 1996.[Abstract/Free Full Text]
-
Wick M., Haronen R., Mumberg D., Burger C., Olsen B. R., Budarf M. L., Apte S. S., Muller R. Structure of the human TIMP-3 gene and its cell cycle-regulated promoter. Biochem. J., 311: 549-554, 1995.
-
Bender C. M., Zingg J. M., Jones P. A. DNA methylation as a target for drug design. Pharm. Res., 15: 175-187, 1998.[Medline]
-
Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
-
Li J-J., Dong Z., Dawson M. I., Colburn N. H. Inhibition of tumor promoter-induced transformation by retinoids that transrepress AP-1 without transactivating retinoic acid response element. Cancer Res., 56: 483-489, 1996.[Abstract/Free Full Text]
-
Gonzalez-Zulueta M., Bender C. M., Yang A. S., Nguyen T., Beart R. W., Van Tornout J. M., Jones P. A. Methylation of the 5' CpG island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing. Cancer Res., 55: 4531-4535, 1995.[Abstract/Free Full Text]
-
Herman J. G., Merlo A., Mao L., Lapidus R. G., Issa J-P. J., Davidson N. E., Sidransky D., Baylin S. B. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res., 55: 4525-4530, 1995.[Abstract/Free Full Text]
-
Costello J. F., Berger M. S., Huang H-J. S., Cavenee W. K. Silencing of p16/CDKN2 expression in human gliomas by methylation and chromatin condensation. Cancer Res., 56: 2405-2410, 1996.[Abstract/Free Full Text]
-
Herman J. G., Latif F., Weng Y., Lerman M. I., Zbar B., Liu S., Samid D., Duan D-S. R., Gnarra J. R., Linehan W. M., Baylin S. B. Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc. Natl. Acad. Sci. USA, 91: 9700-9704, 1994.[Abstract/Free Full Text]
-
Yoshiura K., Kenai Y., Ochiai A., Shimoyama Y., Sugimura T., Hirohashi S. Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in human carcinomas. Proc. Natl. Acad. Sci. USA, 92: 7416-7419, 1995.[Abstract/Free Full Text]
-
Feil R., Charlton J., Bird A. P., Walter J., Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res., 22: 695-696, 1994.[Free Full Text]
-
Short M. L., Nickel J., Schmitz A., Renkawitz R. In vivo protein interaction with the mouse M-lysozyme gene downstream enhancer correlates with demethylation and gene expression. Cell Growth Differ., 7: 1545-1550, 1996.[Abstract]
-
Yokomori N., Kobayashi R., Moore R., Sueyoshi T., Negishi M. A demethylation site in the male specific P450 (Cyp 2d-9) promoter and binding of the heteromeric transcription factor GABP. Mol. Cell. Biol., 15: 5355-5362, 1995.[Abstract]
-
Boyes J., Bird A. Repression of genes by DNA methylation depends on CpG density and promoter strength: evidence for involvement of a methyl-CpG binding protein. EMBO J., 11: 327-333, 1992.[Medline]
-
Rountree M. R., Selker E. U. DNA methylation inhibits elongation but not initiation of transcription in Neurospora crassa. Genes Dev., 11: 2383-2395, 1998.[Abstract/Free Full Text]
-
Felsenfeld G. Chromatin: an essential part of the transcription apparatus. Nature (Lond.), 355: 219-224, 1992.[Medline]
-
Tsukiyama T., Becker P. B., Wu C. ATP-dependent nucleosome disruption at a heat-shock promoter mediated by binding of FAFA transcription factor. Nature (Lond.), 367: 525-532, 1994.[Medline]
-
Archer T. K., Lefebvre P., Wolford R. G., Hager G. L. Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation. Science (Washington DC), 255: 1573-1576, 1992.[Abstract/Free Full Text]
-
Keshet I., Lieman-Hurwitz J., Cedar H. DNA methylation affects the formation of active chromatin. Cell, 44: 535-543, 1986.[Medline]
-
Buschausen G., Wittig B., Graessmann M., Graessmann A. Chromatin structure is required to block transcription of the methylated herpes simplex virus thymidine kinse gene. Proc. Natl. Acad. Sci. USA, 84: 1177-1181, 1987.[Abstract/Free Full Text]
-
Dong Z., Birrer M. J., Watts R. G., Matrisian L. M., Colburn N. H. Blocking of tumor promoter-induced AP-1 activity inhibits induced transformation in JB6 mouse epidermal cells. Proc. Natl. Acad. Sci. USA, 91: 609-613, 1994.[Abstract/Free Full Text]
-
Szyf M., Rouleau J., Theberge J., Bozovic V. Induction of myogenic differentiation by an expression vector encoding the DNA methyltransferase cDNA sequence in an antisense orientation. J. Biol. Chem., 267: 12831-12836, 1992.[Abstract/Free Full Text]
-
MacLeod A. R., Szyf M. Expression of antisense to DNA methyltransferase mRNA induces DNA demethylation and inhibits tumorigenesis. J. Biol. Chem., 270: 8037-8043, 1995.[Abstract/Free Full Text]
-
Bestor T., Laudano A., Mattaliano R., Ingram V. Cloning and sequencing of a cDNA encoding DNA methyltransferase of mouse cells. J. Mol. Biol., 203: 971-983, 1988.[Medline]
-
Alonso S., Minty A., Bourlet Y., Buckingham M. Comparison of three actin-coding sequences in the mouse: evolutionary relationships between the actin genes of warm blooded vertebrates. J. Mol. Evol., 23: 11-22, 1986.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
J. Ng, M. T. Coroneo, D. Wakefield, and N. Di Girolamo
Ultraviolet Radiation and the Role of Matrix Metalloproteinases in the Pathogenesis of Ocular Surface Squamous Neoplasia
Invest. Ophthalmol. Vis. Sci.,
December 1, 2008;
49(12):
5295 - 5306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhe, Y. Yang, S. Jakkaraju, and L. Schuger
Tissue Inhibitor of Metalloproteinase-3 Downregulation in Lymphangioleiomyomatosis: Potential Consequence of Abnormal Serum Response Factor Expression
Am. J. Respir. Cell Mol. Biol.,
April 1, 2003;
28(4):
504 - 511.
[Abstract]
[Full Text]
[PDF]
|
 |
|