CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Percario, Z. A.
Right arrow Articles by Romeo, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Percario, Z. A.
Right arrow Articles by Romeo, G.
Cell Growth & Differentiation Vol. 10, 263-270, April 1999
© 1999 American Association for Cancer Research

Retinoic Acid Is Able to Induce Interferon Regulatory Factor 1 in Squamous Carcinoma Cells via a STAT-1 Independent Signalling Pathway1

Zulema A. Percario, Valeria Giandomenico, Gianna Fiorucci, Maria V. Chiantore, Serena Vannucchi, John Hiscott, Elisabetta Affabris and Giovanna Romeo2

Laboratory of Virology, Istituto Superiore di Sanità [G. F., M. V. C., S. V., E. A., G. R.], and Istituto Tecnologie Biomediche [G. F., M. V. C., G. R.], Consiglio Nazionale delle Ricerche, 00161 Rome, Italy; Department of Biology, University of Rome 3, 00146 Rome, Italy [Z. A. P., V. G., E. A.]; and Lady Davis Institute, McGill University, Molecular Oncology Group, Montreal H3T 1E2, Canada [J. H.]


   Abstract
TOP
 Abstract
Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Interferon regulatory factor 1 (IRF-1) transcription factor binds to DNA sequence elements found in the promoters of type I IFN and IFN-inducible genes. Transient up-regulation of the IRF-1 gene by virus and IFN treatment causes the consequent induction of many IFN-inducible genes involved in cell growth control and apoptosis. We reported recently that IFN-{alpha} and all-trans retinoic Acid (RA) inhibit the cell proliferation of squamous carcinoma cell line ME-180 by inducing apoptotic cell death. IRF-1 expression correlates with the IFN-{alpha}-induced apoptosis phenomenon and, surprisingly, with the RA-induced apoptosis phenomenon. To study how these two different ligands cross-talk in the regulation of cellular antitumor responses, the signalling pathways involved in IRF-1 induction were analyzed in RA and/or IFN-{alpha}-treated ME-180 cells. We provide evidence indicating that RA-induced IRF-1 gene expression is independent of the STAT-1 activation pathway, despite the presence of the IFN-{gamma} activated sequence element in the gene promoter, but involves nuclear factor-{kappa}B activation. Thus, here we first describe the activation of nuclear factor-{kappa}B by both IFN-{alpha} and RA in the ME-180 cell line. The induced IRF-1 protein is successively able to bind the IFN-stimulated responsive element in the promoter of the target gene 2',5'-oligoadenylate synthetase.


   Introduction
TOP
 Abstract
 Introduction
Results
 Discussion
 Materials and Methods
 References
 
IRF-13 was originally identified as a transcription factor that binds to DNA sequence elements (IRF-Es) found in the promoters of type I IFN and IFN-inducible genes (1, 2, 3) . The IRF-1 gene is virus and IFN inducible (4) and is also induced by other cytokines such as tumor necrosis factor-{alpha}, IL-1, IL-6, leukemia inhibitory factor, and prolactin (5, 6, 7, 8, 9) . These stimuli cause the transient up-regulation of the IRF-1 gene and consequent induction of many IFN-inducible genes. Several putative binding sites for known transcription factors were found within the IRF-1-promoter including one IFN-{gamma}-activated sequence (GAS; Ref. 10 ) and one NF-{kappa}B site (10 , 11) .

Presently, one of the best-understood systems of signal transduction is the activation of the so-called STAT proteins by IFN-{alpha} and IFN-{gamma}, as well as by other growth factors and cytokines (3 , 11 , 12) . These different stimuli induce tyrosine phosphorylation and the consequent activation of different combinations of STAT and STAT-associated proteins in a process mediated by the Janus activated kinase family of protein tyrosine kinases. The STAT-containing protein complexes then participate directly in the induction of gene transcription by relocalizing to the nucleus and binding to the promoters of their cognate target genes. Thus, the IFN-{alpha}/ß-inducible genes are mainly activated by the phosphorylated complex ISGF-3 consisting of STAT proteins [namely STAT-1{alpha} (p91) or STAT-1ß (p84) and STAT-2 (p113)] and the associated DNA-binding protein p48. ISGF-3 is able to bind ISRE. In contrast, IFN-{gamma}-inducible genes are activated by a phosphorylated complex, called IFN-{gamma}-activated factor, which consists of dimerized STAT-1{alpha} (3 , 12 , 13) able to bind the GAS element. The STAT-1{alpha} homodimer (IFN-{gamma}-activated factor) is also formed at lower efficiency during IFN-{alpha} signaling and also contributes to IFN-{alpha} signaling. Thus these two complexes, ISGF-3 and GAF, are integral components of the system by which IFN stimulation received at the cell surface is translated into changes in gene transcription in the nucleus. Although ISGF-3 and GAF are responsible for the initial transmission of the IFN signal to the nucleus, the proper regulation of the broad range of genes induced by the interferons involves other transcription factors such as IRF-1. IRF-1s bind DNA sequence elements, designated IRF-E (3 , 4) and also share homology in their DNA-binding regions with p48, the DNA-binding component of ISGF-3 mentioned earlier (14) . This homology is functionally significant, because IRF-1 and ISGF-3 have been shown to bind to overlapping sequences in the promoters of many IFN-{alpha}/ß-inducible genes (3) .

In addition to regulating the IFN system, IRF-1 manifests tumor-suppressive activities (15 , 16) , and its inactivation may be linked to the development of human hematopoietic malignancies (17 , 18) . IRF-1 is also required for the induction of apoptosis after DNA damage or culture in low serum in fibroblasts carrying an activated c-Ha-ras gene (16) . DNA damage-induced apoptosis is dependent on IRF-1, and two different antioncogenic transcription factors, p53 and IRF-1, are required for apoptotic pathways in T lymphocytes (19 , 20) . Recently, it has been shown that IRF1-/- mouse embryonic fibroblasts are deficient in their ability to undergo DNA damage-induced cell cycle arrest (21) mediated by transcriptional induction of the gene encoding p21 (Waf1, CIP1), a cell cycle inhibitor dependent on both p53 and IRF-1.

We reported recently (22) that IFN-{alpha} and RA inhibit cell proliferation of SCC lines by inducing apoptotic cell death. IRF-1 expression correlates with the IFN-{alpha}-induced apoptosis phenomenon and, surprisingly, with the RA-induced apoptosis phenomenon (22) .

RA is a natural metabolite, prototype of retinoids, a group of vitamin A-related compounds with profound influences on cell growth and differentiation (23) . It affects gene expression by binding RAR and retinoid X receptor, its specific nuclear receptors, both ligand-activated transcription factors belonging to the superfamily of nuclear receptors (24) .

Both IFNs and RA have been shown to suppress the growth of certain tumor cells, and a combination of these agents produces significant additive or synergistic antitumor activity as well as an enhanced transcriptional induction of some IFN-stimulated genes (25, 26, 27, 28) . To study how these two different ligands cross-talk in the regulation of cellular antitumor responses, we have analyzed the signaling pathways involved in the induction of IRF-1 observed in the ME-180 squamous carcinoma cell line treated with RA, comparing the results with IFN-{alpha} induction. Here we provide evidence indicating that RA-induced IRF-1 gene expression is independent of the STAT-1 activation pathway, despite the presence of the GAS element in the gene promoter, but involves NF-{kappa}B activation. The induced IRF-1 protein is successively able to bind the ISRE sequence in the promoter of the target gene 2',5'-oligoadenylate (2-5A) synthetase.


   Results
TOP
 Abstract
 Introduction
 Results
Discussion
 Materials and Methods
 References
 
RA Induces IRF-1 Gene Expression.
The kinetic of induction of IRF-1 mRNA analyzed by RNase protection assay and reported previously (22 , 27) indicates a peak at 3 h of RA treatment and a significant level persisting up to 24–48 h. To evaluate whether RA treatment could influence IRF-1 mRNA stability, we carried out reverse transcription-PCR analysis on RNA samples extracted from ME-180 cells treated with IFN-{alpha}2b and RA in the presence or absence of actinomycin D. As expected (Fig. 1A)Citation , IRF-1 mRNA accumulated at a comparable level when ME-180 cells were treated with both IFN and RA. The IRF-1 mRNA decay was determined during the 1-, 3-, and 5-h treatments (Lanes 6–8; Refs. 12, 13, 14 ). The GAPDH mRNA was used as a control because its stability was not modified by actinomycin D during the time of treatment (Fig. 1A)Citation .



View larger version (42K):
[in this window]
[in a new window]
  		Fig. 1. A, Reverse transcription-PCR analysis of the IRF-1 mRNA expression in ME-180 cells treated or not with 10 µg/ml actinomycin D and/or IFN-{alpha}2b and/or RA for the indicated times. Total RNA was extracted (1 µg), reverse transcribed, and amplified as described in "Materials and Methods." The GAPDH mRNA expression was used as a control because its stability was not modified by actinomycin D during the time of treatment. B, analyses of IRF-1 expression in ME-180 cells. ME-180 cells were treated with 10-6 M RA and 2000 UI/ml IFN-{alpha}2b for different times. Total ME-180 cellular proteins were electrophoresed on 10% acrylamide gel, and immunoblot analysis was performed using anti-human IRF-1 polyclonal antibody (Santa Cruz Biotechnology) as described in "Materials and Methods."

 
The IFN and RA induction of IRF-1 mRNA level was abolished after 3–5 h of IFN/actinomycin treatment as well as after RA/actinomycin treatment. This shows also in the case of RA as a transcriptional induction of the IRF-1 gene, responsible for the observed protein accumulation and excluding a reduced degradation rate of the corresponding mRNA. In addition, transient transfection experiments were carried out on 293 cells by using the pIRF-1 promoter-luc construct together with the RSV-lacZ construct as an internal control. Transfected cells were treated for 48 h with RA (10-5 M), IFN-ß (50 units/ml), and RA + IFN-ß. Fig. 2ACitation shows that IFN-ß causes a 2.0-fold induction of this construct; RA causes a 2.4-fold induction. The RA + IFN combination treatment led to a higher augmentation of reporter activity, up to 4.3-fold induction. Similar results have been obtained on HepG2 cells (Fig. 2B)Citation . Thus, RA could increase the expression of IFN-regulated genes through direct transcriptional induction of IRF-1.



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 2. Effect of RA and IFN on IRF-1 promoter. 293 (A) and HepG2 (B) (1.5 x 106 cells) cells were seeded on 6-cm dishes and transfected with 5 µg of pIRF-1 luc and 4 µg of RSV-lacZ with calcium-phosphate protocol. Then cells were treated with RA (10-5 M), IFN-ß (50 units/ml), and their combination. ß-Galactosidase and luciferase activity was measured 48 h later as described in "Materials and Methods." Each experiment included duplicate transfections. The data shown are the means of fold inductions, normalized with respect to ß-galactosidase expression.

 
RA Induces IRF-1 Protein Expression.
Both RA and IFN-{alpha} inhibit proliferation of ME-180 cells by inducing a clear apoptosis phenomenon (22) . IRF-1 expression correlates with the IFN-{alpha}- and RA-induced apoptosis (22 , 27 , 29) . The levels of IRF-1 protein were determined in cells treated with 10-6 M RA by Western blot analysis using the IRF-1-specific antibody. Fig. 1BCitation shows the presence of a low constitutive expression of IRF-1 protein in untreated control cells. RA treatment significantly increased this basal level, starting from 5 h. The signal appeared highly enhanced later on (24 h), persisting up to 80 h. An internal control from cells treated for 2 h with 2000 IU/ml IFN-{alpha}2b was also included.

RA Does Not Activate the STAT-1 Pathway.
Because a putative GAS element (30) was identified within the IRF-1 promoter and IRF-1 was induced by both IFN-{alpha} and RA, the STAT-1 activation was analyzed in cell extracts from ME-180 cells treated with RA or IFN-{alpha}2b as indicated. By immunoprecipitation using anti-p91 followed by immunoblotting using anti-phosphotyrosine-specific antibodies (see "Materials and Methods"), STAT-1{alpha} (p91) was phosphorylated by 10 min after IFN-{alpha} treatment (Fig. 3)Citation and remained activated up to 1 h (data not shown). After RA treatment, phosphorylation of STAT-1 was not observed and specifically STAT-1 was not activated during the interval of IRF-1 induction. The anti-phosphotyrosine blots were reanalyzed, after stripping, with anti-STAT-1 antibody. p91 was present at a similar level after all treatment conditions (Fig. 3)Citation . A clear increase in p84 at late times of treatment (16–48 h) was observed.



View larger version (41K):
[in this window]
[in a new window]
  		Fig. 3. Activation of STAT-1 in ME-180 cells. Tyrosine phosphorylation (pTyr) and protein quantitation of STAT-1 protein in ME-180 cells treated with IFN-{alpha}2b (2000 IU/ml) and RA (10-6 M) for the indicated times were examined. Proteins from whole-cell lysates were immunoprecipitated and immunoblotted as described in "Materials and Methods."

 
Next, EMSA experiments were performed using an oligonucleotide representing the GAS element of the IRF-1 promoter and ME-180 whole-cell extracts to analyze transcription factor binding to this region at different times after IFN-{alpha} and RA treatment. After IFN-{alpha}2b treatment, a GAF/GAS complex appeared at 10 min and was maintained up to 2 h (Fig. 4)Citation . The specificity of complex formation was confirmed by a competition experiment performed in the presence of 200-fold molar excess of the oligonucleotide (see Fig. 4Citation ); anti-STAT-1 treatment supershifted the observed complex (data not shown). No GAF/GAS complex was observed in cell extracts treated with RA, in agreement with negative results of phosphorylation activation of the GAF component STAT-1.



View larger version (36K):
[in this window]
[in a new window]
  		Fig. 4. EMSA on ME-180 cells treated with IFN-{alpha}2b (2000 IU/ml) and RA (10-6 M) for the indicated times. Assays on whole-cell extracts incubated with labeled oligonucleotide representing the GAS element found in the IRF-1 promoter were performed as described in "Materials and Methods."

 
RA Activates NF-{kappa}B.
The IRF-1 promoter also contains binding sequences for the NF-{kappa}B transcription factor (10 , 11) which, like IRFs, regulates cell growth-controlled gene expression. To determine whether RA-induced IRF-1 gene activation may be mediated by NF-{kappa}B binding to its target sequence in the promoter of the IRF-1 gene, gel shift assays were performed using an oligonucleotide representing the NF-{kappa}B binding site in the IRF-1 promoter and ME-180 whole-cell extracts treated with RA and IFN-{alpha}. In the extracts of both IFN-{alpha} and RA-treated ME-180 cells, two specific inducible complexes were detected (Fig. 5a)Citation . Supershift of the major complex was observed in RA and IFN-{alpha}2b cell extracts by treatment with NF-{kappa}B p50 antibody (Fig. 5bCitation , Lanes 4 and 8), whereas the upper complex was abolished by treatment with NF-{kappa}B p65 antibody (Lanes 3 and 7). These results indicate that IFN-{alpha} activates NF-{kappa}B binding to its target sequence in the promoter of the IRF-1 gene, thus resulting in the observed high inducibility of the gene. RA induction of IRF-1 gene expression could be mediated at least in part by NF-{kappa}B.



View larger version (54K):
[in this window]
[in a new window]
  		Fig. 5. EMSA on ME-180 cells treated with IFN-{alpha}2b (2000 IU/ml) and RA (10-6 M) for the indicated times. A), assays on whole-cell extracts, incubated with labeled oligonucleotide representing the NF-{kappa}B binding site found in the IRF-1 promoter, were performed as described in "Materials and Methods." B), assays on whole-cell extracts, incubated with labeled oligonucleotide representing the NF-{kappa}B binding site found in the IRF-1 promoter, were performed as described in "Materials and Methods." Preincubations with specific anti NF-{kappa}B p65 or p50 antibodies were performed to demonstrate the presence of these subunits in the observed complexes (see "Materials and Methods").

 
RA-induced IRF-1 Binds ISRE Sequence.
To test whether the induced IRF-1 was functional in activating IFN-inducible genes involved in regulating cell growth, gel shift assays were performed using an ISRE fragment from 2-5A synthetase promoter as a probe. As shown in Fig. 6aCitation , RA treatment induced a specific protein-DNA complex from 6 to 48 h. The same complex was induced by IFN-{alpha} at 5 h after treatment and was efficiently competed by a 200-fold molar excess of cold hE-IRS oligonucleotide. When the extracts were preincubated with anti-IRF-1 antibodies, the ISRE complex was abolished (Fig. 6bCitation , Lanes 4 and 10), thus indicating the presence of the induced IRF-1 in the RA- and IFN-induced complex.



View larger version (50K):
[in this window]
[in a new window]
  		Fig. 6. EMSA on ME-180 cells treated with IFN-{alpha}2b (2000 IU/ml) and RA (10-6 M) for the indicated times. A), an assay on whole-cell extracts, incubated with labeled oligonucleotide representing ISRE fragment of 2-5A synthetase gene promoter, was performed as described in "Materials and Methods." B), assay on whole-cell extracts, incubated with labeled oligonucleotide representing ISRE fragment of 2-5A synthetase gene promoter, was performed as described in "Materials and Methods." Preincubations with the indicated specific antibodies were performed to demonstrate the presence of these proteins in the observed complexes (see "Materials and Methods").

 
Pretreatment of cell extract with both anti-p48 and anti-p91 antibodies as well as anti-STAT-2 failed to affect the complex formation (Fig. 6bCitation , Lanes 5–7 and 11–13), indicating the absence of STATs in the observed complex. On the other hand, a specific RA induction of the p48 protein belonging to the IRF family is observed in our system (Fig. 7)Citation .



View larger version (44K):
[in this window]
[in a new window]
  		Fig. 7. p48 immunoblot analysis. The assay was performed on ME-180 total cellular proteins electrophoresed on 10% acrylamide gel by using anti-human p48 polyclonal antibody (United Biomedical, Inc.) as described in "Materials and Methods."

 

   Discussion
TOP
 Abstract
 Introduction
 Results
 Discussion
Materials and Methods
 References
 
We reported earlier (27) that RA as well as IFN-{alpha}2b inhibit proliferation of ME-180 cells in a dose- and time-dependent manner. A markedly increased growth-inhibitory effect was observed when a combination treatment was carried out. ME-180 cells underwent massive apoptotic cell death after treatment with either RA or with IFN, both agents being capable of inducing a significant level of programmed cell death (22) . The phenomenon was much more extensive when the two drugs were given together.

Increased expression of the IRF-1, which manifests tumor-suppressive (19) , apoptosis-inducing, and cell cycle arrest activities in different cell types (22 , 31) , correlated with both RA- and IFN-{alpha}-induced apoptosis. In fact, RA per se activated IRF-1 gene expression in ME-180 cells. In particular, the induction of IRF-1 mRNA by 1 h after RA treatment, with levels increasing at 3 and 5 h and persisting up to 24–48 h (see also Refs. 22 and 27 ) correlates with the kinetics of IRF-1 protein accumulation (Fig. 1B)Citation . In addition, the signal appears strongly enhanced at later times (48 and 80 h). The late high level of IRF-1 protein correlates with the maximum inhibitory effect of cell proliferation and apoptosis observed in ME-180 cells treated with RA.

In addition, SiHa, a cell line derived from squamous cervix carcinoma but resistant to RA-induced inhibition of proliferation and apoptosis, did not show RA-induced IRF-1 gene expression (22) . Nonetheless, SiHa cells increase IRF-1 expression after IFN-{alpha} treatment (22) and respond to IFN-{alpha} growth inhibition and induction of apoptosis. These results strengthen the involvement of IRF-1 in the mechanism of RA and IFN-{alpha} growth inhibition and apoptosis. Expression of IRF-1 may be one of the molecular mechanisms by which IFN and RA cross-talk in the regulation of cellular antitumor responses and form the basis for the synergistic actions of RA and IFNs in SCC.

In support of this idea, the RA-induced growth inhibition of acute promyelocytic leukemia cells correlated with IRF-1 expression (32 , 33) , although RA activation of the STAT pathway remains controversial. Gianni et al. (32) showed activation of the STAT pathway by RA, whereas Matikainen et al. (33) did not. In addition, RA enhancement of IFN growth suppression in a breast tumor cell line has been described (26) via a transcriptional enhancement of IFN-inducible gene expression based on the RA-dependent up-regulation of the level of STAT-1.

The present study sheds light on the signalling pathways involved in the induction of IRF-1 observed in ME-180 cells treated with RA. We have provided evidence that RA does not activate the STAT-1 pathway because no tyrosine phosphorylation of this protein was observed in this condition of treatment, whereas a clear rapid induction of tyrosine phosphorylation of STAT-1 was observed after IFN-{alpha} treatment. Also, no formation of GAF/GAS complex was observed in RA-treated cell extracts, when EMSA experiments using the GAS element of IRF-1 promoter as a probe was performed. This result shows that RA does not activate the STAT-1 signaling pathway in these conditions. As expected, a specific IFN-{alpha}-induced complex was observed. This complex was supershifted by anti-STAT-1 antibody (data not shown). In addition, the RA augmentation of the STAT-1{alpha} level described in breast tumor cells MCF-7 (26) and suggested to control cell growth is not observable in our system (Fig. 3)Citation . The STAT-1{alpha} level in ME-180 squamous carcinoma cells is not affected by RA but is significantly increased by IFN-{alpha} treatment.4

We also observed that NF-{kappa}B transcription factor is involved in the RA induction as well as the IFN-{alpha} induction of IRF-1 gene expression in SCC. It has been reported that NF-{kappa}B-regulated genes encode proteins involved in the rapid response to pathogens or stress, including the acute-phase proteins, cytokines, and cellular adhesion molecules (34) . NF-{kappa}B also plays a critical role in T-cell activation. In activated monocytes and macrophages, genes such as those encoding granulocyte-colony stimulating factor, macrophage-colony stimulating factor and granulocyte/macrophage-colony stimulating factor; the inflammatory cytokines IFN-ß, tumor necrosis factor-{alpha}, IL-1, and IL-6; receptors for tissue factor and IL-2 {alpha}-chain; the chemotactic protein MCP-1/JE and nitric oxide synthase are highly induced as a result of regulatory control by NF-{kappa}B (34, 35, 36) . Once NF-{kappa}B DNA-binding activity is activated, numerous target genes are selectively regulated by the transcriptional activation potential of different homo- and heterodimer combinations. Also, variations in the NF-{kappa}B consensus sequence to which the subunits bind and cooperativity between different transcription factor families and NF-{kappa}B/Rel contribute to the specificity of gene activation (37 , 38) .

In our study, an important finding has been that IRF-1 induction by RA in ME-180 cells probably involves the NF-{kappa}B system by both homo- and heterodimer activation (p50, p50) (p50, p65). The eventual functional interaction between NF-{kappa}B and additional transcription factor activation remains to be seen. In fact, the presence of a putative RAR-binding site in the promoter of the IRF-1 gene has been suggested (33) . In our hands, EMSA experiments performed using the indicated (33) putative RAR-binding site in the IRF-1 promoter as a labeled probe (-455 to -440) showed no specific RA-induced shift complex (data not shown). NF-{kappa}B activation is not observed in the study by Matikainen et al. (33) performed on APL cells, where it was reported that RA induces IRF-1 expression without activating both NF-{kappa}B and STAT pathways, and alternative mechanisms have been suggested. In addition we observed RA induction of IRF-1 promoter, containing both GAS and NF-{kappa}B consensus sites as well as the putative RAR element, linked to a luciferase reported construct in 293 and HepG2 cells.

This result suggests that RA induces the expression of IFN-regulated genes and increases their IFN-controlled expression (see Fig. 2Citation ) via the direct transcriptional induction of IRF-1 (see also Ref. 39 ).

IRF-1 transcription factor is able to recognize DNA sequence elements in the promoter of various genes involved in regulating cell proliferation (3 , 40) . Of interest, we found that the RA-induced IRF-1 binds to the hE-IRS consensus sequence of the 2-5A synthetase promoter containing the ISRE element in a gel mobility shift assay. This observation correlates with the slight induction of the gene expression induced by RA treatment in our system (data not shown).

Because the presence of an IFN-{alpha}-induced STAT-1-p48 complex binding the ISRE with high specificity and capable of activating transcription has been described, and because p48 belongs to the IRF family (41) , we investigated the presence of STAT-1 or p48 in the observed ISRE/IRF1 complex. Pretreatment of cell extract with both anti-p48 and anti-p91 antibodies failed to affect the complex formation (Fig. 6)Citation , indicating the absence of these proteins in the observed complex. On the other hand, RA (as well as IFN-{alpha}) is able to increase the expression level of the p48 (Fig. 7)Citation protein.

In view of the results reported here, the important next step is to analyze in SCC the IRF-1 involvement in the regulation of expression of apoptosis- and cell cycle-related genes that may mediate the induction of apoptosis by RA.


   Materials and Methods
TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
References
 
Cell Culture.
The human epidermoid carcinoma cell line ME-180, isolated from an omental metastasis of a rapidly spreading cervical carcinoma, was maintained in McCoy’s 5a medium supplemented with 10% fetal bovine serum, previously inactivated at 56°C for 20 min. This cell line was obtained from the American Type Culture Collection (Rockville, MD). Cells were grown to {approx}85–90% of confluence in a humidified atmosphere of 5% CO2 at 37°C. RA (Sigma Chemical Co., St. Louis, MO) was added to the medium from a stock solution of 10-2 M in DMSO to a final concentration of 10-6 M or 10-5 M, as described. Cells treated with the same volume of DMSO were used as a control in all the experiments performed. 293 cells were grown in DMEM supplemented with 10% FBS and HepG2 in DMEM-F12 plus 10% fetal bovine serum. Recombinant IFN-{alpha}2b (INTRON A; 2 x 108 IU/mg of protein; Shering Corp., Milan, Italy) was added to the medium from a stock solution of 106 IU/ml. Human recombinant IFN-ß (Rebif; 3 x 108 IU/mg of protein; ARES-SERONO) was added to the medium from a stock solution of 104 IU/ml to the final concentration.

Western Blot and Immunoprecipitation Analyses.
Whole-cell lysates were prepared in lysis buffer [0.5% NP40, 1% Triton X-100, 50 mM Tris-HCl (pH 7.4), 1 mM EDTA, 1 mM EGTA, 150 mM NaCl, 0.25% sodium deoxycholate, 0.5 mM phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin, 20 mM NaF, and 1 mM sodium orthovanadate were freshly added to the buffer before each use], electrophoresed on a 7 or 10% SDS-polyacrylamide gel as indicated, and transferred to nitrocellulose for 60 min at 100V with a Bio-Rad transblot. Western blot detection was performed with the indicated antibodies and developed with reagents for ECL (Amersham). Protein concentration was determined by the Bio-Rad Protein Assay. p91 tyrosine phosphorylation was analyzed on proteins from whole-cell lysates immunoprecipitated with specific anti-p91 antibody, electrophoresed on 7% SDS-polyacrylamide gel, and blotted with 4G10 (UBI) and PY20 (ICN) mixed monoclonal antiphosphotyrosine antibodies. All other antibodies were from Santa Cruz Biotechnology.

RT-PCR Analysis of IRF-1 mRNA.
Total cellular RNA prepared (42) from ME-180 cells treated or not with 10 µg/ml of actinomycin D (Sigma) and/or IFN-{alpha}2b (2000 IU/ml) and/or RA (10-6 M) for the indicated times was reverse transcribed and subsequently amplified. The cycler program consisted of an initial denaturation of 3 min at 95°C, followed by 30 cycles of denaturation for 40 s at 94°C, primer annealing for 40 s at 62°C, and extension for 1 min at 72°C. A negative control-lacking template RNA or reverse transcriptase was included in each experiment. The PCR products were run on 3% agarose gel. The sequences for the GAPDH primers were: sense, CCATGGAGAAGGCTGGGG; and antisense, CAAAGTTGTCATGGATGACC. The sequences for the IRF-1 primers were: sense, CCAGAGAAAAGAAAGAAAGTCG; and antisense, CACATGGCGACAGTGCTGG.

Oligonucleotides.
For gel shift competitions and experiments, the following double-stranded oligonucleotides were used (the top strand is shown. Consensus sequence is underlined.): GAS element, 5'-GATCGATTTCCCCGAAAT-3' (43) ; hE-IRS, 5'-CTCCTCCCTTCTGAGGAAACGAAACCAACAGCAGTCCAAG-3' (44) ; and NF-{kappa}B motif, GGGCCGGCCAGGGCTGGGGAATCCCGCTAAGTGTTTGGAT (30) .

DNA Electrophoretic Mobility Shift Assay (EMSA).
To measure the association between DNA-binding proteins and different DNA sequences, the double-stranded oligonucleotides (10 pmol) described above were end-labeled with [{gamma}-32P]ATP (30 µCi; 6000 Ci/mmol NEN) by T4 polynucleotide kinase (Biolabs). The labeled oligonucleotide probes (10,000–20,000 cpm) were incubated for 30 min at 4°C and 20 min at room temperature in a final volume of 20 µl containing 20 µg of cell extract proteins [in 20 mM HEPES (pH 7.9), 50 mM NaCl, 10 mM EDTA, 2 mM EGTA, 0.5% NP40, 0.5 mM DTT, 10 mM sodium molybdate, 100 mM NaF, 10 µg/ml leupeptin, and 0.5 mM phenylmethylsulfonyl fluoride] in a binding buffer containing 75 mM KCl, 20 mM Tris-HCl (pH 7.5), 13% (v/v) glycerol, 1 mM DTT, 1 µg of bovine serum albumin, and 2 µg of poly(dI)-poly(dC) (Pharmacia). Cold competitors were added in 200-fold molar excess of the radiolabeled probe. For antibody treatments, 1–2 µg of specific antibody were added to 20 µg of cell extract proteins. The analysis of DNA-protein complexes (45) was carried out on 5% polyacrylamide gels in 25 mM Tris-borate (pH 8.2), 0.5 mM EDTA.

Transient Transfection Assay.
293 and HepG2 cells (1.5 x 106 cells/6-cm dish) were seeded and transfected with 5 µg of pIRF-1 Iuc and 4 µg of RSV-LacZ using the calcium-phosphate method. The 1.3-kb IRF-1 promoter fragment subcloned in promoterless luciferase reporter gene vector was described previously (11) . RSV-lacZ construct was obtained from A. Levi (Consiglio Nazionale delle Ricerche, Rome, Italy). The transfected cells were treated as described in the Fig. 2Citation legend. Cells were harvested 48 h later. Relative luciferase activity (Promega luciferase assay system) was measured with a luminometer and normalized by ß-galactosidase activity.


   Acknowledgments
 
We are grateful to Francesca Lancillotti for her contribution to the "Discussion" of this work. We thank Roberto Orsatti and Stefania Mochi for technical assistance, Roberto Gilardi for preparing drawings, and Sabrina Tocchio for editorial assistance.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Grants from the Consiglio Nazionale delle Ricerche (97.03974.CT04), MURST 40%, and Medical Research Council supported this work. M. V. C. was supported by a fellowship from Fondazione Italiana per La Ricerca sul Cancro (FIRC). Back

2 To whom requests for reprints should be addressed, at Laboratory of Virology, Istituto Superiore di Sanità, Viale Regina Elena, 299, 00161 Rome, Italy. Phone: (39 06) 49903231; Fax: (39 06) 49902082; E-mail: romeo{at}vpersis.net.iss.it Back

3 The abbreviations used are: IRF-1, IFN regulatory factor 1; ISGF, IFN-stimulated gene factor; ISRE, IFN-stimulated response element; RA, all-trans-retinoic acid; SCC, squamous cell carcinoma; 2-5A, 2',5'-oligoadenylate; RAR, RA receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; STAT, signal transducer and activator of transcription; GAS, IFN-{gamma}-activated sequence; GAF, IFN-{gamma}-activated factor; NF-{kappa}b, Nuclear factor-kappa B; IL, interleukin; EMSA, electrophoretic mobility shift assay. Back

4 Unpublished results. Back

Received for publication 8/11/98. Revision received 12/29/98. Accepted for publication 2/ 8/99.


   References
TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Harada H., Willison K., Sakakibara J., Miyamoto M., Fujita T., Taniguchi T. Absence of the type I IFN system in EC cells: transcriptional activator (IRF-1) and repressor (IRF-2) genes are developmentally regulated. Cell, 63: 303-312, 1990.[Medline]
  2. Miyamoto M., Fujita T., Kimura Y., Maruyama M., Harada H., Sudo Y., Miyata T., Taniguchi T. Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN-ß gene regulatory elements. Cell, 54: 903-913, 1988.[Medline]
  3. Tanaka N., Kawakami T., Taniguchi T. Recognition DNA sequences of interferon regulatory factor 1 (IRF-1) and IRF-2, regulators of cell growth and the interferon system. Mol. Cell. Biol., 13: 4531-4538, 1993.[Abstract/Free Full Text]
  4. Harada H., Fujita T., Miyamoto M., Kimura Y., Maruyama M., Furia A., Miyata T., Taniguchi T. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell, 58: 729-739, 1989.[Medline]
  5. Abdollahi A., Lord K. A., Hoffman-Liebermann B., Liebermann D. Interferon regulatory factor 1 is a myeloid differentiation primary response gene induced by interleukin 6 and leukemia inhibitory factor: role in growth inhibition. Cell Growth Differ., 2: 401-407, 1991.[Abstract]
  6. Fujita T., Reis L. F. L., Watanabe N., Kimura Y., Taniguchi T., Vilcek J. Induction of the transcription factor IRF-1 and interferon ß mRNAs by cytokines and activators of second-messenger pathways. Proc. Natl. Acad. Sci. USA, 86: 9936-9940, 1989.[Abstract/Free Full Text]
  7. Pine R., Decker T., Kessler D. S., Levy D. E., Darnell J. E. Purification and cloning of interferon-stimulated gene factor 2 (ISGF2): ISGF2 (IRF-1) can bind to the promoters of both ß interferon- and interferon-stimulated genes but is not a primary transcriptional activator of either. Mol. Cell. Biol., 10: 2448-2457, 1990.[Abstract/Free Full Text]
  8. Willman C. L., Sever C. E., Pallavicini M. G., Harada H., Tanaka N., Slovak M. L., Yamamoto H., Harada K., Meeker T. C., List A. F., et al Deletion of IRF-1, mapping to chromosome 5q31.1, in human leukemia and preleukemic myelodysplasia. Science (Washington DC), 259: 968-971, 1993.[Abstract]
  9. Yu-Lee L-Y., Hrachovy J. A., Stevens A. M., Schwarz L. A. Interferon-regulatory factor 1 is an immediate-early gene under transcriptional regulation by prolactin in Nb2 T cells. Mol. Cell. Biol., 10: 3087-3094, 1990.[Abstract/Free Full Text]
  10. Kanno Y., Kozak C. A., Schindler C., Driggers P. H., Ennist D. L., Gleason S. L., Darnell J. J. E., Ozato K. The genomic structure of the murine ICSBP gene reveals the presence of the gamma interferon-responsive element, to which an ISGF3 {alpha} subunit (or similar) molecule binds. Mol. Cell. Biol., 13: 3951-3963, 1993.[Abstract/Free Full Text]
  11. Sims S. H., Cha Y., Romine M. F., Gao P-Q., Gottlieb K., Deisseroth A. B. A novel interferon-inducible domain: structural and functional analysis of the human interferon regulatory factor 1 gene promoter. Mol. Cell. Biol., 13: 690-702, 1993.[Abstract/Free Full Text]
  12. Ihle J. N. STATs: signal transducers and activators of transcription. Cell, 84: 331-334, 1996.[Medline]
  13. Darnell J. E., Kerr I., Stark G. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science (Washington DC), 264: 1415-1421, 1994.[Abstract/Free Full Text]
  14. Taniguchi T. Cytokine signaling through nonreceptor protein tyrosine kinases. Science (Washington DC), 268: 251-255, 1995.[Abstract/Free Full Text]
  15. Harada H., Kitagawa M., Tanaka N., Yamamoto H., Harada K., Ishihara M., Taniguchi T. Anti-oncogenic and oncogenic potentials of interferon regulatory factors-1 and 2. Science (Washington DC), 259: 971-974, 1993.[Abstract]
  16. Tanaka N., Ishihara M., Kitagawa M., Harada H., Kimura T., Matsuyama T., Lamphier M. S., Aizawa S., Mak T. W., Taniguchi T. Cellular commitment to oncogene-induced transformation or apoptosis is dependent on the transcription factor IRF-1. Cell, 77: 829-839, 1994.[Medline]
  17. Harada H., Kondo T., Ogawa S., Tamura T., Kitagawa M., Tanaka N., Lamphier M. S., Hirai H., Taniguchi T. Accelerated exon skipping of IRF-1 mRNA in human myelodysplasia/leukemia: a possible mechanism of tumor suppressor inactivation. Oncogene, 9: 3313-3320, 1993.
  18. Watanabe N., Sakakibara J., Hovanessian A., Taniguchi T., Fujita T. Activation of IFN-ß element by IRF-1 requires a posttranslational event in addition to IRF-1 synthesis. Nucleic Acids Res., 16: 4421-4428, 1991.
  19. Sonenberg N. Translation factors as effectors of cell growth and tumorigenesis. Curr. Opin. Cell Biol., 5: 955-960, 1993.[Medline]
  20. Tamura T., Ishihara M., Lamphier M. S., Tanaka N., Oishi I., Aizawa S., Matsuyama T., Mak T. W., Taki S., Taniguchi T. An IRF-1-dependent pathway of DNA damage-induced apoptosis in mitogen-activated T lymphocytes. Nature (Lond.), 376: 596-599, 1995.[Medline]
  21. Tanaka N., Ishihara M., Lamphier M. S., Nozawa H., Matsuyama T., Mak T. W., Aizawa S., Tokino T., Oren M., Taniguchi T. Cooperation of the tumor suppressor IRF-1 and p53 in response to DNA damage. Nature (Lond.), 382: 816-818, 1996.[Medline]
  22. Giandomenico V., Lancillotti F., Fiorucci G., Percario Z. A., Rivabene R., Malorni W., Affabris E., Romeo G. Retinoic acid and IFN inhibition of cell proliferation is associated with apoptosis in squamous carcinoma cell lines: role of IRF-1 and TGase II-dependent pathways. Cell Growth Differ., 8: 91-100, 1997.[Abstract]
  23. Gudas L. J., Sporn M. B., Roberts A. B. The Retinoids: Biology, Chemistry and Medicine Ed. 2 Sporn M. B. Roberts A. B. Goodman D. S. eds. . , : 443-520, Raven Press, Ltd. New York 1994.
  24. Chambon P. The molecular and genetic dissection of the retinoid signaling pathway. Recent Prog. Horm. Res., 50: 317-332, 1995.
  25. Bollag W. Experimental basis of cancer combination chemotherapy with retinoids, cytokines, 1,25-dihydroxyvitamin D3, and analogs. J. Cell. Biochem., 56: 427-435, 1994.[Medline]
  26. Kolla V., Lindner D. J., Weihua X., Borden E. C., Kalvakolanu D. V. Modulation of interferon (IFN)-inducible gene expression by retinoic acid. Up-regulation of STAT1 protein in IFN-unresponsive cells. J. Biol. Chem., 271: 10508-10514, 1996.[Abstract/Free Full Text]
  27. Lancillotti F., Giandomenico V., Affabris E., Fiorucci G., Romeo G., Rossi G. B. Interferon {alpha}-2b and retinoic acid combined treatment affects proliferation and gene expression of human cervical carcinoma cells. Cancer Res., 55: 3158-3164, 1995.[Abstract/Free Full Text]
  28. Lippman S. M., Glisson B. M., Kavanagh J. J., Lotan R., Hong W. K., Peredes-Espinoza M., Hittelman W. N., Holdener E. E., Krakoff I. H. Retinoc acid and interferon combination studies in human cancer. Eur. J. Cancer, 29A: S9-S13, 1993.
  29. Giandomenico V., Vaccari G., Fiorucci G., Percario Z., Vannucchi S., Matarrese P., Malorni W., Romeo G., Affabris E. Apoptosis and growth inhibition of squamous carcinoma cells treated with IFN-{alpha}, IFN-ß and retinoic acid are associated with induction of the cyclin-dependent kinase inhibitor p21. Eur. Cytokine Net., in press, : 1999.
  30. Harada H., Takahashi E-I., Itoh S., Harada K., Hori T-A., Taniguchi T. Structure and regulation of the human interferon regulatory factor 1 (IRF-1) and IRF-2 genes: implications for a gene network in the interferon system. Mol. Cell. Biol., 14: 1500-1509, 1994.[Abstract/Free Full Text]
  31. McDonnell T. J. Cell division versus cell death: a functional model of multistep neoplasia. Mol. Carcinog., 8: 209-213, 1993.[Medline]
  32. Gianni M., Terao M., Fortino I., LiCalzi M., Viggiano V., Barbui T., Rambaldi A., Garattini E. Stat1 induced and activated by all-trans retinoic acid in acute promyelocytic leukemia cells. Blood, 89: 1001-1012, 1997.[Abstract/Free Full Text]
  33. Matikainen S., Ronni T., Hurme M., Pine R., Julkunen I. Retinoic acid activates interferon regulatory factor-1 gene expression in myeloid cells. Blood, 88: 114-123, 1996.[Abstract/Free Full Text]
  34. Baeuerle P. A., Henkel T. Function and activation of NF-{kappa}B in the immune system. Annu. Rev. Immunol., 12: 141-179, 1994.[Medline]
  35. Lin R., Gewert D., Hiscott J. Differential transcriptional activation in vitro by NF-{kappa}B/rel proteins. J. Biol. Chem., 270: 3123-3131, 1995.[Abstract/Free Full Text]
  36. Roulston A., Lin R., Beauparlant P., Wainberg M., Hiscott J. Regulation of human immunodeficiency virus type 1 and cytokine gene expression in myeloid cells by NF-{kappa}B/rel transcription factors. Microbiol. Rev., 59: 481-505, 1992.[Abstract/Free Full Text]
  37. Veals S. A., Schindler C., Leonard D., Fu X. Y., Aebersold R., Darnell J. E., Jr., Levy D. E. Subunit of an {alpha}-interferon-responsive transcription factor is related to interferon regulatory factor and Myb families of DNA-binding proteins. Mol. Cell. Biol., 12: 3315-3324, 1992.[Abstract/Free Full Text]
  38. Perkins N. D., Schmid R. M., Duckett C. S., Leung K., Rice N. R., Nabel G. J. Distinct combinations of NF-{kappa}B subunits determine the specificity of transcriptional activation. Proc. Natl. Acad. Sci. USA, 89: 1529-1533, 1992.[Abstract/Free Full Text]
  39. Pelicano L., Li F., Schindler C., Chelbi-Alix M. K. Retinoic acid enhances the expression of interferon-induced proteins: evidence for multiple mechanisms of action. Oncogene, 15: 2349-2359, 1997.[Medline]
  40. Romeo G., Affabris E. Retinoic acid and interferon induced apoptosis. Retinoids Today Tomorrow, 45: 32-35, 1996.
  41. Bluyssen H. A. R., Durbin J. E., Levy D. E. ISGF3 gamma p48, a specificity switch for interferon activated transcription factors. Cytokine Growth Factor Rev., 7: 11-17, 1996.[Medline]
  42. Glisin V., Crkvenjakov R., Byus C. Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry, 13: 2633-2637, 1974.[Medline]
  43. Pine R., Canova A., Schindler C. Tyrosine phosphorylated p91 binds to a single element in the ISGF2/IRF-1 promoter to mediate induction by IFN {alpha} and IFN {gamma}, and is likely to autoregulate the p91 gene. EMBO J., 13: 158-167, 1994.[Medline]
  44. Coccia E. M., Vaiman D., Raber J., Marziali G., Fiorucci G., Orsatti R., Cohen B., Nissim N., Romeo G., Affabris E., Chebath J., Battistini A. Protein binding to the interferon response enhancer correlates with interferon induction of 2',5'-oligoadenylate synthethase in normal and interferon-resistant Friend cells. J. Virol., 65: 2081-2087, 1991.[Abstract/Free Full Text]
  45. Fried M., Crothers D. M. Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis. Nucleic Acid Res., 9: 6505-6525, 1981.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 FASEB J.Home page
C. Trottier, M. Colombo, K. K. Mann, W. H. Miller Jr., and B. J. Ward
Retinoids inhibit measles virus through a type I IFN-dependent bystander effect
FASEB J, September 1, 2009; 23(9): 3203 - 3212.
[Abstract] [Full Text] [PDF]

Home page
 Exp. Biol. Med.Home page
X. M. Luo and A. C. Ross
Retinoic Acid Exerts Dual Regulatory Actions on the Expression and Nuclear Localization of Interferon Regulatory Factor-1.
Experimental Biology and Medicine, May 1, 2006; 231(5): 619 - 631.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. M. Luo and A. C. Ross
Physiological and Receptor-selective Retinoids Modulate Interferon {gamma} Signaling by Increasing the Expression, Nuclear Localization, and Functional Activity of Interferon Regulatory Factor-1
J. Biol. Chem., October 28, 2005; 280(43): 36228 - 36236.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. C. Morrison, C. B. Wilson, M. Ray, and P. H. Correll
Macrophage-Stimulating Protein, the Ligand for the Stem Cell-Derived Tyrosine Kinase/RON Receptor Tyrosine Kinase, Inhibits IL-12 Production by Primary Peritoneal Macrophages Stimulated with IFN-{gamma} and Lipopolysaccharide
J. Immunol., February 1, 2004; 172(3): 1825 - 1832.
[Abstract] [Full Text] [PDF]

Home page
 CVIHome page
I. Arany, W. E. Whitehead, K. J. Grattendick, I. A. Ember, and S. K. Tyring
Suppression of Growth by All-trans Retinoic Acid Requires Prolonged Induction of Interferon Regulatory Factor 1 in Cervical Squamous Carcinoma (SiHa) Cells
Clin. Vaccine Immunol., September 1, 2002; 9(5): 1102 - 1106.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
E. E.W. Cohen and E. E. Vokes
Searching for a Standard
J. Clin. Oncol., January 15, 2002; 20(2): 359 - 361.
[Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Deb, S. J. Haque, T. Mogensen, R. H. Silverman, and B. R. G. Williams
RNA-Dependent Protein Kinase PKR Is Required for Activation of NF-{{kappa}}B by IFN-{{gamma}} in a STAT1-Independent Pathway
J. Immunol., May 15, 2001; 166(10): 6170 - 6180.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Percario, Z. A.
Right arrow Articles by Romeo, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Percario, Z. A.
Right arrow Articles by Romeo, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation