CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blake, R. A.
Right arrow Articles by Courtneidge, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blake, R. A.
Right arrow Articles by Courtneidge, S. A.
Cell Growth & Differentiation Vol. 10, 231-241, April 1999
© 1999 American Association for Cancer Research

Src Promotes PKC{delta} Degradation

Robert A. Blake, Pilar Garcia-Paramio, Peter J. Parker and Sara A. Courtneidge1

SUGEN Inc., South San Francisco, California 94080-4811 [R. A. B., S. A. C.], and Imperial Cancer Research Fund, London WC2A 3PX, United Kingdom [P. G-P., P. J. P.]


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Platelet-derived growth factor BB (PDGF) stimulates DNA synthesis through a mechanism that is at least partially dependent upon Src family tyrosine kinases, although the signal transduction pathway downstream of Src is poorly understood. We have studied the signaling between Src and different protein kinase C (PKC) isoforms and its possible role in the regulation of PDGF-stimulated DNA synthesis. We found that Src promoted the tyrosine phosphorylation of PKC{delta}, and its subsequent degradation. Enforced expression of PKC{delta} inhibited PDGF-stimulated DNA synthesis, whereas expression of PKC{alpha} and PKC{epsilon} did not, a finding consistent with a model in which PKC{delta} negatively regulates G1-to-S-phase progression. We used mutagenesis to map a critical Src phosphorylation site on PKC{delta} to tyrosine 311. A mutant form of PKC{delta} in which tyrosine 311 was replaced with phenylalanine (Y311F) was more stable in the presence of Src, suggesting that Src-induced degradation was a direct result of PKC{delta} tyrosine phosphorylation. We conclude that PKC{delta} is downstream of Src but is unlikely to play a positive role in the signaling pathway by which Src promotes DNA synthesis.


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
PDGF2 stimulates a mitogenic response in mesenchymally derived cells such as fibroblasts as well as other cell types. The Src family kinases Src, Fyn, and Yes have been implicated in PDGF signaling by their association with the phosphorylated PDGFR and their subsequent activation (1 , 2) . Although there is some redundancy of function between these kinases, as a group they appear to be essential for PDGF-stimulated mitogenesis in fibroblasts. Inactivation of endogenous Src family kinases with either a neutralizing antibody or by expression of kinase-inactive or SH3 domain-deleted forms of Src or Fyn inhibit PDGF-stimulated DNA synthesis (3, 4, 5) .

It is unlikely that Src kinases have only a single substrate involved in the regulation of mitogenesis. Src substrates possibly involved in PDGF signaling include PKC{delta} (6) , the PDGFR itself (7) , Shc (8) , Grb-2 (9) , the inositol 1,4,5-triphosphate (IP3) receptor (10) , the phosphatidylinositol 3'-kinase p85{alpha} subunit (11 , 12) , and Eps8 (13) . Here we focus on the role of Src in PKC{delta} regulation and the possible role that PKC{delta} plays in the regulation of mitogenesis.

It has previously been reported that PKC{delta} serves as a substrate for Src (14) . However, there is some disagreement about the effect of tyrosine phosphorylation on PKC{delta} activity. Some reports suggest that tyrosine phosphorylation activates PKC{delta} (14 , 15) or modifies its substrate preference (16) . Others report that tyrosine phosphorylation decreases PKC{delta} activity (17 , 18) . It should be noted that these apparently conflicting studies differ in several key aspects, including whether they used purified PKC{delta} tyrosine phosphorylated in vitro or PKC{delta} extracted from stimulated cells, the cell type, the nature of the stimulus, and whether they measured PKC{delta} activity directly or addressed changes in PKC activity in different cellular fractions.

Several reports have also suggested that PKC{delta} is involved in PDGF signaling. Li et al. (6) note that in cells overexpressing both PDGFR and PKC{delta}, PDGF causes an increase in PKC activity associated with the membrane fraction, the exclusive location of tyrosine-phosphorylated PKC{delta}. Translocation of PKC{delta} to the membrane fraction is also observed in PDGF-stimulated vascular smooth muscle cells (19) and fibroblasts (20) . In addition, a kinase-inactive mutant of PKC{delta} inhibits cellular transformation by the sis proto-oncogene, which is closely related to PDGF (21) . The results of Li et al. (21) imply that PKC{delta} promotes PDGFR-stimulated anchorage-independent growth. This is somewhat at odds with other data concerning the effect of PKC{delta}. For example, kinase-active PKC{delta} has been shown to inhibit cell cycle progression. Watanabe et al. (22) show that phorbol ester treatment of Chinese hamster ovary cells overexpressing PKC{delta} causes them to arrest in G2/M phase. Also, overexpression of PKC{delta} in either NIH3T3 cells or human glioma cells reduces their rate of growth and the density to which they grow (23 , 24) .

In the experiments described here, we have examined in more detail the role of Src phosphorylation of PKC{delta} and its involvement in PDGF-mediated signal transduction.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Tyrosine Phosphorylation and Protein Instability of PKC{delta} in Src-transformed Cells.
We observed that PKC{delta} was highly tyrosine-phosphorylated in NIH3T3 cells stably transfected with an activated mutant of Src (527 cells), consistent with previous reports that PKC{delta} is a Src substrate. However, we also noted that the level of PKC{delta} was significantly lower in 527 cells compared with the parental NIH3T3 cells (Fig. 1A)Citation . Treatment of NIH3T3 cells with PDGF, but not FCS, stimulated a modest increase in the tyrosine phosphorylation of endogenous PKC{delta}. This elevation of PKC{delta} tyrosine phosphorylation also corresponded with a modest decrease in the level of PKC{delta} (Fig. 1A)Citation .



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 1. Cells stably transfected with activated Src have diminished levels of PKC{delta}. A, NIH3T3 cells or NIH3T3 cells stably transfected with activated Src (527 cells) were quiesced in insulin/transferrin (24 h) and then stimulated with either 10% v/v FCS, 25 ng/ml PDGF, or 100 nM PMA for 10 min. The top panel shows an antiphosphotyrosine immunoblot of immunoprecipitated PKC{delta}. The bottom panel shows the same blot stripped and reprobed for the level of PKC{delta}. B, NIH3T3 cells and 527 cells were labeled with [35S]methione and cysteine, PKC{delta} immunoprecipitated, and resolved by 10% SDS-PAGE and autoradiography. C, PKC{delta} was immunoprecipitated from TGR-1 cells and TGR-1 cells stably transfected with the activated human Src SrcY530F, resolved on 10% SDS-PAGE, and visualized by anti-PKC{delta} immunoblotting.

 
The treatment of cells with phorbol esters, including PMA, ultimately leads to the degradation of phorbol ester- and diacylglycerol-sensitive isoforms of PKC (25 , 26) . We observed a reduction in the level of PKC{delta} after treatment with PMA, but unlike PDGF stimulation, PMA did not stimulate detectable tyrosine phosphorylation of PKC{delta} in NIH3T3 cells. However, both PDGF and PMA increased the tyrosine phosphorylation of PKC{delta} in 527 cells. This is consistent with previous studies in which activation of PKC{delta} renders it a better substrate for Src (14) . It is also likely that phorbol ester stimulates translocation of PKC{delta} to the membrane (27 , 28) , making it more accessible to Src.

The apparent reduction of the steady-state level of PKC{delta} in 527 cells was not due to impaired detection of the tyrosine-phosphorylated form because the anti-COOH-terminal antibody used to immunoprecipitate PKC{delta} was clearly able to recognize tyrosine-phosphorylated PKC{delta} (Fig. 1A)Citation , and similar experiments using an antibody raised to a fusion protein of the NH2-terminal half of PKC{delta} also showed a lower level of PKC{delta} in 527 cells (data not shown). Furthermore, immunoprecipitation of 35S-labeled PKC{delta}, followed by detection by autoradiography, also showed a decreased level of PKC{delta} in 527 cells (Fig. 1B)Citation . In addition, treatment of tyrosine-phosphorylated PKC{delta} with alkaline phosphatase did not increase the apparent level of PKC{delta} detected, despite reducing the phosphorylation (data not shown). Nor was the decreased level of PKC{delta} in 527 cells a clonal artifact or NIH3T3 cell specific, because TGR-1 cells [a fibroblastic cell line derived from Rat-1 (29) ] also had a lower level of endogenous PKC{delta} when stably transfected with an activated mutant of human Src (tyrosine 530 mutated to phenylalanine; human SrcY530F; Fig. 1CCitation ).

We considered the possibility that the decreased level of PKC{delta} detected in Src-transformed cells might be due to its translocation to a detergent-insoluble fraction, although this seemed unlikely because even protein-denaturing extraction conditions (see "Materials and Methods") failed to increase the level of PKC{delta} detected. If insolubility were the cause of the decreased level of PKC{delta}, its level would be diminished according to its distribution between the cell fractions, but the rate of protein turnover would be unaltered. We therefore compared the stability of PKC{delta} in NIH3T3 cells and 527 cells. PKC{delta} showed little sign of degradation over a 6-h period in NIH3T3 cells as determined by 35S pulse chase (Fig. 2A)Citation or using cycloheximide to inhibit protein synthesis (Fig. 2B)Citation . However, PKC{delta} was much less stable in 527 cells. Both 35S pulse-chase and cycloheximide treatment revealed an increased rate of PKC{delta} turnover relative to that of the parental NIH3T3 cells (Fig. 2, A and B)Citation . The half-life of PKC{delta} was estimated as 3.5 h in 527 cells by quantitation of 35S autoradiography. We also asked whether Src affected the level of PKC{delta} mRNA. Fig. 2CCitation shows a Northern blot comparing the level of PKC{delta} mRNA in 527 cells and the parental NIH3T3 cells. We found no evidence that expression of activated Src affects the PKC{delta} transcript level. We therefore conclude that the level of PKC{delta} is reduced through increased degradation.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 2. Src promotes PKC{delta} degradation. A, NIH3T3 cells and 527 cells were labeled 16 h with [35S]methionine/cysteine and washed, and Cys/Met chase medium was added. At the times indicated, cells were lysed. PKC{delta} was immunoprecipitated and resolved on 10% SDS-PAGE and visualized by autoradiography. The PKC{delta} band was excised, and the level of 35S incorporation was quantitated by liquid scintillation counting. The results corrected for background counts are shown in the two graphs. The half-life of PKC{delta} in 527 cells is indicated on the graph to the right. B, NIH3T3 cells and 527 cells were treated with 20 µg/ml cycloheximide and then lysed at the times indicated. PKC{delta} was immunoprecipitated and resolved by SDS-PAGE and immunoblotted for the level of PKC{delta}. C, RNA from NIH3T3 cells and 527 cells was probed for the level of PKC{delta} mRNA. The bottom panel shows the ß-actin control. D, 527 cells were treated with the Src kinase inhibitor PP2 (5 µM) or the proteasome inhibitors Clasto-lactacystin-ß-lactone (c-lc; 1 µM) or MG132 (132; 10 µM) for 16 h, and then PKC{delta} was immunoprecipitated and resolved by SDS-PAGE, and its level was determined by immunoblotting.

 
A major route of protein degradation involves proteasomes, large protease complexes located in both the cytoplasm and the nucleus. Proteasomes are implicated primarily in the degradation of ubiquitinated protein but also in nonubiquitinated protein (30, 31, 32) . To test the hypothesis that tyrosine phosphorylation promotes PKC{delta} degradation and to determine whether proteasomes were involved, we measured the effect of proteasome inhibitors on the level of PKC{delta} in 527 cells. Clasto-lactacystin-ß-lactone, which inhibits several different peptide hydrolytic activities of the proteasome (33) , and MG132, which inhibits protein degradation by the proteasome without affecting its ATPase or isopeptidase activity (34 , 35) , both elevated the level of PKC{delta} in 527 cells (Fig. 2D)Citation . Similar results were seen for proteasome inhibitor 1, which inhibits the chymotrypsin-like activity of the proteasome (Ref. 36 ; data not shown). Together, these data suggest that proteasomes participate in the degradation of tyrosine-phosphorylated PKC{delta}.

Recently, Hanke et al. (37) described the tyrosine kinase inhibitors PP1 and PP2 and demonstrated that they were potent Src family kinase inhibitors, but only weakly inhibited ZAP-70 and JAK2. In further analysis of the selectivity of these compounds, we found that they inhibited both PDGFR kinase activity and Src kinase activity with similar potency (PP1-Src IC50 = 0.4 µM, PP1-PDGFR IC50 = 1.6 µM, PP2-Src IC50 = 1.4 µM, and PP2-PDGFR IC50 = 1.5 µM), precluding us from using them to study the role of Src in PDGF signal transduction. However, we could use them to study Src-transformed cells. For example, we have observed that PP1 and PP2 reverse the transformed phenotype of 527 cells, causing them to flatten and lose their characteristic actin rings.3 We examined the effect of PP2 on the tyrosine phosphorylation of PKC{delta} and on its protein level in 527 cells. PP2 both decreased the tyrosine phosphorylation of PKC{delta} and increased its protein level, effectively reversing the effects of Src on PKC{delta} (Fig. 3A)Citation . This supports the conclusion that tyrosine phosphorylation of PKC{delta} results in its instability.



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 3. PP2 modulates the tyrosine phosphorylation, protein level, and activity of PKC{delta}. A, 527 cells were incubated for 16 h in the presence of 5 µM PP2 or DMSO alone as a control and then lysed. The level of PKC{delta} protein and the level of its tyrosine phosphorylation were determined by immunoprecipitation and immunoblotting. The left panel shows an antiphosphotyrosine blot. The right panel shows an anti-PKC{delta} blot. B, 527 cells overexpressing PKC{delta} (527{delta} cells) were incubated for 16 h with PP2 (5 µM) or with DMSO alone and then lysed according to the PKC{delta} kinase protocol. PKC{delta} was immunoprecipitated from a serial dilution of each lysate (1.0, 0.5, 0.25, 0.125, and 0.0 mg/ml, indicated by the narrowing bar. The presence or absence of anti-PKC{delta} antibody in the immunoprecipitation is indicated by + or -, respectively. Each immunoprecipitate was subjected to PKC{delta} kinase assay using MBP as a substrate (top panel), and the level of PKC{delta} in each immunoprecipitate was determined by immunoblotting (bottom panel).

 
We next asked what effect tyrosine phosphorylation of PKC{delta} had on its intrinsic kinase activity. We measured the PKC{delta}-associated kinase activity in 527 cells overexpressing PKC{delta} (527{delta} cells) that had been treated with PP2 or mock-treated with solvent alone. Fig. 3BCitation shows the PKC{delta} kinase activity detected in decreasing concentrations of cell lysate. Also shown are the levels of PKC{delta} protein in each immunoprecipitate. Consistent with Fig. 3ACitation , PP2 treatment increased the level of PKC{delta} (Fig. 3BCitation , bottom panel). Despite this, however, PKC{delta} kinase activity was lower than in the control cells in which PKC{delta} remains tyrosine-phosphorylated. The lower level of PKC{delta} activity was not caused by PP2 copurifying with and inhibiting PKC{delta} because it had no effect on PKC{delta} activity when added directly to the cell lysate as opposed to the preincubation with intact cells (data not shown). We conclude that tyrosine phosphorylation of PKC{delta} by Src has two effects: (a) it increases the specific activity of PKC{delta}; and (b) it also causes the protein to become unstable.

PKC{delta} and PDGF Stimulation.
We next measured the time course of PKC{delta} tyrosine phosphorylation and activity during stimulation of cells by PDGF. PKC{delta} underwent only a brief period of tyrosine phosphorylation during the initial 20–30 min of PDGF stimulation of TGR-1 cells (Fig. 4A)Citation or NIH3T3 cells (Fig. 1A)Citation . Tyrosine phosphorylation was followed by a modest decrease in the level of PKC{delta} in both cell types. PDGF also stimulated a brief period of activation (this is more convincing in TGR-1 cells, which express higher levels of PKC{delta} than NIH3T3 cells; Fig. 4ACitation and data not shown) followed by a sustained decrease in PKC{delta} activity in both TGR-1 cells and NIH3T3 cells (Fig. 4, B and C)Citation . This pattern of tyrosine phosphorylation, activation, and decrease in protein levels is consistent with the effects of PKC{delta} tyrosine phosphorylation in Src-transformed cells.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 4. PDGF stimulates a pulse of PKC{delta} tyrosine phosphorylation, activation, and a subsequent decrease in the PKC{delta} level. TGR-1 or NIH3T3 cells were quiesced for 24 h in 0.5% FCS and then stimulated with 25 ng/ml PDGF for the times indicated. A, TGR-1 cells were lysed, and PKC{delta} tyrosine phosphorylation (top panel) and protein level (bottom panel) were determined by immunoprecipitation and immunoblotting. B, TGR-1 cells were lysed, and the activity of PKC{delta} was determined according to the PKC{delta} kinase assay protocol using MBP as a substrate. C, quantitation of the activity of PKC{delta} in TGR-1 cells (n = 3) or NIH3T3 cells (n = 4) stimulated for various times with 25 ng/ml PDGF. The data are presented as the fold activation of PKC{delta}. The error bars represent the SE. Significant difference from the unstimulated kinase activity (P <= 0.05) is indicated by *. P <= 0.005 is indicated by **.

 
The degradation of PKC{delta} is probably part of the mechanism that terminates the brief pulse of PKC{delta} activity, but what is its significance with regard to the mitogenic signal of PDGF? One way to address this is to maintain artificially high PKC{delta} levels by ectopic expression from plasmids microinjected into cells. We used bromodeoxyuridine incorporation into newly synthesized DNA to compare the effect of PKC{alpha}, PKC{delta}, and PKC{epsilon} expression on PDGF-stimulated DNA synthesis. PKC{delta} expression caused a significant reduction in the number of cells entering S phase, whereas in cells overexpressing PKC{alpha} and PKC{epsilon}, the percentage of cells entering S phase was unaltered (Fig. 5A)Citation . It appears that prolonged expression and therefore prolonged elevation of PKC{delta} activity prevents or delays cells from proceeding from G1 to S phase. Although we do not know the function of the brief activation of PKC{delta}, if any, we suggest that its rapid termination is important for PDGF-stimulated mitogenesis.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5. Enforced expression of PKC{delta} inhibits PDGF-stimulated DNA synthesis. A, NIH3T3 cells were quiesced for 24 h in 0.5% FCS and then microinjected with plasmids (100 µg/ml) expressing either PKC{alpha}, PKC{delta}, or PKC{epsilon}. After 16 h, cells were stimulated with 25 ng/ml PDGF in the presence of BrdUrd for 24 h and then fixed and stained for the expression of the PKC isoform and the incorporation of BrdUrd into the nuclear DNA. The data are presented as the percentage of cells that stained positively for BrdUrd incorporation (% BrdUrd; n >= 3). B, NIH3T3 cells were quiesced and then microinjected with pBP PKC{delta} (200 µg/ml) either alone or in combination with pSGT SrcY527F (25 µg/ml), stimulated with PDGF, and stained for PKC{delta} as described above. C, NIH3T3 cells were quiesced and then microinjected with pBP PKC{delta}Y311F (200 µg/ml) either alone or in combination with pSGT SrcY527F (25 µg/ml), stimulated with PDGF, and stained for PKC{delta} as described above or for Src using monoclonal antibody EC10 when pSGTSrcY527F was the sole injected plasmid. Significant differences between uninjected and injected PDGF-stimulated cells are indicated by * for P <= 0.05 and ** for P <= 0.005 (n = 3). A significant difference between PDGF cells injected with PKC{delta} alone and PDGF-stimulated cells injected with both PKC{delta} and SrcY527F is indicated by •, indicating P <= 0.05.

 
If Src mediates the down-regulation of PKC{delta}, overexpression of activated Src might be expected to rescue the inhibition of DNA synthesis by PKC{delta}. As before, PKC{delta} inhibited PDGF-stimulated DNA synthesis. Coexpression of activated Src with PKC{delta} caused a significant elevation in the number of PDGF-stimulated cells entering S phase, consistent with a rescue of the PKC{delta} block by Src (Fig. 5B)Citation . It should also be noted that coexpression of this amount of activated Src with PKC{delta} caused a smaller but significant elevation of the number of unstimulated cells entering S phase.

Analysis of PKC{delta} Mutants for Tyrosine Phosphorylation, Stability, and Function.
Several studies have sought to identify sites of tyrosine phosphorylation on PKC{delta}. Szallasi et al. (38) demonstrated that mutation of tyrosine 52 reduced IgE antigen-induced tyrosine phosphorylation. Li et al. (39) identified tyrosine 187 as a phosphorylation site. Konishi et al. (40) demonstrated that mutation of tyrosines 512 and 523 within the kinase domain abolished enzyme activation, but they noted that the mutated enzyme was still phosphorylated to some extent in response to H2O2. To identify other sites phosphorylated by Src, we generated a series of PKC{delta} tyrosine to phenylalanine (YF) point mutants targeting conserved tyrosines with high surface probability and NH2-terminal acidic groups, because these features are often seen in peptide substrates of tyrosine kinases (41) . The YF point mutations included: (a) Y311F, which lies in the extended region between the cysteine-rich domains and the kinase domain; (b) Y372F, which lies in the small lobe of the kinase domain; (c) Y565F, which lies in the large lobe of the kinase domain; and (d) Y628F, which lies in the COOH-terminal tail. We tested the ability of Src to phosphorylate the PKC{delta} YF mutants by coexpressing them with activated Src in HEK293 cells (Fig. 6A)Citation and assaying the level of PKC{delta} tyrosine phosphorylation. Although we often saw a slight reduction in the level of tyrosine phosphorylation of several mutants relative to the wild type, PKC{delta}Y311F was unique in that it was not a substrate for Src, with no phosphorylation over the background being detected. It is interesting to note that the sequence surrounding tyrosine 311 shows the highest similarity to the optimal Src substrate sequence predicted by Songyang et al. (42) .



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 6. Mutation of PKC{delta} tyrosine 311 prevents its phosphorylation by Src and renders it resistant to Src-induced degradation. A, tyrosine to phenylalanine point mutations of PKC{delta} were generated and tested for their ability to act as Src substrates. HEK293 cells were transfected with 4 µg of each PKC{delta} mutant (identified by the residue number mutated, e.g., 311 indicates PKC{delta} Y311F) or wild type (WT) in pBP, in combination with 4 µg of pBP SrcY530F or 4 µg of pBP as a control. After 16 h, cells were lysed, and the level of PKC{delta} tyrosine phosphorylation was determined by immunoprecipitation and antiphosphotyrosine immunoblotting (top panel). The bottom panel shows the immunoblot for the level of PKC{delta}. B, 527 cells overexpressing PKC{delta} (527{delta} cells) were lysed in 1 ml of RIPA containing no protease inhibitors. The lysate was incubated at 37°C with 100 µl of agarose immobilized trypsin (Sigma). At the times indicated, the trypsin-agarose was pelleted, and a 250-µl aliquot of lysate was removed, and 1 mM PMSF was added. An antibody raised to the COOH-terminal sequence of PKC{delta} was used to immunoprecipitate protein from each aliquot, and phosphotyrosine-containing protein was detected by SDS-PAGE and immunoblotting (left panel). The same experiment was performed comparing 527 (5) and 527{delta} ({delta}) cell lysates that were either digested or not digested with trypsin-agarose for 60 min. C, HEK293 cells were transfected with i) 8 µg of pBP PKC{delta} WT + 0.4 µg of pBP, ii) 8 µg of pBP PKC{delta} Y311F + 0.4 µg of pBP, iii) 8 µg of pBP PKC{delta} WT + 0.4 µg of pBP SrcY530F, or iv) 8 µg of pBP PKC{delta} Y311F + 0.4 µg of pBP SrcY530F. After 16 h, each set of transfected cells was trypsinized and divided equally into a 6-well plate. After an additional 12 h, 20 µg/ml cycloheximide was added. Cells were scraped, washed, and lysed at the times indicated after the addition of cycloheximide. The level of PKC{delta} was determined by immunoprecipitation and immunoblotting. D, HEK293 cells were transfected with either 8 µg of pBP PKC{delta} WT or pBP PKC{delta} Y311F for 16 h and trypsinized, and each was divided equally into a 6-well dish. After 12 h, cells were treated with either 100 nM PMA or DMSO alone. Cells were scraped, washed, and lysed at the times indicated after the addition of PMA. The level of PKC{delta} was determined by immunoprecipitation, SDS-PAGE, and immunoblotting.

 
Fig. 6ACitation also shows that, just as in NIH3T3 cells, the level of endogenous PKC{delta} in HEK293 (human embryo renal cortical) cells is significantly reduced when activated Src is expressed [compare the level of endogenous PKC{delta} in the control mock-transfected HEK293 cells in the far left lane of the bottom panel of Fig. 6ACitation with the level of endogenous PKC{delta} in cells transfected with activated Src in Lane Src - (seventh from the left)]. Even when highly expressed by transient transfection in HEK293 cells, PKC{delta} shows a Src-dependent decrease in its protein level in the presence of cycloheximide (Fig. 6C)Citation , suggesting that Src-induced PKC{delta} degradation is not specific to fibroblastic cell lines.

As part of our study of the tyrosine phosphorylation sites of PKC{delta}, we also performed a series of experiments designed to detect tyrosine phosphorylation of COOH-terminal fragments of PKC{delta}. Lysates of 527 cells were digested with immobilized trypsin, and then fragments containing the COOH terminus were isolated by immunoprecipitation using an antibody raised to the extreme COOH-terminal sequence of PKC{delta}. The fragments were analyzed by antiphosphotyrosine immunoblot (Fig. 6B)Citation . Digestion with trypsin over a period of 60 min reduced the 78–83-kDa PKC{delta} band to a trypsin-resistant fragment of 20 kDa. We were concerned about whether this fragment was really derived from PKC{delta}, and not from another protein with an epitope recognized by the COOH-terminal antibody that was exposed when digested with trypsin. We addressed this by comparing the level of the 20-kDa fragment in 527 cells with that of 527 cells overexpressing PKC{delta} (Fig. 6B)Citation . Comparison of the level of the 20-kDa protein in the two right lanes of Fig. 6BCitation shows that trypsinization of the lysate from cells overexpressing PKC{delta} produced an elevated level of the 20-kDa protein relative to the parental cells. This strongly suggests that the 20-kDa fragment is indeed derived from PKC{delta}. This 20-kDa fragment contains both the COOH terminus and at least one site of tyrosine phosphorylation. A COOH-terminal fragment containing tyrosine 311 would be 42 kDa in size. Even allowing for aberrant SDS-PAGE mobility, it is unlikely that the COOH-terminal trypsin-resistant 20-kDa fragment contains tyrosine 311, suggesting that additional tyrosine phosphorylation sites exist. The fact that a single mutation was capable of blocking all detectable phosphorylation of PKC{delta} by Src and the experiments described above are consistent with a mechanism of processive phosphorylation beginning with tyrosine 311.

We have presented evidence that Src promotes the degradation of PKC{delta}. Although PKC{delta} is a Src substrate, it is not certain that its tyrosine phosphorylation is directly responsible for its degradation. The initiation of degradation may occur via an indirect mechanism involving either diacylglycerol, the original second messenger shown to activate PKC isoforms, or phosphatidylinositol-3,4-P2 or phosphatidylinositol-3,4,5-P3, which were identified more recently as second messengers that activate the PKC isoforms {delta}, {epsilon}, and {Sigma}. We do not believe that phosphatidylinositol-3,4-P2 or phosphatidylinositol-3,4,5-P3 is involved in the Src-induced degradation of PKC{delta} because the phosphatidylinositol 3'-kinase inhibitor LY294002 (25 µM) had no effect on PKC{delta} levels in Src-transformed cells (data not shown), but this does not disprove the involvement of a second messenger. The fact that Src was unable to phosphorylate PKC{delta}Y311F enabled us to test whether Src is required to phosphorylate PKC{delta} to promote its degradation. The stability of PKC{delta} WT or PKC{delta}Y311F was compared in the presence or absence of activated Src, using cycloheximide to inhibit protein synthesis in transfected HEK293 cells. To avoid fluctuations in PKC{delta} levels due to differences in transfection efficiency, each time course of cycloheximide treatment was performed on a single transfected sample divided equally between time points. Transiently expressed PKC{delta} WT and PKC{delta}Y311F were stable over the 4-h experiment in the presence of cycloheximide. When cotransfected with activated Src, PKC{delta} WT was rapidly degraded (Fig. 6C)Citation in a manner similar to that seen for endogenous PKC{delta} in cells stably transfected with activated Src (Fig. 2B)Citation . In contrast, PKC{delta}Y311F showed no sign of degradation when cotransfected with activated Src. We conclude that Src-induced degradation of PKC{delta} is a direct result of its tyrosine phosphorylation. We were curious to see whether PKC{delta}Y311F was also resistant to degradation induced by phorbol esters, so we tested the effect of PMA on HEK293 cells transiently transfected with PKC{delta} WT or PKC{delta}Y311F. Both PKC{delta} and PKC{delta}Y311F were stable over the 8-h period of the experiment when treated with DMSO alone as a control. However, PMA (100 nM) reduced the level of both PKC{delta} WT and PKC{delta}Y311F within 4 h of treatment (Fig. 6D)Citation . Therefore, mutation of tyrosine 311, although able to protect PKC{delta} against Src-induced degradation, does not protect it against the degradation elicited by PMA treatment.

Having shown that coexpression of an activated mutant of Src is able to rescue the inhibition of PDGF-stimulated DNA synthesis by PKC{delta} (Fig. 5B)Citation , we went on to test whether this was also true for PKC{delta}Y311F. Fig. 5CCitation shows the proportion of NIH3T3 cells going through PDGF-stimulated S-phase entry after the expression of SrcY527F and PKC{delta}Y311F. As in Fig. 5BCitation , expression of SrcY527F caused a slight elevation of DNA synthesis in unstimulated cells. However, SrcY527F did not cause an additional increase in DNA synthesis in PDGF-stimulated cells. PKC{delta}Y311F was similar to PKC{delta} WT in that its expression inhibited PDGF-stimulated DNA synthesis. However, coexpression of SrcY527F did not show any significant rescue of the inhibition of DNA synthesis by PKC{delta}Y311F, suggesting that the mechanism by which Src rescues the PKC{delta} block requires the tyrosine phosphorylation of PKC{delta} at tyrosine 311.


    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Despite the abundance of information already obtained on Src and many of its substrates, the mechanism by which Src mediates its mitogenic effect is not yet clear. We have focused on one of the Src substrates, PKC{delta}, to determine whether it is part of the PDGF signal transduction pathway downstream of Src that is required for DNA synthesis. Our data implicate PKC{delta} in this pathway but do not support a simple positive kinase cascade model. Src activates PKC{delta} but promotes its degradation, and sustained expression of PKC{delta} inhibits DNA synthesis.

One model that fits these data predicts that Src negatively regulates the level of PKC{delta}, a negative regulator of DNA synthesis, thereby promoting a mitogenic signal. However, it is probably not that simple because Src also transiently activates PKC{delta}. It is also clear that PKC{delta} activation and the fall in its protein level follow a tightly regulated temporal pattern during the very early stages of PDGF stimulation. As an aside, other stimuli unrelated to mitogenesis have also been shown to activate a pulse of PKC{delta} activity. The calcium-mobilizing agents carbachol and substance P stimulate a pulse of PKC{delta} activity in salivary gland parotid acinar cells (43) . It is not certain whether it is the initial activation of PKC{delta} or the cessation of its signal that is important for mitogenesis. The fact that sustained expression of PKC{delta} inhibits cell growth suggests the latter hypothesis. Whereas this may represent a real antimitogenic function, we must also consider the possibility that it is due to inappropriate expression of PKC{delta}. However, the fact that neither PKC{alpha} nor PKC{epsilon} expression was inhibitory suggests some specificity of the effect. Others have also described a negative effect of PKC{delta} on cell growth, but with some important differences. Watanabe et al. (22) observed cell cycle arrest in G2-M phase, whereas our data demonstrate a block in G1-S phase. This difference could be due to the different stimuli being used. Watanabe et al. examined the effect of TPA treatment, whereas our data apply exclusively to PDGF stimulation. Another study based on the pharmacological effects of TPA and bryostatin-1 suggests that PKC{delta} has an antimitogenic function. Lu et al. (44) demonstrate that bryostatin-1, which has complex effects on PKC{delta} including the inhibition of TPA-induced down-regulation of PKC{delta} in cells overexpressing c-Src, blocks the tumor-promoting effects of TPA. It is also likely that one of the other PKC isoforms mediates a positive role in PDGF-stimulated mitogenesis. A series of dominant inhibitory PKC mutants with broad specificity have recently been described (45) . Expression of these forms of PKC{alpha}, PKC{delta}, and PKC{epsilon} inhibit PDGF-stimulated DNA synthesis,4 suggesting that broad inhibition of PKC activation results in a mitogenic block.

The mechanism of PKC{delta} regulation has important implications for cell growth and might be expected to involve multiple levels of control and be regulated by converging signaling pathways. Olivier et al. (46) demonstrate that transforming growth factor ß1 selectively blocks bombesin-induced down-regulation of PKC{delta} within S phase. Shih et al. (47) reported that TPA regulates PKC{delta} expression by down-regulating its mRNA both transcriptionally and posttranscriptionally. However, we found no evidence that Src affects the level of PKC{delta} mRNA. Rather, our evidence implicates Src in the degradation of PKC{delta}. This adds to the growing body of evidence that tyrosine phosphorylation of PKC{delta} activates it but renders it highly susceptible to degradation. Recently, Zang et al. (18) demonstrated that the viral homologue of Src, v-Src, is able to form a complex with PKC{delta} that becomes phosphorylated on tyrosine. Whereas Zang et al. (18) noted a decrease in PKC{delta} activity, they did not address its cause or whether PKC{delta} protein levels were altered. The effect of proteasome inhibitors on the level of PKC{delta} in Src-transformed cells implicates a proteasome-dependent mechanism of degradation. Proteasomes were originally shown to degrade ubiquitinated proteins (30) , although nonubiquitinated proteins are now known to be degraded by this mechanism (31 , 32) . We do not believe that the effect of the proteasome inhibitors on PKC{delta} is due to nonspecific activity because structurally and mechanistically distinct compounds have the same effect, increasing the level of PKC{delta} in Src-transformed cells. Although we were unable to convince ourselves (using antiubiquitin immunoblotting) that PKC{delta} is ubiquitinated after its tyrosine phosphorylation, we do not exclude this possibility. Recently, Lu et al. (48) demonstrated that activation of PKC{alpha}, PKC{delta}, or PKC{epsilon} by phorbol esters triggers their ubiquitination and degradation. We frequently observed a tyrosine-phosphorylated 100–110-kDa protein in PKC{delta} immunoprecipitates from Src-transformed cells, but this is unlikely to represent polyubiquitinated PKC{delta} because it does not have the characteristic ladder of bands normally associated with ubiquitination. However, it could represent monoubiquitination. PKC{delta} may also be degraded by a mechanism involving the interleukin 1ß-converting enzyme-like proteases because it has two DXXD consensus caspase-3 cleavage sites (49) .

The fact that a single point mutation (Y311F) of PKC{delta} prevents its phosphorylation by Src suggests that Src uses a mechanism of processive phosphorylation. Such a mechanism has been implicated in the sequential phosphorylation of the {zeta} chain by Lck and the phosphorylation of p130cas by Abl. The effect of SH2 mutations suggests that processive phosphorylation proceeds via an initial high-affinity phosphorylation site to which the kinase binds using its SH2 domain, enabling subsequent phosphorylation of lower affinity sites (50 , 51) . It is interesting to note that according to the prediction of the optimal substrate sequence of Src (AEEEIYGEFEAKKKK) by Songyang et al. (42) , the sequence surrounding tyrosine 311 (ETVGIYQGFEKKTAV) suggests it is the highest affinity Src phosphorylation site on PKC{delta}. However, the sequence bears little resemblance to the optimal Src SH2 binding sequence PQYEEI (52) , raising the question of whether a third adaptor protein is involved. This SH2 model of processive phosphorylation does not exclude the possibility that tyrosine phosphorylation of Y311 changes the conformation of PKC{delta}, exposing other phosphorylation sites.

We have not addressed the possibility that tyrosine phosphorylation of PKC{delta} modifies its substrate preference because the specific substrates involved in the antimitogenic effect need to be characterized. Also, we recognize that different stimuli, even though they result in PKC{delta} tyrosine phosphorylation, may ultimately affect its activity in different ways, depending on other modes of regulation. PKC{delta} was recently shown to be regulated by PDK1 or a homologue (53) and is likely to be controlled in a manner similar to PKC{alpha}, by multisite phosphorylation (54, 55, 56) .

Some PKC{delta} substrates are common substrates for several PKC isoforms and thus are unlikely to mediate a PKC{delta}-specific effect such as inhibition of cell growth. These include the myristoylated alanine-rich PKC-kinase substrate MARCKS, which is sequentially phosphorylated by conventional, novel, and atypical isoforms of PKC (57) and the cytoskeletal protein vimentin (58) . However, the elongation factor eEF-1{alpha} is a more exclusive PKC{delta} substrate (59) . This protein has been found in complexes containing ribosomal RNA, aminoacyl-t-RNA, and ribosomal protein L8, which was identified as a PKC{delta}-associating protein by yeast 2-hybrid (60) . Perhaps PKC{delta} affects cell cycle progression through the regulation of protein synthesis. Alternatively, eEF-1{alpha} has also been implicated in the regulation of cytoskeletal structures (61 , 62) .

The dual effects of Src on PKC{delta}, its activation and its degradation, might go some way to explaining the conflicting reports of the effect of tyrosine phosphorylation on PKC{delta} activity. Phosphorylation of PKC{delta} in vitro will not have the complications of its degradation. Cellular studies not only deal with degradation, but also with what appear to be quite rapid kinetics of activation and inactivation.

There is considerable evidence implicating PKC{delta} in the regulation of mitogenesis and as a downstream target of Src during PDGF stimulation of fibroblastic cell lines. However, it is not possible to place PKC{delta} in a simple model that invokes a positive kinase cascade leading from Src to the regulation of DNA synthesis. We have demonstrated that the phosphorylation of PKC{delta} by Src requires the tyrosine at position 311. Mutation of this site prevents PKC{delta} from acting as a Src substrate, protects it from phosphorylation induced-degradation, and prevents Src from rescuing the inhibition of DNA synthesis by PKC{delta}. The antimitogenic effects of PKC{delta} lead us to speculate that its degradation may contribute to cell cycle progression.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Cell Lines.
527 cells, which are a stably transfected clone of NIH3T3 cells overexpressing an activating mutation (Y527F) of chicken Src, have been described previously (63) . 527{delta} cells overexpressing both SrcY527F and PKC{delta} were generated by stably transfecting 527 cells with pBabePuro PKC{delta}. TGR-1 cells were a generous gift from John Sedivy (29) . TGR-1 cells overexpressing human SrcY530F were generated by stable transfection with pBP human SrcY530F. TGR-1, NIH3T3, and HEK293 cells were cultured in DMEM containing 10% FCS.

Antibodies.
The principal anti-PKC{delta} used for immunoblotting was a mouse monoclonal IgG2b raised against amino acids 114–289 of human PKC{delta}, spanning the cysteine-rich repeats (Transduction Laboratories). The principal antibody used to immunoprecipitate PKC{delta} and for immunofluorescent staining was an affinity-purified rabbit polyclonal antibody raised against a peptide corresponding to amino acids 657–673, mapping within the extreme COOH terminus of rat PKC{delta}. Similar antibodies raised to the COOH-termini of PKC{alpha} and PKC{epsilon} were also used (Santa Cruz Biotechnology). Another anti-PKC{delta} antibody also used for immunoprecipitation was a rabbit polyclonal antibody raised against a GST fusion of amino acids 1–302 of rat PKC{delta} (Zymed). Antiphosphotyrosine mouse monoclonal (IgG2bk) 4G10 and avian Src-specific monoclonal antibody EC10 were from Upstate Biotechnology, and anti-BrdUrd mouse monoclonal was from Boehringer Mannheim.

Plasmids.
Rat PKC{alpha}, PKC{delta}, and PKC{epsilon} were subcloned into pBabePuro3 for stable transfection and microinjection. Site-directed mutagenesis of PKC{delta} was performed using the Quickchange site-directed mutagenesis kit (Stratagene). The Y311F mutation was made using oligonucleotide CGAATCCCTGGAATATTCCGACAGTC and its reverse complement. The Y372F mutation was made using oligonucleotide CAAGGAAAGGTTCTTTGCAATCAAGTACC and its reverse complement. The Y565F mutation was made using oligonucleotide GGACACACCACACTTCCCGCGCTGG and its reverse complement. The Y628F mutation was made using the oligonucleotide GAAATCCCCTTCAGACTTCAGCAACTTTGACCCAGAG and its reverse complement. Mutagenesis was verified by sequencing. An Eco47III/PinA1 fragment encompassing the Y311F mutation and PinA1/NdeI fragments encompassing the Y372F, Y565F, and Y628F mutations were each subcloned back into wild-type PKC{delta}, and the inserts were sequenced to check for PCR errors.

Compounds.
Human recombinant PDGF was from Upstate Biotechnology. Proteasome inhibitor, MG132 (carbobenzoxy-L-leucyl-L-leucyl-L-leucinal), clasto-lactacystin ß-lactone, and LY294002 were from Calbiochem). PP2 was provided by Sugen Inc. Cycloheximide and PMA were from Sigma. All other reagents were of analytical grade.

Immunoprecipitation.
Cells were washed in 10 ml of ice-cold PBS (100 µM sodium vanadate) and then lysed on ice in 1 ml of RIPA [described previously (63) ] per 10-cm dish. In the case of denaturing immunoprecipitation, cells were lysed in denaturing extraction buffer [2% SDS, 20 mM Tris (pH 7.3), 1 mM PMSF, 10 mM EDTA, and 100 µM sodium orthovanadate] and then diluted 20-fold in SDS-free RIPA. After protein determination, an equal concentration of each lysate was prepared for immunoprecipitation using 5–10 µl of affinity-purified anti-PKC{delta} (Santa Cruz Biotechnology) and 20 µl of protein A/G-agarose. SDS-PAGE and immunoblotting were performed as described previously (64) .

PKC{delta} Kinase Assay.
Confluent cells on a 10-cm dish were washed with 10 ml of ice-cold PBS and then lysed on ice with 1.0 ml of ice-cold PKC{delta} lysis buffer [0.8% NP-40, 150 mM NaCl, 100 µM sodium orthovanadate, 50 mM NaF, 1 mM PMSF, and 10 µg/ml aprotinin (pH 7.4)]. DTT (1 mM) was added after the determination of protein concentration. The cell lysate was clarified by tumbling with 20 µl of pansorbin for 1 h, followed by microfugation. PKC{delta} was immunoprecipitated from 0.25 mg of lysate (or as otherwise indicated) using 10 µl of rabbit anti-PKC{delta} and 20 µl of protein A/G-agarose (Santa Cruz Biotechnology) for 16 h at 4°C. Immunoprecipitated PKC{delta} was washed three times in ice-cold PKC{delta} lysis buffer and once in minimal PKC{delta} reaction buffer [30 mM Tris (pH 7.4), 6 mM magnesium acetate, 100 µM sodium orthovanadate, 0.25 mM EGTA, and 0.4% v/v NP-40]. PKC{delta} reaction buffer was prepared by the addition of the following to minimal PKC{delta} reaction buffer: 10 mM DTT; 0.2 mg/ml phosphatidylserine (Sigma; evaporated from chloroform and resuspended by sonication); 40 µM ATP (100 µCi/ml [{gamma}-32P]ATP); and 0.2 mg/ml MBP. The reaction was initiated by the addition of 25 µl of PKC{delta} reaction buffer to each immunoprecipitate and mixing at 30°C for 10 min. The reaction was terminated by the addition of 10 µl 4x SDS-PAGE sample buffer. MBP phosphorylation was determined by 15% SDS-PAGE and autoradiography, followed by excision of the MBP band and liquid scintillation counting.

Microinjection and Immunofluorescent Staining.
Microinjection was performed with an Eppendorf Micromanipulator 5171 and Transjector 5246 using borosilicate thin wall capillaries with filament pulled on a Sutter Instrument Co. model P-97 Flaming/Brown micropipette puller. Cells were seeded at 30% confluence on coverslips, grown for 24 h, and then quiesced in 0.5% FCS and DMEM for 24 h before nuclear microinjection of the expression plasmids of interest (plasmid concentrations ranged between 40 and 200 µg/ml). After a period of 16 h to enable protein expression, cells were stimulated with 25 ng/ml PDGF in the presence of 20 µM BrdUrd for 24 h, fixed using methanol/acetone (1:1; room temperature), treated with 2 M HCl at 37°C for 15 min, and then washed twice with PBS. Cells were stained with a 1:40 dilution [in PBS (pH 7.6)] of affinity-purified rabbit anti-PKC isoform-specific antibodies (either anti-PKC{alpha}, anti-PKC{delta}, or anti-PKC{epsilon}, depending on the isoform being expressed) or EC10 anti-avian Src for 40 min, washed once in PBS, stained with a 1:40 dilution of Oregon Green-conjugated antirabbit IgG or Texas-Red-conjugated antimouse IgG (Molecular Probes), washed once in PBS, stained with a 1:10 dilution of anti-BrdUrd monoclonal antibody, washed once with PBS, stained with a 1:25 dilution of Texas Red-conjugated AffiniPure goat antimouse IgG (Jackson Immunoresearch Laboratories) in PBS containing 1 µg/ml bisbenzimide (Sigma), washed once with PBS and once with deionized water, and then mounted Biomeda Gel/Mount (MO1). In the case of probing for Src using EC10, a directly conjugated fluorescein-anti-BrdUrd was used to detect de novo DNA synthesis. A C-Imaging 640 imaging system was used to store and analyze images of cells expressing the proteins of interest and to quantitate the proportion of cells staining positive for BrdUrd incorporation into the DNA.

Transient Transfection.
HEK293 cells were transfected using 10 µl of LipofectAMINE and 0.5–10 µg of DNA/10-cm dish in Optimem over 16 h and then either lysed in RIPA for immunoprecipitation or trypsinized and replated at equal density in 6-well plates to determine PKC{delta} stability. The quantity of DNA used in each transfection is described in the figure legend.

35S Labeling of Cells and Pulse Chase.
Cells were labeled with 1–3 mCi of 35S Met/Cys (DuPont New England Nuclear) for 16 h in Cys/Met-free MEM and 10% dialyzed FCS and then either prepared for immunoprecipitation or washed in PBS and chase medium containing 1.52 mg/ml methionine, 2.4 mg/ml cysteine, and 10% FCS in DMEM. PKC{delta} was immunoprecipitated from RIPA lysate, denatured in 2% SDS, diluted 20-fold in SDS-free RIPA, reimmunoprecipitated, and then prepared for SDS-PAGE and autoradiography.

Northern Blotting.
RNA was prepared using the FastTrack 2.0 kit. Nothern blotting of PKC{delta} mRNA was performed using a 32P-labeled Eco47III/PinA1 fragment from pBP PKC{delta}.

Analysis of Results.
Microinjection results are shown as mean ± SE of at least three separate experiments. Statistical analyses were performed by Student’s t test with, P < 0.05 taken as the level of significance.


    Acknowledgments
 
We thank Jianming Wu for help with the Northern blots, John Sedivy for supplying us with the TGR-1 cells, Rich Cutler for review of the manuscript, and all members of the Courtneidge laboratory for helpful suggestions throughout the course of this work.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at SUGEN Inc., 230 East Grand Avenue, South San Francisco, CA 94080-4811. Phone: (650) 553-8300; Fax: (650) 553-8304; E-mail: sara-courtneidge{at}sugen.com Back

2 The abbreviations used are: PDGF, platelet-derived growth factor BB PKC, protein kinase C; PDGFR, PDGF receptor ß; PMA, phorbol 12-myristate 13-acetate; TPA, 12-O-tetradecanoyl-phorbol-13-acetate; PMSF, phenylmethylsulfonyl fluoride; BrdUrd, bromodeoxyuridine; MBP, myelin basic protein; RIPA, radioimmunoprecipitation assay. Back

3 R. A. Blake and S. A. Courtneidge, unpublished observations. Back

4 Unpublished observations. Back

Received for publication 2/ 4/99. Revision received 3/12/99. Accepted for publication 3/12/99.


    References
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Ralston R., Bishop J. M. The product of the protooncogene c-src is modified during the cellular response to platelet-derived growth factor. Proc. Natl. Acad. Sci. USA, 82: 7845-7849, 1985.[Abstract/Free Full Text]
  2. Kypta R. M., Goldberg Y., Ulug E. T., Courtneidge S. A. Association between the PDGF receptor and members of the src family of tyrosine kinases. Cell, 62: 481-492, 1990.[Medline]
  3. Twamley-Stein G. M., Pepperkok R., Ansorge W., Courtneidge S. A. The Src family tyrosine kinases are required for platelet-derived growth factor-mediated signal transduction in NIH 3T3 cells. Proc. Natl. Acad. Sci. USA, 90: 7696-7700, 1993.[Abstract/Free Full Text]
  4. Erpel T., Alonso G., Roche S., Courtneidge S. A. The Src SH3 domain is required for DNA synthesis induced by platelet-derived growth factor and epidermal growth factor. J. Biol. Chem., 271: 16807-16812, 1996.[Abstract/Free Full Text]
  5. Broome M. A., Hunter T. Requirement for c-Src catalytic activity and the SH3 domain in platelet-derived growth factor BB and epidermal growth factor mitogenic signaling. J. Biol. Chem., 271: 16798-16806, 1996.[Abstract/Free Full Text]
  6. Li W., Yu J. C., Michieli P., Beeler J. F., Ellmore N., Heidaran M. A., Pierce J. H. Stimulation of the platelet-derived growth factor ß receptor signaling pathway activates protein kinase C-{delta}. Mol. Cell. Biol., 14: 6727-6735, 1994.[Abstract/Free Full Text]
  7. Hansen K., Johnell M., Siegbahn A., Rorsman C., Engstrom U., Wernstedt C., Heldin C. H., Ronnstrand L. Mutation of a Src phosphorylation site in the PDGF ß-receptor leads to increased PDGF-stimulated chemotaxis but decreased mitogenesis. EMBO J., 15: 5299-5313, 1996.[Medline]
  8. McGlade J., Cheng A., Pelicci G., Pelicci P. G., Pawson T. Shc proteins are phosphorylated and regulated by the v-Src and v-Fps protein-tyrosine kinases. Proc. Natl. Acad. Sci. USA, 89: 8869-8873, 1992.[Abstract/Free Full Text]
  9. Jones D. A., Benjamin C. W. Phosphorylation of growth factor receptor binding protein-2 by pp60c-src tyrosine kinase. Arch. Biochem. Biophys., 337: 143-148, 1997.[Medline]
  10. Jayaraman T., Ondrias K., Ondriasova E., Marks A. R. Regulation of the inositol 1,4,5-trisphosphate receptor by tyrosine phosphorylation. Science (Washington DC), 272: 1492-1494, 1996.[Abstract]
  11. Otsu M., Hiles I., Gout I., Fry M. J., Ruiz-Larrea F., Panayotou G., Thompson A., Dhand R., Hsuan J., Totty N. Characterization of two 85 kd proteins that associate with receptor tyrosine kinases, middle-T/pp60c-src complexes, and PI3-kinase. Cell, 65: 91-104, 1991.[Medline]
  12. Roche S., Dhand R., Waterfield M. D., Courtneidge S. A. The catalytic subunit of phosphatidylinositol 3-kinase is a substrate for the activated platelet-derived growth factor receptor, but not for middle-T antigen-pp60c-src complexes. Biochem. J., 301: 703-711, 1994.
  13. Gallo R., Provenzano C., Carbone R., Di Fiore P. P., Castellani L., Falcone G., Alema S. Regulation of the tyrosine kinase substrate Eps8 expression by growth factors, v-Src and terminal differentiation. Oncogene, 15: 1929-1936, 1997.[Medline]
  14. Gschwendt M., Kielbassa K., Kittstein W., Marks F. Tyrosine phosphorylation and stimulation of protein kinase C {delta} from porcine spleen by src in vitro Dependence on the activated state of protein kinase C {delta}. FEBS Lett., 347: 85-89, 1994.[Medline]
  15. Li W., Mischak H., Yu J. C., Wang L. M., Mushinski J. F., Heidaran M. A., Pierce J. H. Tyrosine phosphorylation of protein kinase C-{delta} in response to its activation. J. Biol. Chem., 269: 2349-2352, 1994.[Abstract/Free Full Text]
  16. Haleem-Smith H., Chang E. Y., Szallasi Z., Blumberg P. M., Rivera J. Tyrosine phosphorylation of protein kinase C-{delta} in response to the activation of the high-affinity receptor for immunoglobulin E modifies its substrate recognition. Proc. Natl. Acad. Sci. USA, 92: 9112-9116, 1995.[Abstract/Free Full Text]
  17. Denning M. F., Dlugosz A. A., Howett M. K., Yuspa S. H. Expression of an oncogenic rasHa gene in murine keratinocytes induces tyrosine phosphorylation and reduced activity of protein kinase C {delta}. J. Biol. Chem., 268: 26079-26081, 1993.[Abstract/Free Full Text]
  18. Zang Q., Lu Z., Curto M., Barile N., Shalloway D., Foster D. A. Association between v-Src and protein kinase C {delta} in v-Src-transformed fibroblasts. J. Biol. Chem., 272: 13275-13280, 1997.[Abstract/Free Full Text]
  19. Leng L., Du B., Consigli S., McCaffrey T. A. Translocation of protein kinase C-{delta} by PDGF in cultured vascular smooth muscle cells: inhibition by TGF-ß 1. Artery, 22: 140-154, 1996.[Medline]
  20. Olivier A. R., Parker P. J. Bombesin, platelet-derived growth factor, and diacylglycerol induce selective membrane association and down-regulation of protein kinase C isotypes in Swiss 3T3 cells. J. Biol. Chem., 269: 2758-2763, 1994.[Abstract/Free Full Text]
  21. Li W., Michieli P., Alimandi M., Lorenzi M. V., Wu Y., Wang L. H., Heidaran M. A., Pierce J. H. Expression of an ATP binding mutant of PKC-{delta} inhibits Sis-induced transformation of NIH3T3 cells. Oncogene, 13: 731-737, 1996.[Medline]
  22. Watanabe T., Ono Y., Taniyama Y., Hazama K., Igarashi K., Ogita K., Kikkawa U., Nishizuka Y. Cell division arrest induced by phorbol ester in CHO cells overexpressing protein kinase C-{delta} subspecies. Proc. Natl. Acad. Sci. USA, 89: 10159-10163, 1992.[Abstract/Free Full Text]
  23. Mischak H., Goodnight J. A., Kolch W., Martiny-Baron G., Schaechtle C., Kazanietz M. G., Blumberg P. M., Pierce J. H., Mushinski J. F. Overexpression of protein kinase C-{delta} and -{epsilon} in NIH 3T3 cells induces opposite effects on growth, morphology, anchorage dependence, and tumorigenicity. J. Biol. Chem., 268: 6090-6096, 1993.[Abstract/Free Full Text]
  24. Mishima K., Ohno S., Shitara N., Yamaoka K., Suzuki K. Opposite effects of the overexpression of protein kinase C {gamma} and {delta} on the growth properties of human glioma cell line U251 MG. Biochem. Biophys. Res. Commun., 201: 363-372, 1994.[Medline]
  25. Stabel S., Rodriguez-Pena A., Young S., Rozengurt E., Parker P. J. Quantitation of protein kinase C by immunoblot: expression in different cell lines and response to phorbol esters. J. Cell. Physiol., 130: 111-117, 1987.[Medline]
  26. Young S., Parker P. J., Ullrich A., Stabel S. Down-regulation of protein kinase C is due to an increased rate of degradation. Biochem. J., 244: 775-779, 1987.[Medline]
  27. Chen C. C. Protein kinase C {alpha}, {delta}, {epsilon} and {zeta} in C6 glioma cells. TPA induces translocation and down-regulation of conventional and new PKC isoforms but not atypical PKC {zeta}. FEBS Lett., 332: 169-173, 1993.[Medline]
  28. Chen C. C., Cheng C. S., Chang J., Huang H. C. Differential correlation between translocation and down-regulation of conventional and new protein kinase C isozymes in C6 glioma cells. J. Neurochem., 64: 818-824, 1995.[Medline]
  29. Prouty S. M., Hanson K. D., Boyle A. L., Brown J. R., Shichiri M., Follansbee M. R., Kang W., Sedivy J. M. A cell culture model system for genetic analyses of the cell cycle by targeted homologous recombination. Oncogene, 8: 899-907, 1993.[Medline]
  30. Hochstrasser M. Ubiquitin, proteasomes, and the regulation of intracellular protein degradation. Curr. Opin. Cell Biol., 7: 215-223, 1995.[Medline]
  31. Murakami Y., Matsufuji S., Kameji T., Hayashi S., Igarashi K., Tamura T., Tanaka K., Ichihara A. Ornithine decarboxylase is degraded by the 26S proteasome without ubiquitination. Nature (Lond.), 360: 597-599, 1992.[Medline]
  32. Yu C. L., Burakoff S. J. Involvement of proteasomes in regulating Jak-STAT pathways upon interleukin-2 stimulation. J. Biol. Chem., 272: 14017-14020, 1997.[Abstract/Free Full Text]
  33. Dick L. R., Cruikshank A. A., Destree A. T., Grenier L., McCormack T. A., Melandri F. D., Nunes S. L., Palombella V. J., Parent L. A., Plamondon L., Stein R. L. Mechanistic studies on the inactivation of the proteasome by lactacystin in cultured cells. J. Biol. Chem., 272: 182-188, 1997.[Abstract/Free Full Text]
  34. Lee H. W., Smith L., Pettit G. R., Vinitsky A., Smith J. B. Ubiquitination of protein kinase C-{alpha} and degradation by the proteasome. J. Biol. Chem., 271: 20973-20976, 1996.[Abstract/Free Full Text]
  35. Wiertz E. J., Jones T. R., Sun L., Bogyo M., Geuze H. J., Ploegh H. L. The human cytomegalovirus US11 gene product dislocates MHC class I heavy chains from the endoplasmic reticulum to the cytosol. Cell, 84: 769-779, 1996.[Medline]
  36. Griscavage J. M., Wilk S., Ignarro L. J. Inhibitors of the proteasome pathway interfere with induction of nitric oxide synthase in macrophages by blocking activation of transcription factor NF-{kappa} B. Proc. Natl. Acad. Sci. USA, 93: 3308-3312, 1996.[Abstract/Free Full Text]
  37. Hanke J. H., Gardner J. P., Dow R. L., Changelian P. S., Brissette W. H., Weringer E. J., Pollok B. A., Connelly P. A. Discovery of a novel, potent, and Src family-selective tyrosine kinase inhibitor. Study of Lck- and FynT-dependent T cell activation. J. Biol. Chem., 271: 695-701, 1996.[Abstract/Free Full Text]
  38. Szallasi Z., Denning M. F., Chang E. Y., Rivera J., Yuspa S. H., Lehel C., Olah Z., Anderson W. B., Blumberg P. M. Development of a rapid approach to identification of tyrosine phosphorylation sites: application to PKC {delta} phosphorylated upon activation of the high affinity receptor for IgE in rat basophilic leukemia cells. Biochem. Biophys. Res. Commun., 214: 888-894, 1995.[Medline]
  39. Li W., Chen X. H., Kelley C. A., Alimandi M., Zhang J., Chen Q., Bottaro D. P., Pierce J. H. Identification of tyrosine 187 as a protein kinase C-{delta} phosphorylation site. J. Biol. Chem., 271: 26404-26409, 1996.[Abstract/Free Full Text]
  40. Konishi H., Tanaka M., Takemura Y., Matsuzaki H., Ono Y., Kikkawa U., Nishizuka Y. Activation of protein kinase C by tyrosine phosphorylation in response to H2O2. Proc. Natl. Acad. Sci. USA, 94: 11233-11237, 1997.[Abstract/Free Full Text]
  41. Kemp B. E., Pearson R. B. Design and use of peptide substrates for protein kinases. Methods Enzymol., 200: 121-134, 1991.[Medline]
  42. Songyang Z., Carraway K. L. R., Eck M. J., Harrison S. C., Feldman R. A., Mohammadi M., Schlessinger J., Hubbard S. R., Smith D. P., Eng C., Lorenzo M. J., Ponder B. A. J., Mayer B. J., Cantley L. C. Catalytic specificity of protein-tyrosine kinases is critical for selective signalling. Nature (Lond.), 373: 536-539, 1995.[Medline]
  43. Soltoff S. P., Toker A. Carbachol, substance P, and phorbol ester promote the tyrosine phosphorylation of protein kinase C {delta} in salivary gland epithelial cells. J. Biol. Chem., 270: 13490-13495, 1995.[Abstract/Free Full Text]
  44. Lu Z., Hornia A., Jiang Y. W., Zang Q., Ohno S., Foster D. A. Tumor promotion by depleting cells of protein kinase C {delta}. Mol. Cell. Biol., 17: 3418-3428, 1997.[Abstract]
  45. Garcia-Paramio P., Cabrerizo Y., Bornancin F., Parker P. J. The broad specificity of dominant inhibitory protein kinase C mutants infers a common step in phosphorylation. Biochem. J., 333: 631-636, 1998.
  46. Olivier A. R., Hansra G., Pettitt T. R., Wakelam M. J., Parker P. J. The co-mitogenic combination of transforming growth factor ß 1 and bombesin protects protein kinase C-{delta} from late-phase down-regulation, despite synergy in diacylglycerol accumulation. Biochem. J., 318: 519-525, 1996.
  47. Shih N. Y., Floyd-Smith G. Protein kinase C-{delta} mRNA is down-regulated transcriptionally and post-transcriptionally by 12-O-tetradecanoylphorbol-13-acetate. J. Biol. Chem., 271: 16040-16046, 1996.[Abstract/Free Full Text]
  48. Lu Z., Liu D., Hornia A., Devonish W., Pagano M., Foster D. A. Activation of protein kinase C triggers its ubiquitination and degradation. Mol. Cell. Biol., 18: 839-845, 1998.[Abstract/Free Full Text]
  49. Cohen G. M. Caspases: the executioners of apoptosis. Biochem. J., 326: 1-16, 1997.
  50. Lewis L. A., Chung C. D., Chen J., Parnes J. R., Moran M., Patel V. P., Miceli M. C. The Lck SH2 phosphotyrosine binding site is critical for efficient TCR-induced processive tyrosine phosphorylation of the {zeta}-chain and IL-2 production. J. Immunol., 159: 2292-2300, 1997.[Abstract/Free Full Text]
  51. Mayer B. J., Hirai H., Sakai R. Evidence that SH2 domains promote processive phosphorylation by protein-tyrosine kinases. Curr. Biol., 5: 296-305, 1995.[Medline]
  52. Songyang Z., Shoelson S. E., Chaudhuri M., Gish G., Pawson T., Haser W. G., King F., Roberts T., Ratnofsky S., Lechleider R. J. SH2 domains recognize specific phosphopeptide sequences. Cell, 72: 767-778, 1993.[Medline]
  53. Le Good J. A., Ziegler W. H., Parekh D. B., Alessi D. R., Cohen P., Parker P. J. Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science (Washington DC), 281: 2042-2045, 1998.[Abstract/Free Full Text]
  54. Cazaubon S. M., Parker P. J. Identification of the phosphorylated region responsible for the permissive activation of protein kinase C. J. Biol. Chem., 268: 17559-17563, 1993.[Abstract/Free Full Text]
  55. Cazaubon S., Bornancin F., Parker P. J. Threonine-497 is a critical site for permissive activation of protein kinase C {alpha}. Biochem. J., 301: 443-448, 1994.
  56. Bornancin F., Parker P. J. Phosphorylation of protein kinase C-{alpha} on serine 657 controls the accumulation of active enzyme and contributes to its phosphatase-resistant state. J. Biol. Chem., 272: 3544-3549, 1997.[Abstract/Free Full Text]
  57. Herget T., Oehrlein S. A., Pappin D. J., Rozengurt E., Parker P. J. The myristoylated alanine-rich C-kinase substrate (MARCKS) is sequentially phosphorylated by conventional, novel and atypical isotypes of protein kinase C. Eur. J. Biochem., 233: 448-457, 1995.[Medline]
  58. Owen P. J., Johnson G. D., Lord J. M. Protein kinase C-{delta} associates with vimentin intermediate filaments in differentiated HL60 cells. Exp. Cell Res., 225: 366-373, 1996.[Medline]
  59. Kielbassa K., Muller H. J., Meyer H. E., Marks F., Gschwendt M. Protein kinase C {delta}-specific phosphorylation of the elongation factor eEF-{alpha} and an eEF-1 {alpha} peptide at threonine 431. J. Biol. Chem., 270: 6156-6162, 1995.[Abstract/Free Full Text]
  60. Garrone B., Kedar P., Elarova I., Lavin M., Watters D. Approaches to determine the specific role of the {delta} isoform of protein kinase C. J. Biochem. Biophys. Methods, 36: 51-61, 1997.[Medline]
  61. Murray J. W., Edmonds B. T., Liu G., Condeelis J. Bundling of actin filaments by elongation factor 1 {alpha} inhibits polymerization at filament ends. J. Cell Biol., 135: 1309-1321, 1996.[Abstract/Free Full Text]
  62. Shiina N., Gotoh Y., Kubomura N., Iwamatsu A., Nishida E. Microtubule severing by elongation factor 1 {alpha}. Science (Washington DC), 266: 282-285, 1994.[Abstract/Free Full Text]
  63. Fumagalli S., Totty N. F., Hsuan J. J., Courtneidge S. A. A target for Src in mitosis. Nature (Lond.), 368: 871-874, 1994.[Medline]
  64. Blake R. A., Schieven G. L., Watson S. P. Collagen stimulates tyrosine phosphorylation of phospholipase C-{gamma} 2 but not phospholipase C-{gamma} 1 in human platelets. FEBS Lett., 353: 212-216, 1994.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
S. Van Schaeybroeck, D. M. Kelly, J. Kyula, S. Stokesberry, D. A. Fennell, P. G. Johnston, and D. B. Longley
Src and ADAM-17-Mediated Shedding of Transforming Growth Factor-{alpha} Is a Mechanism of Acute Resistance to TRAIL
Cancer Res., October 15, 2008; 68(20): 8312 - 8321.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H. Nakashima, G. D. Frank, H. Shirai, A. Hinoki, S. Higuchi, H. Ohtsu, K. Eguchi, A. Sanjay, M. E. Reyland, P. J. Dempsey, et al.
Novel Role of Protein Kinase C-{delta} Tyr311 Phosphorylation in Vascular Smooth Muscle Cell Hypertrophy by Angiotensin II
Hypertension, February 1, 2008; 51(2): 232 - 238.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
M. Morita, H. Matsuzaki, T. Yamamoto, Y. Fukami, and U. Kikkawa
Epidermal Growth Factor Receptor Phosphorylates Protein Kinase C {delta} at Tyr332 to form a Trimeric Complex with p66Shc in the H2O2-stimulated Cells
J. Biochem., January 1, 2008; 143(1): 31 - 38.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Cao, K. Yu, C. Banh, V. Nguyen, A. Ritz, B. J. Raphael, Y. Kawakami, T. Kawakami, and A. R. Salomon
Quantitative Time-Resolved Phosphoproteomic Analysis of Mast Cell Signaling
J. Immunol., November 1, 2007; 179(9): 5864 - 5876.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kaul, V. Anantharam, Y. Yang, C. J. Choi, A. Kanthasamy, and A. G. Kanthasamy
Tyrosine Phosphorylation Regulates the Proteolytic Activation of Protein Kinase C{delta} in Dopaminergic Neuronal Cells
J. Biol. Chem., August 5, 2005; 280(31): 28721 - 28730.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Murugappan, H. Shankar, S. Bhamidipati, R. T. Dorsam, J. Jin, and S. P. Kunapuli
Molecular mechanism and functional implications of thrombin-mediated tyrosine phosphorylation of PKC{delta} in platelets
Blood, July 15, 2005; 106(2): 550 - 557.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Wheaton and K. Riabowol
Protein Kinase C{delta} Blocks Immediate-Early Gene Expression in Senescent Cells by Inactivating Serum Response Factor
Mol. Cell. Biol., August 15, 2004; 24(16): 7298 - 7311.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
B. Li, X. Wang, N. Rasheed, Y. Hu, S. Boast, T. Ishii, K. Nakayama, K. I. Nakayama, and S. P. Goff
Distinct roles of c-Abl and Atm in oxidative stress response are mediated by protein kinase C {delta}
Genes & Dev., August 1, 2004; 18(15): 1824 - 1837.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. O. Rybin, J. Guo, A. Sabri, H. Elouardighi, E. Schaefer, and S. F. Steinberg
Stimulus-specific Differences in Protein Kinase C{delta} Localization and Activation Mechanisms in Cardiomyocytes
J. Biol. Chem., April 30, 2004; 279(18): 19350 - 19361.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. N. Wrobel, J. Debnath, E. Lin, S. Beausoleil, M. F. Roussel, and J. S. Brugge
Autocrine CSF-1R activation promotes Src-dependent disruption of mammary epithelial architecture
J. Cell Biol., April 26, 2004; 165(2): 263 - 273.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
D. N. JACKSON and D. A. FOSTER
The enigmatic protein kinase C{delta}: complex roles in cell proliferation and survival
FASEB J, April 1, 2004; 18(6): 627 - 636.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kajimoto, Y. Shirai, N. Sakai, T. Yamamoto, H. Matsuzaki, U. Kikkawa, and N. Saito
Ceramide-induced Apoptosis by Translocation, Phosphorylation, and Activation of Protein Kinase C{delta} in the Golgi Complex
J. Biol. Chem., March 26, 2004; 279(13): 12668 - 12676.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Sumitomo, T. Asano, J. Asakuma, T. Asano, D. M. Nanus, and M. Hayakawa
Chemosensitization of Androgen-Independent Prostate Cancer with Neutral Endopeptidase
Clin. Cancer Res., January 1, 2004; 10(1): 260 - 266.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. A. Tapia, L. J. Garcia-Marin, and R. T. Jensen
Cholecystokinin-stimulated Protein Kinase C-{delta} Kinase Activation, Tyrosine Phosphorylation, and Translocation Are Mediated by Src Tyrosine Kinases in Pancreatic Acinar Cells
J. Biol. Chem., September 12, 2003; 278(37): 35220 - 35230.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Yamaura, T. Turoczi, F. Yamamoto, M. A. Q. Siddqui, N. Maulik, and D. K. Das
STAT signaling in ischemic heart: a role of STAT5A in ischemic preconditioning
Am J Physiol Heart Circ Physiol, July 11, 2003; 285(2): H476 - H482.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Crosby and A. W. Poole
Physical and Functional Interaction between Protein Kinase C {delta} and Fyn Tyrosine Kinase in Human Platelets
J. Biol. Chem., June 27, 2003; 278(27): 24533 - 24541.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
X.-L. Tang, E. Kodani, H. Takano, M. Hill, K. Shinmura, T. M. Vondriska, P. Ping, and R. Bolli
Protein tyrosine kinase signaling is necessary for NO donor-induced late preconditioning against myocardial stunning
Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1441 - H1448.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Bao, G. Gur, and Y. Yarden
Src promotes destruction of c-Cbl: Implications for oncogenic synergy between Src and growth factor receptors
PNAS, March 4, 2003; 100(5): 2438 - 2443.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
I. Junttila, R. P. Bourette, L. R. Rohrschneider, and O. Silvennoinen
M-CSF induced differentiation of myeloid precursor cells involves activation of PKC-{delta} and expression of Pkare
J. Leukoc. Biol., February 1, 2003; 73(2): 281 - 288.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Shibukawa, M. Takahashi, I. Laffont, K. Honke, and N. Taniguchi
Down-regulation of Hydrogen Peroxide-induced PKCdelta Activation in N-Acetylglucosaminyltransferase III-transfected HeLaS3 Cells
J. Biol. Chem., January 24, 2003; 278(5): 3197 - 3203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Joseloff, C. Cataisson, H. Aamodt, H. Ocheni, P. Blumberg, A. J. Kraker, and S. H. Yuspa
Src Family Kinases Phosphorylate Protein Kinase C delta on Tyrosine Residues and Modify the Neoplastic Phenotype of Skin Keratinocytes
J. Biol. Chem., March 29, 2002; 277(14): 12318 - 12323.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Blass, I. Kronfeld, G. Kazimirsky, P. M. Blumberg, and C. Brodie
Tyrosine Phosphorylation of Protein Kinase C{delta} Is Essential for Its Apoptotic Effect in Response to Etoposide
Mol. Cell. Biol., January 1, 2002; 22(1): 182 - 195.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. W. Wooten, M. L. Vandenplas, M. L. Seibenhener, T. Geetha, and M. T. Diaz-Meco
Nerve Growth Factor Stimulates Multisite Tyrosine Phosphorylation and Activation of the Atypical Protein Kinase C's via a src Kinase Pathway
Mol. Cell. Biol., December 15, 2001; 21(24): 8414 - 8427.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Wakino, U. Kintscher, Z. Liu, S. Kim, F. Yin, M. Ohba, T. Kuroki, A. H. Schonthal, W. A. Hsueh, and R. E. Law
Peroxisome Proliferator-activated Receptor gamma Ligands Inhibit Mitogenic Induction of p21Cip1 by Modulating the Protein Kinase Cdelta Pathway in Vascular Smooth Muscle Cells
J. Biol. Chem., December 7, 2001; 276(50): 47650 - 47657.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Saito, J. Haendeler, Y. Hojo, K. Yamamoto, and B. C. Berk
Receptor Heterodimerization: Essential Mechanism for Platelet-Derived Growth Factor-Induced Epidermal Growth Factor Receptor Transactivation
Mol. Cell. Biol., October 1, 2001; 21(19): 6387 - 6394.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Hattori, H. Otani, T. Uchiyama, H. Imamura, J. Cui, N. Maulik, G. A. Cordis, L. Zhu, and D. K. Das
Src tyrosine kinase is the trigger but not the mediator of ischemic preconditioning
Am J Physiol Heart Circ Physiol, September 1, 2001; 281(3): H1066 - H1074.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
C. M. Boney, H. Sekimoto, P. A. Gruppuso, and A. R. Frackelton Jr.
Src Family Tyrosine Kinases Participate in Insulin-like Growth Factor I Mitogenic Signaling in 3T3-L1 Cells
Cell Growth Differ., July 1, 2001; 12(7): 379 - 386.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Benes and S. P. Soltoff
Modulation of PKC{delta} tyrosine phosphorylation and activity in salivary and PC-12 cells by Src kinases
Am J Physiol Cell Physiol, June 1, 2001; 280(6): C1498 - C1510.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Konishi, E. Yamauchi, H. Taniguchi, T. Yamamoto, H. Matsuzaki, Y. Takemura, K. Ohmae, U. Kikkawa, and Y. Nishizuka
Phosphorylation sites of protein kinase C delta in H2O2-treated cells and its activation by tyrosine kinase invitro
PNAS, May 24, 2001; (2001) 111158798.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
M. Zhong, Z. Lu, T. Abbas, A. Hornia, K. Chatakondu, N. Barile, P. Kaplan, and D. A. Foster
Novel Tumor-promoting Property of Tamoxifen
Cell Growth Differ., April 1, 2001; 12(4): 187 - 192.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
R. A. Blake, M. A. Broome, X. Liu, J. Wu, M. Gishizky, L. Sun, and S. A. Courtneidge
SU6656, a Selective Src Family Kinase Inhibitor, Used To Probe Growth Factor Signaling
Mol. Cell. Biol., December 1, 2000; 20(23): 9018 - 9027.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Sumitomo, R. Shen, J. S. Goldberg, J. Dai, D. Navarro, and D. M. Nanus
Neutral Endopeptidase Promotes Phorbol Ester-induced Apoptosis in Prostate Cancer Cells by Inhibiting Neuropeptide-induced Protein Kinase C {{delta}} Degradation
Cancer Res., December 1, 2000; 60(23): 6590 - 6596.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. A. Otieno and T. W. Kensler
A Role for Protein Kinase C-{{delta}} in the Regulation of Ornithine Decarboxylase Expression by Oxidative Stress
Cancer Res., August 1, 2000; 60(16): 4391 - 4396.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
A. Hornia, Z. Lu, T. Sukezane, M. Zhong, T. Joseph, P. Frankel, and D. A. Foster
Antagonistic Effects of Protein Kinase C alpha and delta on Both Transformation and Phospholipase D Activity Mediated by the Epidermal Growth Factor Receptor
Mol. Cell. Biol., November 1, 1999; 19(11): 7672 - 7680.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Bahr, A. Rohwer, L. Stempka, G. Rincke, F. Marks, and M. Gschwendt
DIK, a Novel Protein Kinase That Interacts with Protein Kinase Cdelta . CLONING, CHARACTERIZATION, AND GENE ANALYSIS
J. Biol. Chem., November 10, 2000; 275(46): 36350 - 36357.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Kronfeld, G. Kazimirsky, P. S. Lorenzo, S. H. Garfield, P. M. Blumberg, and C. Brodie
Phosphorylation of Protein Kinase Cdelta on Distinct Tyrosine Residues Regulates Specific Cellular Functions
J. Biol. Chem., November 3, 2000; 275(45): 35491 - 35498.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Pepio and W. S. Sossin
Membrane Translocation of Novel Protein Kinase Cs Is Regulated by Phosphorylation of the C2 Domain
J. Biol. Chem., February 2, 2001; 276(6): 3846 - 3855.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. P. Soltoff
Rottlerin Is a Mitochondrial Uncoupler That Decreases Cellular ATP Levels and Indirectly Blocks Protein Kinase Cdelta Tyrosine Phosphorylation
J. Biol. Chem., October 5, 2001; 276(41): 37986 - 37992.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Konishi, E. Yamauchi, H. Taniguchi, T. Yamamoto, H. Matsuzaki, Y. Takemura, K. Ohmae, U. Kikkawa, and Y. Nishizuka
Phosphorylation sites of protein kinase C delta in H2O2-treated cells and its activation by tyrosine kinase invitro
PNAS, June 5, 2001; 98(12): 6587 - 6592.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blake, R. A.
Right arrow Articles by Courtneidge, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blake, R. A.
Right arrow Articles by Courtneidge, S. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation