CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brodie, C.
Right arrow Articles by Blumberg, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brodie, C.
Right arrow Articles by Blumberg, P. M.
Cell Growth & Differentiation Vol. 10, 183-191, March 1999
© 1999 American Association for Cancer Research

Protein Kinase C-{epsilon} Plays a Role in Neurite Outgrowth in Response to Epidermal Growth Factor and Nerve Growth Factor in PC12 Cells

Chaya Brodie, Krisztina Bogi, Peter Acs, Philip Lazarovici, Gyorgy Petrovics, Wayne B. Anderson and Peter M. Blumberg1

Molecular Mechanisms of Tumor Promotion Section, LCCTP [C. B., K. B., P. A., P. M. B.] and Signal Transduction Section, LCO [G. P., W. B. A.], National Cancer Institute, NIH, Bethesda, Maryland 20892, and Gonda-Goldschmied Center, Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan 52900, Israel [C. B., P. L.]


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
In this study, we examined the role of specific protein kinase C (PKC) isoforms in the differentiation of PC12 cells in response to nerve growth factor (NGF) and epidermal growth factor (EGF). PC12 cells express PKC-{alpha}, -ß, -{gamma}, -{delta}, -{epsilon}, -µ, and -{zeta}. For PKC-{delta}, -{epsilon}, and -{zeta}, NGF and EGF exerted differential effects on translocation. Unlike overexpression of PKC-{alpha} and -{delta}, overexpression of PKC-{epsilon} caused enhanced neurite outgrowth in response to NGF. In the PKC-{epsilon}-overexpressing cells, EGF also dramatically induced neurite outgrowth, arrested cell proliferation, and induced a sustained phosphorylation of mitogen-activated protein kinase (MAPK), in contrast to its mitogenic effects on control cells or cells overexpressing PKC-{alpha} and -{delta}. The induction of neurite outgrowth by EGF was inhibited by the MAPK kinase inhibitor PD95098. In cells overexpressing a PKC-{epsilon} dominant negative mutant, NGF induced reduced neurite outgrowth and a more transient phosphorylation of MAPK than in controls. Our results suggest an important role for PKC-{epsilon} in neurite outgrowth in PC12 cells, probably via activation of the MAPK pathway.


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The rat pheochromocytoma cell line PC12 has been extensively used as a model system for studying mechanisms involved in neuronal cell differentiation (1) . In response to NGF,2 PC12 cells cease division and differentiate into sympathetic neuron-like cells with extensive neurites (2) . PC12 cells also express receptors for growth factors such as fibroblast growth factor and EGF. Despite similarities in the tyrosine phosphorylation of different substrates, NGF and EGF induce markedly different effects on PC12 cells, with EGF inducing cell proliferation rather than differentiation (3) . Binding of NGF and EGF to their respective receptors induces receptor autophosphorylation and activation of overlapping second messenger pathways (4 , 5) . The basis for the distinct cellular outcomes induced by NGF and EGF is not fully understood (6) . One major difference between NGF and EGF is the more prolonged activation in response to NGF of different kinases such as MAPK (7 , 8) and phosphatidylinositol 3'-kinase (9) . In addition, certain proteins such as SNT have been shown to be phosphorylated specifically in response to NGF but not to EGF and have therefore been implicated in the ability of NGF to induce neuronal differentiation (10) . Although NGF activates PKC in PC12 cells (11 , 12) , and PKC has been implicated in PC12 cell differentiation (13 , 14) , it is currently not known whether NGF and EGF differ in their effects on PKC activity.

PKC is a family of phospholipid-dependent serine-threonine kinases involved in the signal transduction of many physiological stimuli (15) . PKC is activated by DAG, a second messenger that is generated directly when phospholipase C is activated by extracellular stimuli including hormones and growth factors or indirectly via phosphatidic acid formation by phospholipase D (16 , 17) . PKC is also the receptor for the potent tumor-promoting phorbol esters, which can substitute for DAG in PKC activation (18) . PKC plays a prominent role in the regulation of cell proliferation and differentiation (19) . Eleven isoforms of PKC have been isolated thus far, showing characteristic patterns of distribution in different tissues (20) . The unique expression of specific PKC isoforms in different tissues and cells suggests that different isoforms fulfill distinct functions, and numerous studies are beginning to dissect these isoform-specific roles in different systems. The PKC isoforms are divided into three main groups based on sequence homology and similarity in biochemical properties. The conventional PKCs ({alpha}, ß1, ß2, and {gamma}) are Ca2+-dependent and are regulated by DAG and phorbol esters. The novel PKCs ({delta}, {epsilon}, {nu}, and {theta}) are Ca2+-independent but show similar responses to DAG and phorbol esters. In contrast, the atypical PKCs ({zeta} and {lambda}/{iota}) are insensitive to Ca2+, DAG, and phorbol esters. Finally, PKC-µ shows multiple differences relative to the other PKCs (21) .

In this study, we compared the effects of NGF and EGF on the activation of specific PKC isoforms to determine whether differential activation of specific PKC isoforms might contribute to the differences in the effects of these two growth factors on neurite outgrowth. Our data indicate that PKC-{delta}, -{epsilon}, and -{zeta} are differentially translocated by NGF and EGF treatments. We further show that EGF induces neurite outgrowth, as contrasted with proliferation, in cells overexpressing PKC-{epsilon}.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Differential Translocation of PKC Isoforms by NGF and EGF in PC12 Cells.
We first analyzed the expression and cellular distribution of PKC isoforms in the PC12 cells used in our study and their responses to NGF and EGF treatment. Fig. 1Citation shows that these PC12 cells express PKC-{alpha}, -ß, -{gamma}, -{delta}, -{epsilon}, -µ, and -{zeta} as determined by Western blot analysis using specific PKC isoform antibodies. Treatment of the cells with NGF for 15 min induced a partial translocation of PKC-{alpha} and -{gamma} to the membrane, the translocation of PKC-{epsilon} to the membrane and the cytoskeleton, and the translocation of PKC-{zeta} to the cytosol and the nucleus (data not shown). The effect of EGF on PKC-{alpha} and -{gamma} was similar to that of NGF. On the other hand, EGF induced only a partial translocation of PKC-{epsilon} to the membrane and did not affect the translocation of PKC-{zeta}. EGF also induced the translocation of PKC-{delta} to the membrane, whereas NGF exerted a smaller effect.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 1. Expression and translocation of PKC isoforms in NGF- and EGF-treated PC12 cells. Aliquots of soluble (S), membrane (M), and cytoskeletal (C) fractions of PC12 cells untreated or treated with NGF or EGF for 15 min were subjected to SDS-PAGE and immunoblotted as described in "Materials and Methods." Blots were probed with antibodies specific to the appropriate PKC isoforms, as indicated in the figure. The results shown are from one of four representative experiments.

 
Overexpression of PKC Isoforms.
Because major differences were observed in the translocation of PKC-{delta} and -{epsilon} by NGF and EGF, we wanted to further examine the possible role of these isoforms in mediating the biological effects of NGF and EGF. Our approach was to use PC12 cells overexpressing PKC-{delta} or -{epsilon}; for comparison, we also included PC12 cells overexpressing PKC-{alpha}.

Using the {epsilon}MTH vector, we transfected PC12 cells with PKC-{alpha}, -{delta}, and -{epsilon}. To examine the level of protein expression, we analyzed the pooled cultures and three different overexpressing clones for each of the isoforms by Western blotting and compared them with the vector controls. Fig. 2Citation illustrates a representative Western blot of PC12 cells overexpressing the different PKC isoforms and the vector control. The levels of the overexpressed PKC-{alpha}, -{delta}, and -{epsilon} in the transfected cells were 7–10-fold higher than the corresponding endogenous PKCs, as determined using isoform-specific antibodies (Fig. 2)Citation . To establish that the overexpressed PKC isoforms were functionally active, we measured specific [3H]PDBu binding on partially purified cell lysates. All PKC clones exhibited increased [3H]PDBu binding as compared to the control transfected cells (Table 1)Citation . Moreover, binding was further enhanced in cells treated for 24 h with 20 µM ZnCl2, an inducer of the metallothionein expression vector (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Overexpression of PKC isoforms in PC12 cells. Stable transfectants of PC12 cells overexpressing the different PKC isoforms or the control vector were harvested and subjected to SDS-PAGE and Western blot analysis. The membranes were probed with specific anti-PKC-{alpha}, -{delta}, or -{epsilon} antibodies. The immunoreactive bands were visualized as described in "Materials and Methods." The results shown are of one representative experiment of pooled clones; similar results were obtained in each of five additional experiments that were performed with three different clones.

 

View this table:
[in this window]
[in a new window]
 
Table 1 [3H]PDBu binding of cells overexpressing different PKC isoforms

 
Morphology and Proliferation of PC12 Cells Overexpressing Different PKC Isoforms in Response to EGF and NGF.
The morphology of the PC12 cells overexpressing PKC-{alpha} or -{delta} was similar to the empty vector control cells and the parental PC12 line (data not shown). Likewise, the proliferation of these cells was not significantly different (Fig. 3)Citation . In contrast, cells overexpressing PKC-{epsilon} showed slower cell growth compared to the empty vector control cells (Fig. 3)Citation , and some of these cells extended small processes (Fig. 4D)Citation . NGF induced neurite outgrowth in all of the PKC-overexpressing cell lines. However, the degree of neurite outgrowth, as reflected by their length and by the number of cells extending neurites, was significantly higher in cells overexpressing PKC-{epsilon} compared to the empty vector control cells or to the other PKC overexpresser cell lines (Fig. 4Citation ; Table 2Citation ). Treatment of empty vector control cells or cells overexpressing PKC-{alpha} or -{delta} with EGF did not induce significant changes in the morphology of the cells. As determined by BrdUrd incorporation, treatment of the cells with EGF for 4 days increased cell proliferation by 56 ± 7.1% (P < 0.005) in vector control cells, by 46 ± 6.2% (P < 0.002) in cells overexpressing PKC-{alpha}, and by 97 ± 9.2% (P < 0.01) in cells overexpressing PKC-{delta}, whereas it exerted a small inhibitory effect (35 ± 2.4%; P < 0.001) on the proliferation of cells overexpressing PKC-{epsilon} (Fig. 3)Citation . Similar results were obtained in parallel experiments in which cells were counted (data not shown). Likewise, similar results were obtained with an incubation time of 6 days (data not shown). Unlike the results obtained with the other PKC isoform-overexpressing cells, the cells overexpressing PKC-{epsilon} showed a striking difference in their morphological response to EGF. In these cells, EGF induced marked neurite outgrowth (Fig. 4F)Citation . The kinetics of neurite outgrowth in EGF-treated cells was similar to that of the NGF-treated cells. However, neurites of the EGF-treated cells were less arborized than those seen in NGF-treated cells, and fewer cells with multiple neurites (more than three) were observed.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3. Proliferation of PC12 cells overexpressing PKC-{alpha}, -{delta}, and -{epsilon}. Cells were plated in 96-well plates, and cell proliferation was determined after 4 days in culture. BrdUrd was added to the cells for the last 6 h, and the assay was performed as described in "Materials and Methods." Background readings were subtracted, and the results are expressed in optical density (OD) units. The results represent the mean ± SE of three separate experiments.

 


View larger version (79K):
[in this window]
[in a new window]
 
Fig. 4. Morphology of NGF- and EGF-treated vector control PC12 cells and cells overexpressing PKC-{epsilon}. Stable transfectants of PC12 cells overexpressing PKC-{epsilon} or the control vector were cultured for 4 days on collagen-coated dishes in the absence and presence of NGF (50 ng/ml) or EGF (10 ng/ml). Cells were counted and scored for the presence of neurites. The results represent one representative experiment of five similar experiments.

 

View this table:
[in this window]
[in a new window]
 
Table 2 Percentage of cells with neurites in cells overexpressing different PKC isoforms after treatment with NGF and EGF

 
The neurite outgrowth induced by EGF was inhibited in cells pretreated with the PKC inhibitor GF 109203X (1 µM), consistent with the effect of EGF being associated with PKC activation (data not shown).

EGF Induces Sustained Phosphorylation of MAPK in PC12 Cells Overexpressing PKC-{epsilon}.
One of the marked biochemical differences between the effects of NGF and EGF on PC12 cells is the kinetics of phosphorylation and activation of MAPK. NGF induces a sustained activation of MAPK, whereas EGF induces only a transient activation of this kinase (7 , 22) . We therefore examined the pattern as a function of the time of MAPK phosphorylation by NGF and EGF in cells overexpressing PKC-{epsilon}.

NGF induced maximal phosphorylation of both ERK1 and ERK2 after 5 min, and this phosphorylation persisted for at least 1 h. In contrast, as described previously by others (7) , EGF induced a transient phosphorylation of ERK1 and ERK2 that declined after 15 min. Similar patterns of response to NGF and EGF were observed in cells overexpressing PKC-{alpha} and -{delta} (data not shown). In contrast, cells overexpressing PKC-{epsilon} showed an enhanced activation of both ERK1 and ERK2 in response to NGF as compared to the control vector cells. Overexpression of PKC-{epsilon} dramatically increased the phosphorylation of ERK1 and ERK2 by EGF and caused the response in these cells to persist for up to 1 h (Fig. 5)Citation .



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5. EGF- and NGF-induced MAPK phosphorylation in PC12 cells overexpressing PKC-{epsilon}. Cells were stimulated with NGF (A) or EGF (B) for the time periods indicated. ERK1 and ERK2 phosphorylation was detected by Western blot analysis using a phospho-MAPK antibody. The results represent one representative experiment of five similar experiments. Similar results were obtained with three additional clones of PKC-{epsilon}-overexpressing cells.

 
The MAPK Kinase Inhibitor PD98059 Inhibits EGF-induced Neurite Outgrowth in Cells Overexpressing PKC-{epsilon}.
To examine the role of MAPK activation in the induction of neurite outgrowth by EGF in the PKC-{epsilon} overexpressers, we pretreated the cells with the MAPK kinase inhibitor PD98059 (23) for 1 h, followed by treatment of the cells with EGF. As presented in Fig. 6Citation , treatment of the cells with PD98059 caused a 75 ± 8.3% decrease in the percentage of neurite-bearing cells, thus suggesting that the prolonged activation of MAPK by EGF in the PKC-{epsilon} overexpressers plays a role in the induction of neurite outgrowth by EGF.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. PD98059 inhibits EGF-induced neurite outgrowth in cells overexpressing PKC-{epsilon}. PC12 cells overexpressing PKC-{epsilon} were treated with PD98059 (10 µM) for 1 h, followed by treatment with EGF (10 ng/ml) for 3 days. Cells were counted and scored for the presence of neurites. Values represent the mean values ± SE of quadruplicate determinations from each of three separate experiments. The results were reproduced with three additional clones of PKC-{epsilon}.

 
Cells Overexpressing a PKC-{epsilon} Dominant Negative Mutant.
Our results suggest an important role for PKC-{epsilon} in the process of neurite outgrowth induced by both NGF and EGF. To further examine the role of this isoform, we transfected cells with a PKC-{epsilon} dominant negative mutant and examined the response of the cells to NGF and EGF. To examine the level of protein expression, we analyzed the pooled cultures and three different PKC-overexpressing clones by Western blotting as compared with the vector controls. Fig. 7ACitation illustrates a representative Western blot of PC12 cells overexpressing a PKC-{epsilon} dominant negative mutant compared with the vector control. The levels of the overexpressed PKC-{epsilon} dominant negative mutant in the transfected cells were 10-fold higher than the endogenous PKC-{epsilon}. The morphology of cells overexpressing the PKC-{epsilon} dominant negative mutant was similar to that of the vector control cells. However, these cells displayed a higher rate of cell growth as compared to the vector control cells and the parental cell line (53 ± 11.4% increase over control; P < 0.002; n = 5). The addition of NGF induced a smaller increase in neurite outgrowth in the PKC-{epsilon} dominant negative mutant-overexpressing cells as compared to the vector control cells. This was reflected both in the number of cells expressing neurites (Fig. 7B)Citation and in the length of the neurites (data not shown). Cells expressing the PKC-{epsilon} dominant negative mutant also showed a more transient pattern of MAPK phosphorylation in response to NGF as compared to the control cells (Fig. 7C)Citation . Thus, the maximal level of phosphorylation persisted only up to 30 min and decreased thereafter. EGF did not induce neurite outgrowth in these cells, and its effect on cell proliferation was not significantly affected.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. Expression of PKC-{epsilon} dominant negative mutant inhibits NGF-induced neurite outgrowth and MAPK activation. Stable transfectants of PC12 cells overexpressing PKC-{epsilon} dominant negative mutant or the control vector (M) were harvested and subjected to SDS-PAGE and Western blot analysis. The membranes were probed with anti-PKC-{epsilon} (A). PC12 cells overexpressing a PKC-{epsilon} dominant negative mutant were treated with NGF for 4 days, and cells were counted and scored for the presence of neurites (B). Cells were stimulated with NGF for different periods of time, and ERK1 and ERK2 phosphorylation was determined as described in the Fig. 5 legend (C). The results are of one representative experiment of five similar experiments. Similar results were obtained with three other clones overexpressing the PKC-{epsilon} dominant negative mutant.

 
EGFR Expression.
One possible explanation for the ability of EGF to induce neurite outgrowth and sustained phosphorylation of MAPK could be an increased expression of EGFR in the PKC-{epsilon}-overexpressing cells. To examine this possibility, we immunoprecipitated EGFR from PC12 cells overexpressing the different PKC isoforms and from the vector control cells. No significant difference in the level of EGFR was found (Fig. 8)Citation . Similar results were obtained in three independent clones and two pooled cultures for each of the PKC isoforms examined (data not shown).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 8. Expression of EGFR in PC12 cells overexpressing PKC-{alpha}, -{delta}, or -{epsilon}. Stable transfectants of PC12 cells overexpressing the different PKC isoforms or the control vector (M) were harvested, and immunoprecipitation of the EGFR was performed as described in "Materials and Methods." The results are of one representative experiment of three similar experiments. Similar results were obtained with three other overexpresser clones.

 

    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
PKC activation is known to play a role in the differentiation and proliferation of various cell types (19 , 20) . PKC isoforms differ with regard to tissue distribution, regulation, and enzymatic properties, and the vigorous efforts of various groups are beginning to clarify the different biological roles of individual isoforms. Recent studies have suggested that specific PKC isoforms may be tightly linked with cellular proliferation and differentiation in various systems. For example, PKC-{delta} and -{epsilon} have been shown to exert opposite effects on cell proliferation in NIH3T3 cells (24) . PKC-{delta} plays a role in PMA-induced myeloid differentiation in mouse 32D cells (25) , and PKC-{epsilon} has been linked with neuronal differentiation of the neuroblastoma cell line SH-SY5Y (26) . In this study, we compared the effects of NGF and EGF on specific PKC isoform translocation in PC12 cells and showed that EGF induces neurite outgrowth in PC12 cells overexpressing PKC-{epsilon}.

Conflicting evidence has been reported regarding the role of PKC in the induction of neurite outgrowth in PC12 cells. On one hand, it was suggested that PKC does not play a critical role in NGF-induced differentiation of PC12 cells because depletion of PKC by chronic treatment with PMA did not inhibit neurite outgrowth (27 , 28) . On the other hand, chronic treatment with bryostatin 1, a specific partial antagonist of PKC, did inhibit neurite outgrowth by NGF (29) . Similarly, treatment of PC12 cells with the PKC inhibitor sphingosine (13) and the injection of anti-PKC antibody into PC12 cells (30) have also been shown to inhibit neurite outgrowth in response to NGF. Consistent with these studies, different PKC isoforms have been implicated in the differentiation and proliferation of PC12 cells based on changes in their expression and cellular distribution after NGF-induced differentiation or serum-induced proliferation (31, 32, 33) .

We found that the PC12 cells used in our study express PKC-{alpha}, -ß, -{gamma}, -{delta}, -{epsilon}, -µ, and -{zeta}. Different expression of PKC isoforms has been reported in various PC12 clones. Thus, some clones have been shown to express PKC-{alpha}, -ß, -{delta}, -{epsilon}, and -{zeta} (34) , whereas others have been reported to express, in addition, low levels of PKC-{gamma} mRNA (32) or PKC-{nu} (33) . Differences in the pattern or relative expression of PKC isoforms in various clones may account for the different results obtained regarding the role of PKC in the differentiation of PC12 cells. Our findings that NGF and EGF induced differential translocation of PKC-{delta}, -{epsilon}, and -{zeta} suggested that one of these isoforms may be associated with the differential cellular effects of these two factors. Using two different antisense oligonucleotides for PKC-{zeta}, we found only a small inhibitory effect on neurite outgrowth by NGF, although the expression of PKC-{zeta} was significantly reduced.3 These results are in contrast with those reported by Coleman and Wooten (35) and suggested that PKC-{epsilon} or PKC-{delta} might be involved in the differential effect of NGF and EGF on neurite outgrowth.

We found that EGF induced neurite outgrowth in cells overexpressing PKC-{epsilon}, whereas it did not have a significant effect on cells overexpressing either PKC-{alpha} or -{delta}. PKC-{epsilon} is expressed in high levels in the nervous system and has been implicated in neural differentiation (36) . In the developing chick brain, PKC-{epsilon} is highly expressed in differentiated neurons, and in immunoreactive neurons it has been localized in axons and presynaptic nerve terminals (37) . Further support for the role of PKC-{epsilon} in neural differentiation comes from in vitro studies in which PKC-{epsilon} has been shown to be involved in neurite outgrowth in human neuroblastoma cells (26) and in bradykinin-induced neurite outgrowth in PC12 cells. In addition, recent studies reported that PKC-{epsilon} mediates the enhancement of NGF induction of neurites by PMA and ethanol using cells overexpressing either PKC-{epsilon} or an inhibitory fragment from PKC-{epsilon} (38 , 39) .

In addition to inducing neurite outgrowth in cells overexpressing PKC-{epsilon}, EGF also induced a sustained phosphorylation of MAPK in these cells. Although NGF and EGF exert different effects on PC12 cells, there are both common and distinct aspects of their signaling pathways (6) . Various studies have demonstrated that both NGF and EGF activate p21ras, which is linked to the activated receptors by the adaptor proteins Shc and Grb2 (40) and eventually leads to the activation of a kinase cascade including Raf, MAPK kinase, and MAPK (41) . However, the patterns of phosphorylation induced by NGF and EGF are quite distinct. Thus, EGF induced a more transient tyrosine phosphorylation of PLC-{gamma} as compared to NGF (9) . Similarly, p21ras, MAPK kinase, MAPK, and phosphatidylinositol 3'-kinase are also more rapidly and transiently phosphorylated and activated in response to EGF as compared to NGF in PC12 cells (7 , 9 , 22) . Recently, it was suggested that Rap1 mediates the differentiation of PC12 cells in response to NGF by sustained activation of MAPK via activation of B-Raf. It is currently not clear whether PKC-{epsilon} converges on the Rap1-B-Raf pathway or whether it represents an alternative pathway. Our results further support the hypothesis that the duration of growth factor-induced activation of signaling pathways is related to the cellular response.

The results reported here suggest that PKC-{epsilon} may be associated with activation of the MAPK pathway in PC12 cells. Different PKC isoforms have been implicated in the regulation of the MAPK pathway by influencing different upstream and downstream kinases. Because the effect of EGF and NGF on the translocation of PKC-{epsilon} differs in both the kinetics of the effect and the cellular distribution of the isoform after stimulation, it is possible that either the duration of PKC-{epsilon} activation or its localization in the cell may be of importance in the activation of the MAPK pathway. Indeed, PKC-{epsilon} has been reported to phosphorylate Raf and to induce a persistent activation of MAPK in fibroblasts (42) . Thus, it is possible that EGF activation of PKC-{epsilon} in the overexpressers activates one of the upstream kinases that leads to increased MAPK activation. In addition, NGF has been reported to activate PKC-{epsilon} in PC12 cells (43) and to induce the binding of PKC-{epsilon} to F-actin in nerve terminals (44) , thus suggesting a possible role for this interaction in neurite outgrowth. One of the most striking differences in the effects of NGF and EGF on PKC-{epsilon} was the ability of NGF to induce a massive translocation of this isoform to the cytoskeleton, whereas EGF induced a transient translocation to the membrane. Because we found that there was an increased expression of PKC-{epsilon} in the cytoskeletal fraction (data not shown) in cells overexpressing PKC-{epsilon}, it is possible that the presence of this isoform in the cytoskeleton may play a role in the differentiative effect of EGF.

Although EGF has been reported to act as a mitogen in PC12 cells, it has also been shown to induce cell differentiation under certain conditions. These conditions are associated with treatments that increase the expression of the EGFR or induce a sustained tyrosine phosphorylation and a decreased down-regulation of the receptor (45 , 46) . In addition, cell growth arrest by cAMP (47) , activation of the signal transducers and activators of transcription tyrosine kinase pathway (48) , and changes in the pattern of MAPK activation (49) have been also suggested to play a role in the induction of neurite outgrowth by EGF. Our results indicate that overexpression of PKC-{epsilon} is another mechanism that converts the mitogenic effect of EGF to a differentiative one. EGF-induced differentiation of these cells may be related to the observed reduction in cell proliferation, which is similar to the effect obtained in cAMP-treated cells (47) , or to the sustained activation of MAPK via PKC-{epsilon}. Interestingly, cAMP was recently shown to induce the translocation of PKC-{epsilon} in PC12 cells, thus providing further support for the importance of this isoform in PC12 cell differentiation (50) .

The present results also suggest a role for PKC-{epsilon} in neurite outgrowth in response to NGF, because expression of a PKC-{epsilon} dominant negative mutant reduced the ability of NGF to induce both neurite outgrowth and MAPK phosphorylation. Our results differ from those reported by Hundle et al. (38) , who concluded that inhibition of PKC-{epsilon} does not affect the ability of NGF to induce neurite outgrowth but rather abrogates the enhancement of the NGF effect exerted by ethanol and PMA. The differences in our results may arise from the use of different PC12 clones that express various levels of specific PKC isoforms or from different approaches for studying the role of PKC{epsilon}.

In conclusion, the results of this study suggest that PKC-{epsilon} provides a positive signal for the neurite outgrowth response by NGF and EGF via activation of the MAPK pathway. Our findings provide an important system for analyzing the signals involved in neurite outgrowth and the interactions of PKC with the MAPK pathway.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Materials.
NGF (2.5S), EGF, and anti-EGFR were purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Anti-PKC-{alpha}, -ß, -{gamma}, -{delta}, -{zeta}, and -µ were obtained from Transduction Laboratories (Lexington, KY). An affinity-purified polyclonal anti-PKC-{epsilon} antibody against a polypeptide corresponding to amino acids 726–737 of PKC-{epsilon} was purchased from Life Technologies, Inc. (Gaithersburg, MD). Leupeptin, aprotinin, PMSF, and sodium vanadate were obtained from Sigma Chemical Co. (St. Louis, MO). Anti-ACTIVE MAPK polyclonal antibody was purchased from Promega (Madison, WI). PD98059 was obtained from Alexis Biochemicals (San Diego, CA).

Generation of PKC Constructs.
PKC constructs were made as described previously (51 , 52) . The PKC isoforms were subcloned into a metallothionein promoter-driven eukaryotic expression vector (MTH). The vector sequence encodes a COOH-terminal PKC-{epsilon}-derived 12-amino acid tag ({epsilon}MTH) that was added to the expressed proteins (53) .

Construction of a Kinase Inactive Mutant of Murine PKC-{epsilon}.
The PKC-{epsilon} kinase inactive mutant construct (K437R) was generated by the PCR overlap extension method. The following oligonucleotide primers were used in the mutagenesis protocol: (a) 5' primer, CCGCGTCGACCATGGTAGTGTTCAATGG; (b) primer A, CGTCCTTCTTTAGGGCCCTCACAGCATAGAC; (c) primer B, GTCTATGCTGTGAGGGCCCTAAAGAAGGACG; and (d) 3' primer, ATTCGCGCGCTCAGGGCATCAGGTCTTCAC.

The altered sites introduced into primers A and B (underlined nucleotides) were designed to mutate the original amino acids Lys437 and Val438 to Arg437 and Ala438, respectively, and to introduce a new ApaI restriction cutting site (GGGCCC). The mutant cDNA fragment generated by the PCR overlap extension procedure was cloned into the mammalian {epsilon} epitope-tagging expression vector, which contains the metallothionein promoter (53) . The PCR reactions were performed with low (10 or less) cycle numbers using the high-fidelity Vent DNA polymerase to minimize the chance of undesired point mutations. The introduced ATP binding site mutation was verified in selected clones by restriction digestions and DNA sequencing.

PC12 Cultures and Cell Transfection.
PC12 cells originally obtained from Dr. G. Guroff (NIH, Bethesda, MD) were grown in medium consisting of DMEM containing 10% heat-inactivated horse serum, 5% FCS, 2 mM glutamine, 50 units/ml penicillin, and 0.05 mg/ml streptomycin in a 10% CO2 atmosphere. The cells were transfected with either the empty vector or with the different PKC expression vectors using LipofectAMINE (Life Technologies, Inc.) according to the procedure recommended by the manufacturer. The transfected cells were grown in selection medium containing 450 µg/ml G418 (Life Technologies, Inc.). After 2–3 weeks in selection medium, single colonies were picked, expanded, and screened for the presence of different PKC isoforms using Western blot analysis. Experiments were routinely carried out on pools of transfected cells, but all of the results were confirmed on three different individual clones for each of the different isoforms.

Neurite Outgrowth Assay.
For studies of neurite outgrowth, cells were plated in collagen-coated 6-well plates at a density of 1 x 104 cells/ml in either growth medium or DMEM containing 2% horse serum. After 24 h, cells were treated with the appropriate factor, and the appearance of neurites was examined at different times. Cells bearing neurites at least twice the size of the cell body were counted.

Cell Homogenates.
Cells were washed and resuspended in serum-free medium. The plates were placed on ice, scraped with a rubber policeman, and centrifuged at 1,400 rpm for 10 min. The supernatants were aspirated, and the cell pellets were resuspended in 100 µl of lysis buffer [25 mM Tris-HCl (pH 7.4), 50 mM NaCl, 0.5% sodium deoxycholate, 2% NP-40, 0.2% SDS, 1 mM PMSF, 50 µg/ml aprotinin, 50 µM leupeptin, and 0.5 mM Na3VO4] on ice for 15 min. The cell lysates were centrifuged for 15 min at 14,000 rpm in an Eppendorf microcentrifuge, supernatants were removed, and 2x sample buffer was added.

Subcellular Fractionation.
Subcellular fractionation was carried out according to the following protocol. Cultures were harvested in 0.5 ml of ice-cold homogenization buffer [20 mM Tris-HCl (pH 7.5), 10 mM EGTA, 2 mM EDTA, 0.5 mM PMSF, 0.1% (v/v) aprotinin, 50 µg/ml leupeptin, and 50 µM NaF] and lysed by sonication. The cytosolic fraction represents the supernatant after centrifugation at 100,000 x g for 1 h at 4°C. The Triton X-100-soluble particulate fraction was prepared by a 2-h extraction of the pellet with the same buffer containing 1% Triton X-100 and a subsequent centrifugation for 1 h at 100,000 x g. The remaining pellet is the Triton X-100-insoluble fraction (mainly the cytoskeletal fraction).

Immunoprecipitation.
PC12 cells overexpressing the different PKC isoforms or the control vector were washed three times with cold PBS and scraped into 1 ml of lysis buffer containing 50 mM HEPES (pH 7.5), 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 1 µM 4-(2-aminoethyl)benzenesulfonyl fluoride, and 1 mM EDTA. After mixing, the samples were incubated on ice for 30 min and then centrifuged in a microcentrifuge at 4°C for 5 min. The supernatant was removed and preabsorbed with 25 µl of protein A/G-Sepharose (50%) for 10 min. The samples were then spun at 4°C for 3 min at 15,000 x g, and the supernatants were taken for immunoprecipitation. Immunoprecipitation was performed by rotating the samples overnight with 4 µg/ml anti-EGFR antibody and 30 µl of protein A/G-Sepharose at 4°C. The samples were spun at 15,000 x g at 4°C for 3 min and washed three times with radioimmunoprecipitation assay buffer containing 50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 0.1% SDS, and 1% deoxycholate. The pellets were resuspended in 25 µl of SDS sample buffer and boiled for 5 min. Before SDS-PAGE, samples were centrifuged again as described above, and all of the supernatants were subjected to Western blotting.

Immunoblot Analysis.
Lysates (20 µg of protein) were resolved by SDS-PAGE (10%) and transferred to nitrocellulose membranes. To determine the protein content of individual lanes, membranes were stained with 0.1% Ponceau S solution in 5% acetic acid. The Ponceau S staining was removed by several washes with PBS (pH 7.4); the membranes were blocked with 5% dry milk in PBS and subsequently stained with the primary antibody. Specific reactive bands were detected using a goat antirabbit or goat antimouse IgG conjugated to horseradish peroxidase (Bio-Rad, Hercules, CA), and the immunoreactive bands were visualized by the enhanced chemiluminescence Western blotting detection kit (Amersham, Arlington Heights, IL). The specificities of the antibodies (for all PKC isoforms) were determined by the use of soluble immunogenic peptides that compete with the epitope of the correct molecular size of the specific PKC isotypes immobilized on the membranes.

MAPK Activation.
Activation of MAPK was analyzed using a rabbit polyclonal phospho-specific Mr 42,000/44,000 MAPK antibody directed against the phosphorylated form of the MAPK enzyme (Thr183 and Tyr185). For this assay, cells were serum-starved for 1 h and then stimulated with either NGF or EGF for different periods of time. Cells were washed in ice-cold PBS and harvested in lysis buffer, and cell lysates were subjected to Western blot analysis. Membranes were stained with anti-ACTIVE MAPK antibody followed by antirabbit antibody conjugated to horseradish peroxidase. The immunoreactive bands were visualized by the enhanced chemiluminescence Western blotting detection kit (Amersham).

[3H]PDBu Binding.
[3H]PDBu binding was measured using the polyethylene glycol precipitation assay (54) . Briefly, cell lysates (4–60 µg of protein/assay) were incubated with 20 nM [3H]PDBu in the presence of phosphatidylcholine/phosphatidylserine (80:20). Nonspecific binding, which was determined in the presence of 30 µM nonradioactive PDBu, was subtracted to give specific binding. Data represent triplicate determinations in each experiment.

Cell Proliferation Assay.
Cells overexpressing the different PKC isoforms or the control vector cells were seeded in two sets of triplicate wells in 96-well plates and incubated in the absence or presence of NGF or EGF for a period of 4 or 6 days. Cells were labeled with BrdUrd for the last 6 h in culture. Cells were washed three times and fixed, and the DNA was denatured. The cells were then incubated with anti-BrdUrd antibody conjugated with horseradish peroxidase for 2 h. The immune complexes were detected using the substrate tetramethylbenzidine, and the reaction product was quantified by measuring the absorbance at 450 nm with a reference wavelength of 690 nm.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Molecular Mechanisms of Tumor Promotion Section, LCCTP, National Cancer Institute, Building 37, Room 3A01, 37 Convent Drive MSC 4255, Bethesda, MD 20892-4255. Phone: (301) 496-3189; Fax: (301) 496-8709; E-mail: blumberp{at}dc37a.nci.nih.gov Back

2 The abbreviations used are: NGF, nerve growth factor; EGF, epidermal growth factor; PKC, protein kinase C; PLC, phospholipase C; MAPK, mitogen-activated protein kinase; PMA, phorbol 12-myristate 13-acetate; DAG, sn-1,2 diacylglycerol; PDBu, phorbol 12,13-dibutyrate; BrdUrd, bromodeoxyuridine; ERK, extracellular signal-regulated kinase; EGFR, EGF receptor; PMSF, phenylmethylsulfonyl fluoride. Back

3 Unpublished data. Back

Received for publication 10/20/98. Revision received 1/13/99. Accepted for publication 1/13/99.


    References
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Greene L. A., Tischler A. S. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc. Natl. Acad. Sci. USA, 73: 2424-2428, 1976.[Abstract/Free Full Text]
  2. Greene L. A., Aletta J. M., Rukenstein A., Green S. H. PC12 pheochromocytoma cells: culture, nerve growth factor treatment, and experimental exploitation. Methods Enzymol., 147: 207-216, 1987.[Medline]
  3. Huff K., End D., Guroff G. Nerve growth factor-induced alteration in the response of PC12 pheochromocytoma cells to epidermal growth factor. J. Cell Biol., 88: 189-198, 1981.[Abstract/Free Full Text]
  4. Kaplan D. R., Martin-Zanca D., Parada L. F. Tyrosine phosphorylation and tyrosine kinase activity of the trk proto-oncogene product induced by NGF. Nature (Lond.), 350: 158-160, 1991.[Medline]
  5. Ullrich A., Schlessinger J. Signal transduction by receptors with tyrosine kinase activity. Cell, 61: 203-212, 1990.[Medline]
  6. Chao M. V. Growth factor signaling: where is the specificity?. Cell, 68: 995-997, 1992.[Medline]
  7. Traverse S., Gomez N., Paterson H., Marshall C., Cohen P. Sustained activation of the mitogen-activated protein (MAP) kinase cascade may be required for differentiation of PC12 cells. Comparison of the effects of nerve growth factor and epidermal growth factor. Biochem. J., 288: 351-355, 1992.
  8. York R. D., Yao H., Dillon T., Ellig C. L., Eckert S. P., McCleskey E. W., Stork P. J. Rap1 mediates sustained MAP kinase activation induced by nerve growth factor. Nature (Lond.), 392: 622-626, 1998.[Medline]
  9. Blumberg D., Radeke M. J., Feinstein S. C. Specificity of nerve growth factor signaling: differential patterns of early tyrosine phosphorylation events induced by NGF, EGF, and bFGF. J. Neurosci. Res., 41: 628-639, 1995.[Medline]
  10. Rabin S. J., Cleghon V., Kaplan D. R. SNT, a differentiation-specific target of neurotrophic factor-induced tyrosine kinase activity in neurons and PC12 cells. Mol. Cell. Biol., 13: 2203-2213, 1993.[Abstract/Free Full Text]
  11. Hama T., Huang K. P., Guroff G. Protein kinase C as a component of a nerve growth factor-sensitive phosphorylation system in PC12 cells. Proc. Natl. Acad. Sci. USA, 83: 2353-2357, 1986.[Abstract/Free Full Text]
  12. Heasley L. E., Johnson G. L. Regulation of protein kinase C by nerve growth factor, epidermal growth factor, and phorbol esters in PC12 pheochromocytoma cells. J. Biol. Chem., 264: 8646-8652, 1989.[Abstract/Free Full Text]
  13. Hall F. L., Fernyhough P., Ishii D. N., Vulliet P. R. Suppression of nerve growth factor-directed neurite outgrowth in PC12 cells by sphingosine, an inhibitor of protein kinase C. J. Biol. Chem., 263: 4460-4466, 1988.[Abstract/Free Full Text]
  14. Burstein D. E., Blumberg P. M., Greene L. A. Nerve growth factor-induced neuronal differentiation of PC12 pheochromocytoma cells: lack of inhibition by a tumor promoter. Brain Res., 247: 115-119, 1982.[Medline]
  15. Nishizuka Y. The molecular heterogeneity of protein kinase C and its implications for cellular regulation. Nature (Lond.), 334: 661-665, 1988.[Medline]
  16. Nishizuka Y. The role of protein kinase C in cell surface signal transduction and tumour promotion. Nature (Lond.), 308: 693-698, 1984.[Medline]
  17. Nishizuka Y. Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science (Washington DC), 258: 607-614, 1992.[Abstract/Free Full Text]
  18. Mosior M., Newton A. C. Mechanism of interaction of protein kinase C with phorbol esters. Reversibility and nature of membrane association. J. Biol. Chem., 270: 25526-25533, 1995.[Abstract/Free Full Text]
  19. Newton A. C. Protein kinase C: structure, function, and regulation. J. Biol. Chem., 270: 28495-28498, 1995.[Free Full Text]
  20. Jaken S. Protein kinase C isozymes and substrates. Curr. Opin. Cell. Biol., 8: 168-173, 1996.[Medline]
  21. Johannes F. J., Prestle J., Dieterich S., Oberhagemann P., Link G., Pfizenmaier K. Characterization of activators and inhibitors of protein kinase C µ. Eur. J. Biochem., 227: 303-307, 1995.[Medline]
  22. Qiu M. S., Green S. H. NGF and EGF rapidly activate p21ras in PC12 cells by distinct, convergent pathways involving tyrosine phosphorylation. Neuron, 7: 937-946, 1991.[Medline]
  23. Pang L., Sawada T., Decker S. J., Saltiel A. R. Inhibition of MAP kinase kinase blocks the differentiation of PC12 cells induced by nerve growth factor. J. Biol. Chem., 270: 13585-13588, 1995.[Abstract/Free Full Text]
  24. Borner C., Ueffing M., Jaken S., Parker P. J., Weinstein I. B. Two closely related isoforms of protein kinase C produce reciprocal effects on the growth of rat fibroblasts. Possible molecular mechanisms. J. Biol. Chem., 270: 78-86, 1995.[Abstract/Free Full Text]
  25. Mischak H., Pierce J. H., Goodnight J., Kazanietz M. G., Blumberg P. M., Mushinski J. F. Phorbol ester-induced myeloid differentiation is mediated by protein kinase C-{alpha} and -{delta} and not by protein kinase C-ß II, -{epsilon}, -{zeta}, and -{nu}. J. Biol. Chem., 268: 20110-20115, 1993.[Abstract/Free Full Text]
  26. Fagerstrom S., Pahlman S., Gestblom C., Nanberg E. Protein kinase C-{epsilon} is implicated in neurite outgrowth in differentiating human neuroblastoma cells. Cell Growth Differ., 7: 775-785, 1996.[Abstract]
  27. Reinhold D. S., Neet K. E. The lack of a role for protein kinase C in neurite extension and in the induction of ornithine decarboxylase by nerve growth factor in PC12 cells. J. Biol. Chem., 264: 3538-3544, 1989.[Abstract/Free Full Text]
  28. Damon D. H., D’Amore P. A., Wagner J. A. Nerve growth factor and fibroblast growth factor regulate neurite outgrowth and gene expression in PC12 cells via both protein kinase C- and cAMP-independent mechanisms. J. Cell Biol., 110: 1333-1339, 1990.[Abstract/Free Full Text]
  29. Singh K. R., Taylor L. K., Campbell X. Z., Fields A. P., Neet K. E. A bryostatin-sensitive protein kinase C required for nerve growth factor activity. Biochemistry, 33: 542-551, 1994.[Medline]
  30. Altin J. G., Wetts R., Riabowol K. T., Bradshaw R. A. Testing the in vivo role of protein kinase C and c-fos in neurite outgrowth by microinjection of antibodies into PC12 cells. Mol. Biol. Cell, 3: 323-333, 1992.[Abstract]
  31. Wooten M. W., Seibenhener M. L., Soh Y., Ewald S. J., White K. R., Lloyd E. D., Olivier A., Parker P. J. Characterization and differential expression of protein kinase C isoforms in PC12 cells. Differentiation parallels an increase in PKC ß II. FEBS Lett., 298: 74-78, 1992.[Medline]
  32. O’Driscoll K. R., Teng K. K., Fabbro D., Greene L. A., Weinstein I. B. Selective translocation of protein kinase C-{delta} in PC12 cells during nerve growth factor-induced neuritogenesis. Mol. Biol. Cell, 6: 449-458, 1995.[Abstract]
  33. Borgatti P., Mazzoni M., Carini C., Neri L. M., Marchisio M., Bertolaso L., Previati M., Zauli G., Capitani S. Changes of nuclear protein kinase C activity and isotype composition in PC12 cell proliferation and differentiation. Exp. Cell Res., 224: 72-78, 1996.[Medline]
  34. Wooten M. W., Zhou G., Seibenhener M. L., Coleman E. S. A role for {zeta} protein kinase C in nerve growth factor-induced differentiation of PC12 cells. Cell Growth Differ., 5: 395-403, 1994.[Abstract]
  35. Coleman E. S., Wooten M. W. Nerve growth factor-induced differentiation of PC12 cells employs the PMA-insensitive protein kinase C-{zeta} isoform. J. Mol. Neurosci., 5: 9-57, 1994.
  36. Mangoura D., Sogos V., Dawson G. Protein kinase C-{epsilon} is a developmentally regulated, neuronal isoform in the chick embryo central nervous system. J. Neurosci. Res., 35: 488-498, 1993.[Medline]
  37. Saito N., Itouji A., Totani Y., Osawa I., Koide H., Fujisawa N., Ogita K., Tanaka C. Cellular and intracellular localization of {epsilon}-subspecies of protein kinase C in the rat brain; presynaptic localization of the {epsilon}-subspecies. Brain Res., 607: 241-248, 1993.[Medline]
  38. Hundle B., McMahon T., Dadgar J., Chen C. H., Mochly-Rosen D., Messing R. O. An inhibitory fragment derived from protein kinase C{epsilon} prevents enhancement of nerve growth factor responses by ethanol and phorbol esters. J. Biol. Chem., 272: 15028-15035, 1997.[Abstract/Free Full Text]
  39. Hundle B., McMahon T., Dadgar J., Messing R. O. Overexpression of {epsilon}-protein kinase C enhances nerve growth factor-induced phosphorylation of mitogen-activated protein kinases and neurite outgrowth. J. Biol. Chem., 270: 30134-30140, 1995.[Abstract/Free Full Text]
  40. Basu T., Warne P. H., Downward J. Role of Shc in the activation of Ras in response to epidermal growth factor and nerve growth factor. Oncogene, 9: 3483-3491, 1994.[Medline]
  41. Thomas S. M., DeMarco M., D’Arcangelo G., Halegoua S., Brugge J. S. Ras is essential for nerve growth factor- and phorbol ester-induced tyrosine phosphorylation of MAP kinases. Cell, 68: 1031-1040, 1992.[Medline]
  42. Cai H., Smola U., Wixler V., Eisenmann-Tappe I., Diaz-Meco M. T., Moscat J., Rapp U., Cooper G. M. Role of diacylglycerol-regulated protein kinase C isotypes in growth factor activation of the Raf-1 protein kinase. Mol. Cell. Biol., 17: 732-741, 1997.[Abstract/Free Full Text]
  43. Ohmichi M., Zhu G., Saltiel A. R. Nerve growth factor activates calcium-insensitive protein kinase C-{epsilon} in PC12 rat pheochromocytoma cells. Biochem. J., 295: 767-772, 1993.
  44. Prekeris R., Mayhew M. W., Cooper J. B., Terrian D. M. Identification and localization of an actin-binding motif that is unique to the {epsilon} isoform of protein kinase C and participates in the regulation of synaptic function. J. Cell Biol., 132: 77-90, 1996.[Abstract/Free Full Text]
  45. Raffioni S., Bradshaw R. A. Staurosporine causes epidermal growth factor to induce differentiation in PC12 cells via receptor up-regulation. J. Biol. Chem., 270: 7568-7572, 1995.[Abstract/Free Full Text]
  46. Isono F., Widmer H. R., Hefti F., Knusel B. Epidermal growth factor induces PC12 cell differentiation in the presence of the protein kinase inhibitor K-252a. J. Neurochem., 63: 1235-1245, 1994.[Medline]
  47. Mark M. D., Storm D. R. Coupling of epidermal growth factor (EGF) with the antiproliferative activity of cAMP induces neuronal differentiation. J. Biol. Chem., 272: 17238-17244, 1997.[Abstract/Free Full Text]
  48. Wu Y. Y., Bradshaw R. A. Synergistic induction of neurite outgrowth by nerve growth factor or epidermal growth factor and interleukin-6 in PC12 cells. J. Biol. Chem., 271: 13033-13039, 1996.[Abstract/Free Full Text]
  49. Wu C. F., Zhang M., Howard B. D. K252a potentiates epidermal growth factor-induced differentiation of PC12 cells. J. Neurosci. Res., 36: 539-550, 1993.[Medline]
  50. Graness A., Adomeit A., Ludwig B., Muller W. D., Kaufmann R., Liebmann C. Novel bradykinin signaling events in PC12 cells: stimulation of the cAMP pathway leads to cAMP-mediated translocation of protein kinase C{epsilon}. Biochem. J., 327: 147-154, 1997.
  51. Chang E. Y., Szallasi Z., Acs P., Raizada V., Wolfe P. C., Fewtrell C., Blumberg P. M., Rivera J. Functional effects of overexpression of protein kinase C-{alpha}, -ß, -{delta}, -{epsilon}, and -{nu} in the mast cell line RBL-2H3. J. Immunol., 159: 2624-2632, 1997.[Abstract]
  52. Kazanietz M. G., Areces L. B., Bahador A., Mischak H., Goodnight J., Mushinski J. F., Blumberg P. M. Characterization of ligand and substrate specificity for the calcium- dependent and calcium-independent protein kinase C isozymes. Mol. Pharmacol., 44: 298-307, 1993.[Abstract]
  53. Olah Z., Lehel C., Jakab G., Anderson W. B. A cloning and {epsilon}-epitope-tagging insert for the expression of polymerase chain reaction-generated cDNA fragments in Escherichia coli and mammalian cells. Anal. Biochem., 221: 94-102, 1994.[Medline]
  54. Szallasi Z., Smith C. B., Pettit G. R., Blumberg P. M. Differential regulation of protein kinase C isozymes by bryostatin 1 and phorbol 12-myristate 13-acetate in NIH 3T3 fibroblasts. J. Biol. Chem., 269: 2118-2124, 1994.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. Sunesson, U. Hellman, and C. Larsson
Protein Kinase C{epsilon} Binds Peripherin and Induces Its Aggregation, Which Is Accompanied by Apoptosis of Neuroblastoma Cells
J. Biol. Chem., June 13, 2008; 283(24): 16653 - 16664.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Gopalakrishna, U. Gundimeda, J. E. Schiffman, and T. H. McNeill
A Direct Redox Regulation of Protein Kinase C Isoenzymes Mediates Oxidant-induced Neuritogenesis in PC12 Cells
J. Biol. Chem., May 23, 2008; 283(21): 14430 - 14444.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Beaudry, L. Gendron, M.-O. Guimond, M. D. Payet, and N. Gallo-Payet
Involvement of Protein Kinase C{alpha} (PKC{alpha}) in the Early Action of Angiotensin II Type 2 (AT2) Effects on Neurite Outgrowth in NG108-15 Cells: AT2-Receptor Inhibits PKC{alpha} and p21ras Activity
Endocrinology, September 1, 2006; 147(9): 4263 - 4272.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Liu, T. Nakazawa, T. Tezuka, and T. Yamamoto
Physical and Functional Interaction of Fyn Tyrosine Kinase with a Brain-enriched Rho GTPase-activating Protein TCGAP
J. Biol. Chem., August 18, 2006; 281(33): 23611 - 23619.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
E. Lessmann, M. Leitges, and M. Huber
A redundant role for PKC-{varepsilon} in mast cell signaling and effector function
Int. Immunol., May 1, 2006; 18(5): 767 - 773.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. M. Belcheva, A. L. Clark, P. D. Haas, J. S. Serna, J. W. Hahn, A. Kiss, and C. J. Coscia
{micro} and {kappa} Opioid Receptors Activate ERK/MAPK via Different Protein Kinase C Isoforms and Secondary Messengers in Astrocytes
J. Biol. Chem., July 29, 2005; 280(30): 27662 - 27669.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. K. Parran, A. Barker, and M. Ehrich
Effects of Thimerosal on NGF Signal Transduction and Cell Death in Neuroblastoma Cells
Toxicol. Sci., July 1, 2005; 86(1): 132 - 140.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ling, U. Troller, R. Zeidman, H. Stensman, A. Schultz, and C. Larsson
Identification of Conserved Amino Acids N-terminal of the PKC{epsilon}C1b Domain Crucial for Protein Kinase C{epsilon}-mediated Induction of Neurite Outgrowth
J. Biol. Chem., May 6, 2005; 280(18): 17910 - 17919.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. K. Basu, M. Kovarova, A. Garza, S. Kubota, T. Saha, P. S. Mitra, R. Banerjee, J. Rivera, and I. S. Owens
Phosphorylation of a UDP-glucuronosyltransferase regulates substrate specificity
PNAS, May 3, 2005; 102(18): 6285 - 6290.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Watanabe, T. Yokozeki, M. Yamazaki, H. Miyazaki, T. Sasaki, T. Maehama, K. Itoh, M. A. Frohman, and Y. Kanaho
Essential Role for Phospholipase D2 Activation Downstream of ERK MAP Kinase in Nerve Growth Factor-stimulated Neurite Outgrowth from PC12 Cells
J. Biol. Chem., September 3, 2004; 279(36): 37870 - 37877.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
S. Kawa, J. Fujimoto, T. Tezuka, T. Nakazawa, and T. Yamamoto
Involvement of BREK, a serine/threonine kinase enriched in brain, in NGF signalling
Genes Cells, March 1, 2004; 9(3): 219 - 232.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Jose Lopez-Andreo, J. C. Gomez-Fernandez, and S. Corbalan-Garcia
The Simultaneous Production of Phosphatidic Acid and Diacylglycerol Is Essential for the Translocation of Protein Kinase C{epsilon} to the Plasma Membrane in RBL-2H3 Cells
Mol. Biol. Cell, December 1, 2003; 14(12): 4885 - 4895.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Mikule, S. Sunpaweravong, J. C. Gatlin, and K. H. Pfenninger
Eicosanoid Activation of Protein Kinase C {epsilon}: INVOLVEMENT IN GROWTH CONE REPELLENT SIGNALING
J. Biol. Chem., May 30, 2003; 278(23): 21168 - 21177.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-C. Cheng, H.-M. Shih, and Y. Chern
Essential Role of cAMP-response Element-binding Protein Activation by A2A Adenosine Receptors in Rescuing the Nerve Growth Factor-induced Neurite Outgrowth Impaired by Blockage of the MAPK Cascade
J. Biol. Chem., September 6, 2002; 277(37): 33930 - 33942.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Gannon-Murakami and K. Murakami
Selective Association of Protein Kinase C with 14-3-3 zeta in Neuronally Differentiated PC12 Cells. STIMULATORY AND INHIBITORY EFFECT OF 14-3-3 zeta IN VIVO
J. Biol. Chem., June 21, 2002; 277(26): 23116 - 23122.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. Obara, T. Aoki, M. Kusano, and Y. Ohizumi
beta -Eudesmol Induces Neurite Outgrowth in Rat Pheochromocytoma Cells Accompanied by an Activation of Mitogen-Activated Protein Kinase
J. Pharmacol. Exp. Ther., June 1, 2002; 301(3): 803 - 811.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. W. Wooten, M. L. Vandenplas, M. L. Seibenhener, T. Geetha, and M. T. Diaz-Meco
Nerve Growth Factor Stimulates Multisite Tyrosine Phosphorylation and Activation of the Atypical Protein Kinase C's via a src Kinase Pathway
Mol. Cell. Biol., December 15, 2001; 21(24): 8414 - 8427.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. S. Song, Y. K. Park, J.-H. Lee, and K. Park
Induction of Glucose-regulated Protein 78 by Chronic Hypoxia in Human Gastric Tumor Cells through a Protein Kinase C-{epsilon}/ERK/AP-1 Signaling Cascade
Cancer Res., November 1, 2001; 61(22): 8322 - 8330.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K. O. Aley, A. Martin, T. McMahon, J. Mok, J. D. Levine, and R. O. Messing
Nociceptor Sensitization by Extracellular Signal-Regulated Kinases
J. Neurosci., September 1, 2001; 21(17): 6933 - 6939.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
F. Manseau, X. Fan, T. Hueftlein, W. S. Sossin, and V. F. Castellucci
Ca2+-Independent Protein Kinase C Apl II Mediates the Serotonin-Induced Facilitation at Depressed Aplysia Sensorimotor Synapses
J. Neurosci., February 15, 2001; 21(4): 1247 - 1256.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K. Naruse and G. L. King
Protein Kinase C and Myocardial Biology and Function
Circ. Res., June 9, 2000; 86(11): 1104 - 1106.
[Full Text] [PDF]


Home page
J. Neurosci.Home page
R. Farias-Eisner, L. Vician, A. Silver, S. Reddy, S. A. Rabbani, and H. R. Herschman
The Urokinase Plasminogen Activator Receptor (UPAR) Is Preferentially Induced by Nerve Growth Factor in PC12 Pheochromocytoma Cells and Is Required for NGF-Driven Differentiation
J. Neurosci., January 1, 2000; 20(1): 230 - 239.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Gaubert, F. Escaffit, C. Bertrand, M. Korc, L. Pradayrol, F. Clemente, and A. Estival
Expression of the High Molecular Weight Fibroblast Growth Factor-2 Isoform of 210 Amino Acids Is Associated with Modulation of Protein Kinases C delta and epsilon and ERK Activation
J. Biol. Chem., January 5, 2001; 276(2): 1545 - 1554.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Hossain, C. M. L. Bouton, J. Pevsner, and J. Laterra
Induction of Vascular Endothelial Growth Factor in Human Astrocytes by Lead. INVOLVEMENT OF A PROTEIN KINASE C/ACTIVATOR PROTEIN-1 COMPLEX-DEPENDENT AND HYPOXIA-INDUCIBLE FACTOR 1-INDEPENDENT SIGNALING PATHWAY
J. Biol. Chem., September 1, 2000; 275(36): 27874 - 27882.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-J. Cheng, B.-S. Wung, Y.-J. Chao, and D. L. Wang
Sequential Activation of Protein Kinase C (PKC)-alpha and PKC-epsilon Contributes to Sustained Raf/ERK1/2 Activation in Endothelial Cells under Mechanical Strain
J. Biol. Chem., August 10, 2001; 276(33): 31368 - 31375.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tsuji, O. Inanami, and M. Kuwabara
Induction of Neurite Outgrowth in PC12 Cells by alpha -Phenyl-N-tert-butylnitron through Activation of Protein Kinase C and the Ras-Extracellular Signal-regulated Kinase Pathway
J. Biol. Chem., August 24, 2001; 276(35): 32779 - 32785.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. Zeidman, U. Troller, A. Raghunath, S. Pahlman, and C. Larsson
Protein Kinase Cepsilon Actin-binding Site Is Important for Neurite Outgrowth during Neuronal Differentiation
Mol. Biol. Cell, January 1, 2002; 13(1): 12 - 24.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brodie, C.
Right arrow Articles by Blumberg, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brodie, C.
Right arrow Articles by Blumberg, P. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation