Cell Growth & Differentiation Vol. 10, 163-171, March 1999
© 1999 American Association for Cancer Research
Human Melanoma Cell Line UV Responses Show Independency of p53 Function1
Tarja Haapajärvi,
Kimmo Pitkänen and
Marikki Laiho2
Haartman Institute, Department of Virology, University of Helsinki, FIN-00014 Helsinki, Finland
 |
Abstract
|
|---|
UV radiation-induced mutation of the p53 gene is suggested as a causative event in skin cancer, including melanoma. We have analyzed here p53 mutations in melanoma cell lines and studied its stabilization, DNA-binding activity, and target gene activation by UVC. p53 was mutated in three of seven melanoma cell lines. However, high levels of p53 were detected in all cell lines, including melanoma cells with wild-type p53, with the exception of one line with a truncated form. Upon UV induction, p53 accumulated in lines with wild-type p53, and p53 target genes p21Cip1/Waf1, GADD45, and mdm2 were induced, but the induction of p21Cip1/Waf1 was significantly delayed as compared with the increase in p53 DNA-binding activity. However, despite p53 target gene induction, p53 DNA-binding activity was absent in one melanoma line with wild-type p53, and p53 target genes were induced also in cells with mutant p53. In response to UV, DNA replication ceased in all cell lines, and apoptosis ensued in four lines independently of p53 but correlated with high induction of GADD45. The results suggest that in melanoma, several p53 regulatory steps are dislodged; its basal expression is high, its activation in response to UV damage is diminished, and the regulation of its target genes p21Cip1/Waf1 and GADD45 are dissociated from p53 regulation.
 |
Introduction
|
|---|
DNA damage of cells by UV radiation causes pyrimidine dimer formation and generates (6, 5, 4)
photoproducts, both of which distort the double-helical structure of DNA. Although this damage is efficiently repaired by photoreactivation of DNA and nucleotide excision repair, accumulation of unrepaired lesions, especially if targeted at DNA damage checkpoint proteins (1)
, is suggested to lead to impaired damage control, loss of cell cycle control, genomic instability, and cancer. Genes most often mutated in UV damage-associated cancers include p16MTS1/CDKN2 and p53 (2, 3, 4, 5)
. The p53 mutations observed in skin cancer are typically found at dipyrimidine sites (C
T and CC
TT transitions), supporting the mutations being induced by direct UV damage (2
, 3)
, and the rate of repair of mutations in p53, especially at commonly affected sites, is slow (6)
. Furthermore, the mutation in p53 appears to be an early event in the development of skin cancer (7)
, and mutations arising in p53 can alternatively be blocked by sunscreens (8)
. Studies based on direct DNA sequencing of p53 indicate that its mutation in melanoma is rare, with <1% mutations detected in primary melanoma (9)
. In metastatic melanomas, the frequency of p53 mutation increases to 5% (9, 10, 11)
, and in melanoma cell lines, the frequency is detected at an
20% rate (12, 13, 14)
. This is in contrast to the 50% p53 mutation rate found in other cancers (15)
, including other skin cancers. p53 mutations have been found in benign compound nevi and in dysplastic nevi, especially in cases with previous history of melanoma (16
, 17)
. The mutation pattern of p53 occurring in dipyrimidine sites is in accordance with UV damage being an underlying event in tumor progression as well as in melanoma (9
, 14
, 17)
. In addition, changes in p53 intron 4 containing putative elements for several transcription factors have been described in melanoma cells (18)
. In contrast to the low frequency of p53 mutation in melanoma, several studies have found high levels of p53 expression in melanoma cells, with increasing frequency (60%) in metastatic melanomas (19, 20, 21)
. In some cases, a cytoplasmic localization for p53 has been described (14)
, whereas these studies are contrasted by others showing singularly nuclear p53 localization (19
, 20)
.
UV damage of cells causes a replicative arrest, concomitant with accumulation of p53, increased p53 DNA-binding activity, and induction of its target genes (22, 23, 24, 25, 26)
. All of these responses are usually detected in parallel within 36 h after UV treatment. p53 is thus thought to function by enforcing DNA damage checkpoints to allow time for DNA repair but which could, under extensive damage, initiate apoptosis of the cells. To elucidate the function of p53 in melanoma cell lines, we undertook analysis of p53 mutations, its stability, activation, and regulation of its target genes in response to UV radiation. We show here that of the analyzed seven melanoma cell lines, three have a mutant form of p53. Despite this, all cell lines arrest in response to UV, and apoptosis subsequently followed in four of the cell lines in a p53-independent fashion. Significantly, mRNAs for p53 target genes p21Cip1/Waf1 (p21), GADD45, and mdm2 were up-regulated also in cell lines with p53 mutations. A high level of induction of GADD45 correlated with apoptotic response. Although p53 DNA-binding activity was induced in three of four wild-type p53-expressing melanoma cells, the kinetically similar regulation of p21 and GADD45 in both wild-type and mutant p53 melanoma cells cannot fully support participation of p53 in the UV response pathway of melanoma cells. The results suggest alternative activation mechanisms for p53 target genes and question the functional role of p53 in melanoma cells.
 |
Results
|
|---|
Expression and Mutational Analysis of p53 in Melanoma Cells.
The levels of expression of p53 were analyzed by Western immunoblotting using antibody DO-1 detecting both mutant and wild-type p53. All melanoma cell lines expressed high levels of p53 with the exception of RPMI-7951 (Fig. 1A
; Table 1
). In contrast, p53 expression was significantly lower in three melanocyte cell lines, of which one is shown as an example (Fig. 1A)
. Because high levels of p53 expression have been associated with its mutant form, we undertook mutational analysis of all p53 coding exons by RT-PCR3
and direct sequencing. Compiling data from this analysis and work published previously indicated that p53 was mutated in SK-MEL-2, SK-MEL-28, and RPMI-7951 cell lines (Table 1)
and was wild-type in A-375, Malme-3M, WM239, and G361 cells (Table 1)
. In RPMI-7951, a nonsense mutation in codon 166 (ser
stop) lead to truncation of the protein. However, DO-1 antibody recognizing the NH2 terminus of p53 did not detect truncated p53 in RPMI-7951 cells (not shown). Nuclear localization of p53 was confirmed by immunofluorescence in all melanoma cells except in RPMI-7951, where p53 was absent, and the protein levels detected by Western analysis correlated well with immunofluorescence analysis of p53 (Table 1)
. As a conclusion, in all studied melanoma cells, including those harboring wild-type p53, the level of p53 was abnormally high in contrast to low or negligible levels of p53 found in normal melanocytes (Fig. 1A)
. Immunoblotting of p53 target protein p21 revealed its expression in melanoma cells with wild-type p53, whereas no protein was detected in normal melanocytes or in mutant p53 melanoma cells (Fig. 1A)
. mdm2, another target for p53, regulates p53 protein by enhancing its degradation (27
, 28)
, and on the other hand, high levels of p53 are suggested to be coupled with increased mdm2 expression (29)
. We therefore analyzed the mdm2 levels by Northern blotting. The results indicated that on the average, higher mRNA levels for mdm2 were expressed in melanoma cell lines containing wild-type p53 (mean relative levels, 3.3 versus 0.6 in wild-type and mutant p53 lines, respectively) but with a great variation (Fig. 1
, B
and C)
. There was no clear correlation between the levels of mdm2 and p53 expressed in individual melanoma cell lines.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 1. Expression levels of p53, p21, and mdm2 in melanoma cell lines. A, the expression of p53 and p21 were analyzed in melanoma cell lines by immunoblotting using specific antibodies against each. Normal melanocytes are shown as a control. B, Northern analysis for mdm2 was carried out as described in "Materials and Methods." The signals were quantitated with a PhosphorImager analyzer, levels were normalized against GAPDH, and the relative levels as compared with mdm2 expression in A-375 cells are shown. C, quantitation of mdm2 expression in Malme-3M cells was included from a separate experiment.
|
|
Growth Arrest and Apoptosis of Melanoma Cells in Response to UV Radiation.
UVC Radiation generates a replicative arrest of fibroblasts, which is followed by reentry of the cells into cycle (23
, 30
, 31) . The UV responses of melanocytes and melanoma cell lines were assessed by treating the cells with 50 J/m2 UVC and analyzing the DNA replication activity by a 5-BrdUrd pulse during the last 2 h of the incubation, followed by 5-BrdUrd immunostaining. In each cell line, DNA synthesis activity was determined 6, 16, and 24 h after the UVC treatment. As shown in Fig. 2A
, UVC radiation inhibited DNA replication in all cell lines in >60% of the cells. Growth inhibition was maximal 616 h after the radiation. Two types of responses were found; in some cells (A-375, WM239, and SK-MEL-2), including the melanocytes, the arrest was persistent after 24 h of incubation, whereas in others (G361, Malme-3M, and SK-MEL-28), the cells gradually recovered their DNA replication activity, with partial recovery of RPMI-7951 cells (Fig. 2A)
. As a marker of apoptosis, nuclear condensation and fragmentation was found at a significant level in melanoma cell lines uncapable of restoring their DNA replication activity (Fig. 2B)
. In the melanocytes, only few apoptotic nuclei were detected (Fig. 2B)
, and they entered into cycle 30 h after the radiation (not shown). The presence and absence of apoptotic cells upon UV treatment was confirmed independently by flow cytometry analysis (A0 population; not shown). Thus, the DNA damage caused growth arrest, induced by UVC (50 J/m2); the apoptotic response as well appears to be independent of the presence of wild-type p53 in these melanoma cells.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2. Effect of UVC radiation on DNA replication and cell apoptosis. Melanoma cells and melanocytes were radiated with UVC (50 J/m2) and incubated for the indicated times. A, 5-BrdUrd incorporation was determined during the last 2 h of the incubation and was detected by immunostaining. The percentage of inhibition of DNA replication represents the reduction of DNA replication in radiated cells as compared with control cells. The data shown are the average of two to three independent analyses for each cell line; bars, SD. B, percentage of condensed and fragmented nuclei was determined at the indicated times of cells fixed and stained by Hoechst 33328. The data shown are the average of two experiments for each cell line; bars, SD. Upper panels, wild-type p53 cells; lower panels, mutant p53 cells.
|
|
UVC Induces p21 Protein in Wild-Type p53 Cells.
UVC radiation induces the stabilization of p53 (22
, 24
, 25)
and leads to p53 transactivation (23
, 26)
. To address the ability of the melanoma cells to respond to UV radiation by p53 accumulation and transcriptional activation, we analyzed by immunoblotting the levels of p53 and p21 in UVC-treated melanoma cells at different time points. In melanocytes and all melanoma cells expressing wild-type p53, p53 levels increased in response to UVC (Fig. 3
; Table 2
), but there was no change in p53 mRNA in A-375, Malme-3M, or WM239 cells (not shown), indicating posttranscriptional mechanisms in p53 accumulation. Thus, although the levels of endogenous wild-type p53 are high in the melanoma cell lines, accumulation of p53 protein in response to UVC occurs as expected. In contrast, there was no further increase in the levels of mutant p53 expressed in SK-MEL-2 and SK-MEL-28 cells (Fig. 3
; Table 2
). These results were confirmed by immunofluorescence analyses, which showed that in cases where p53 induction was detectable, it accumulated in the nucleus (not shown). The expression of p21 was analyzed similarly. UVC induction of p21 protein was detected in all cells expressing wild-type p53 (melanocytes, A-375, WM239, G361, and Malme-3M) but not in any p53 mutant cells (Fig. 3)
. However, as compared with the kinetics observed in human and rodent fibroblasts (30
, 31)
, the induction, when observed, was slow, with p21 being detectable only after a 16-h incubation.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 3. Regulation of p53 and p21 protein by UVC radiation. Cells were treated with UVC (50 J/m2) and incubated for the indicated times; cellular lysates were prepared and analyzed by immunoblotting using specific p53 and p21 antibodies. Note that the exposure times for the chemiluminescence signals vary between the cell lines, and thus basal levels of the proteins cannot be directly compared.
|
|
Induction of p21, GADD45, and mdm2 mRNAs by UV Radiation Independently of p53.
To confirm the above results and to resolve the kinetics of induction, Northern analysis of the UVC-treated cells was performed. The mRNA levels for p21 and GADD45 were analyzed and normalized against GAPDH. As expected, p21 mRNA was induced in wild-type p53 cells A-375, WM239, Malme-3M, and G361 (Fig. 4A)
. Surprisingly, p21 mRNA was induced also in SK-MEL-28 cells expressing mutant p53 and which lacked p21 protein accumulation. The kinetics of mRNA induction by UVC concurred with that observed for p21 protein (Fig. 4A)
, because significant induction was detected only after a 16-h incubation. However, the fold induction in p21 mRNA of cells incubated for 24 h after UVC was greater in wild-type p53-expressing cells than in SK-MEL-28 cells (6.2- versus 2.2-fold, respectively; Fig. 4A
).

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 4. Northern analysis of UVC-treated cells. Cells were treated with UVC (50 J/m2) at the indicated times. Poly(A)+ RNA was isolated and analyzed by Northern blotting and probed with: A, p21, GADD45 and GAPDH; or B, mdm2 cDNA inserts. The fold inductions by UVC, as measured by PhosphorImager analysis after normalizing with GAPDH and compared with the control cells, are shown below each autoradiograph.
|
|
Induction of GADD45 mRNA in the UVC-treated melanoma cells differed from that of p21: (a) GADD45 mRNA was induced in all melanoma cell lines studied, including RPMI-7951, in which no p21 response was detectable; (b) GADD45 mRNA induction was kinetically very fast, taking place 6 h after UVC treatment in all cells studied (Fig. 4A)
. It is noteworthy that a strong GADD45 mRNA induction (fold induction >4) correlated with prominent apoptosis (A-375, WM239, and RPMI-7951; Fig. 4A
, Fig. 2B
, and Table 2
). These results indicate that melanoma cells have UV-stimulated p21 and GADD45 responses that are also detectable in cell lines that harbor mutant p53. The results are suggestive that GADD45 serves as a rapid DNA damage response target, its activation being independent on p53 action.
mdm2 Responses to a High Dose of UV Differ from Those of p21 and GADD45.
An initial p53-independent decrease in mdm2 is suggested to be followed by a p53-dependent increase (32)
. In all melanoma cell lines studied, except in RPMI-7951, the mRNA levels for mdm2 fell by 4090% 6 h after UV radiation (Fig. 4B)
. Subsequently, mdm2 levels increased by 1.63.3-fold in wild-type, p53-expressing melanoma lines by 24 h, and in mutant p53 cells, the levels were increased by 2.1- and 1.7-fold (RPMI-7951 and SK-MEL-28 cells, respectively; Fig. 4B
). Thus, there appears to be p53 independence also in the regulation of mdm2 by UVC.
Stimulation of p53 DNA-binding Activity by UVC Is Aberrant in G361 Melanoma Cells with Wild-Type p53.
To analyze whether the observed regulation of p21 and GADD45 by UV are dependent on p53 DNA-binding activity, gel electrophoretic mobility shift analyses were used. Nuclear extracts of UVC-treated cells were isolated at various points after the radiation and analyzed by electrophoretic mobility shift assay using either oligonucleotides from p21 promoter and GADD45 intron with p53 sequence-specific DNA-binding motifs or as a negative control, p21 promoter containing a mutant p53-binding site. The experiments were carried out in the presence or absence of p53 antibody DO-1 to demonstrate the specificity of the reaction. As shown in Fig. 5A
, UV stimulated p53 DNA-binding activity in A375 cells in gel shifts where either p21 or GADD45 oligonucleotides were used (Lanes 3 and 7). The DNA-binding activity was supershifted by DO-1 antibody (Lanes 5 and 9) but not in assays where mutant p21 oligonucleotides were used (Fig. 5A
, Lane 13). Specificity was additionally verified by using excess cold probes (Fig. 5A
, Lanes 14 and 15). The p53 UV-stimulated, sequence-specific binding to p21 oligonucleotide probe was confirmed using both DO-1 and PAb421 antibodies in A375, Malme-3M, and WM239 cells (Fig. 5B
, Lanes 2, 4, 10, 12, 14, and 16), with similar results obtained using the GADD45 probe (not shown). However, this activity was absent in RPMI-7951 and SK-MEL-2 cells (not shown) and in SK-MEL-28 cells (Fig. 5B
, Lane 18) and, surprisingly, in G361 cells expressing high levels of wild-type p53 (Fig. 5B
, Lanes 6 and 8). Although PAb421 antibody can increase DNA-binding activity of p53 (33)
, the DNA-binding activity was not stimulated by PAb421 in UV-treated G361 cells (Fig. 5B
, Lane 8). Similarly, further attempts to demonstrate p53 DNA-binding activity in G361 cells (titrations of amounts of nuclear extract, oligonucleotide probe or nonspecific competitor poly-inosinic:poly-cytidylic acid, not shown) were not successful. In A-375, Malme-3M, and WM239 cells, the UV induction of p53 DNA-binding activity to both p21 (Fig. 5C)
and GADD45 (not shown) oligonucleotides was detected by 6 h (Lanes 2, 8, and 11), the activity of which did not further increase at 16 h. The UV stimulation of p53 DNA-binding activity to p21 probe in melanocytes was similar to that of A-375, WM239, and Malme-3M (not shown).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 5. Gel mobility shift assays of UVC-treated melanoma cells. Melanoma cells were treated with UVC (50 J/m2), incubated for the indicated times, and nuclear extracts were prepared, followed by DNA-binding assays. p53 antibodies DO-1 or PAb421 were added to the reactions as indicated. A, A-375 cells were incubated for 16 h after UVC treatment, followed by binding assays using 7.5 µg of nuclear extracts and as indicated, labeled p21, GADD45, or mutant p21 oligonucleotides and DO-1 antibody. Lanes 14 and 15, 50x excess cold p21 or GADD45 oligonucleotides were added to the reactions, respectively. Lane 1, free probe alone. B, cells were incubated after UV treatment for 6 h (A375) or 16 h (G361, Malme-3M, WM239, and SK-MEL-28), and DNA-binding assays were carried out with 7.5 µg of nuclear extracts and p21 probe in the presence of either DO-1 or PAb421 antibody as indicated. C, cells were incubated for the indicated times after UV, and DNA-binding assays were carried out with p21 probe in the presence of DO-1 antibody. Nuclear extracts (7.5 µg) were used, except 2 µg for G361. -, unirradiated control cells; solid arrows, p53-DNA binding complexes; *, supershift of p53-DNA binding complexes with antibodies.
|
|
 |
Discussion
|
|---|
The results indicate defects in DNA damage response pathways that activate and stabilize p53 and in its capacity to target the genes p21, GADD45, and mdm2 in UV-damaged melanoma cell lines. All melanoma cells, irrespective of p53 status, and in contrast to normal melanocytes, expressed high basal levels of p53 with the exception of one line that contained a truncated form of the protein. Several previous studies have indicated high levels of p53 expression in primary and metastatic melanomas (19, 20, 21)
. However, studies that combine immunohistochemistry with genetic analysis of p53 have shown that in the majority of p53-positive melanomas, p53 is genetically not altered (9)
. This suggests that abnormal stabilization is a frequent property of p53 in melanoma. p53 stabilization without genetic alterations has been described in other malignancies, most prominently in teratocarcinomas (34)
, suggesting that altered stabilization and lack of transactivation capacity may pose a risk for loss-of-function (35
, 36)
. Because mdm2 is implicated in the degradation of p53 (27
, 28)
, we analyzed its expression as a possible factor affecting p53 expression in the melanoma cell lines under study here. mdm2 mRNA levels were found to be generally higher in melanoma cell lines expressing wild-type than mutant p53, but there was no clear correlation between p53 and mdm2 levels in individual cell lines. Other factors besides mdm2 that may affect p53 levels and/or activity are p14ARF (37)
, HMG-1 (38)
, and ref-1 (39)
.
In the melanomas described here, the response of p53 to UV radiation was an expected one, in the sense that enhanced amounts of protein were found in all lines expressing wild-type but not mutant p53. However, the cellular responses to DNA damage, i.e., inhibition of DNA replication and apoptosis, ensued in a manner independent of p53. DNA replication ceased in all melanoma cells studied, followed by apoptosis in four melanoma lines, two of which had wild-type and two mutant p53.
To resolve whether p53 maintains its properties as a transcriptional activator in the melanoma cells, we undertook analysis of regulation of p53 target genes by UV. As shown by immunoblotting analysis in Fig. 3
, p21 was induced in melanocytes and all melanoma cell lines with wild-type p53. The induction was, however, slow, with enhanced levels of protein being detectable only 16 h after treatment, whereas in human and rodent fibroblasts, the induction takes <6 h (23
, 30
, 31)
. As expected, p21 mRNA was induced in all wild-type melanoma cell lines but also in SK-MEL-28, which harbors mutant p53. In all melanomas, p21 mRNA induction was slow, similarly to that observed for the regulation of the protein expression. The fold induction of p21 mRNA 24 h after UV treatment in SK-MEL-28 cells was, however, markedly less than in melanoma lines with wild-type p53 (2- versus 6-fold). The finding that p21 is induced also in melanoma cells that carry a mutated p53, and in the case of RPMI-7951 no p53 protein, suggests that there are alternative UV-activated routes for p21 induction. This is supported by our finding that p21 is induced by UVC also in p53 null fibroblasts4
and in human fibroblasts with mutant p53 (40)
.
In parallel to p21 regulation, the induction of GADD45 was p53 independent. GADD45 was induced in all wild-type, p53-expressing melanoma lines but also in SK-MEL-28 and RPMI-7951 that express mutant or no p53 protein, respectively. In contrast to p21, GADD45 was induced in all melanoma cells within 6 h after UV treatment independent of p53 status. Similarly, comparison of levels of mean induction at the studied time points showed no major difference in wild-type and mutant p53 lines. GADD45 regulation by UV is thus dissociated from p53 activity in these melanoma cell lines, the independency of which has been shown also earlier in p53 null fibroblasts (41)
. However, apoptosis was found to correlate not with p53 but with high (>4-fold) induction of GADD45. In melanoma cells the regulation of GADD45 by UV is opposite to that observed by
-radiation. In
-radiated melanoma cells, the GADD45 response is attenuated or absent, regardless of the p53 status (13)
. This suggests that GADD45 is a primary UV response gene activated independently of p53 but which displays p53-dependent responses to
-radiation in other tumor types (42)
.
Analysis for UV-stimulated p53 sequence-specific DNA-binding activity in the melanoma cell lines showed that p53 DNA-binding activity was stimulated in three wild-type, p53-expressing cell lines, whereas this activity was absent in G361 cells and the mutant p53-expressing cells. Similar results were obtained using p53-response elements from both p21 and GADD45 genes. COOH-terminal antibody PAb421, which relieves the interaction between the basic COOH terminus and the core of the protein and exposes p53 sequence-specific DNA-binding domain (33)
, was, however, incapable in stimulating p53 DNA-binding activity in G361 cells. This indicates that in G361 cells, the p53 DNA-binding activity cannot be stimulated by UV, suggesting that the p53 function is inactivated. Although p53 DNA-binding activity to both p21 and GADD45 oligonucleotides is stimulated by UV, we cannot exclusively ascribe the inductions of the respective mRNAs to p53 because: (a) DNA-binding activity to p21 oligonucleotides was detected at 6 h after UV, whereas p21 mRNA induction was delayed to 16 h; and (b) these target genes were regulated in an indistinguishable manner in the p53 mutant cell lines. Jointly, although these results suggest that p53 activity may be required for certain aspects of p21 and GADD45 regulation, like a higher level of induction of p21, there are indications that p53 functions are altered in the studied melanoma cells.
p53 is infrequently mutated in malignant melanoma, and its mutations are found at much higher frequencies in non-melanoma skin cancers. The role of UV radiation as a causative effect of melanoma is debated, but the type of mutations detected at dipyrimidine sites frequently concur with the damage event being UV light (9
, 14
, 17)
. Of the metastatic melanoma cell lines studied here, p53 mutations were detected in three of seven lines. However, the UV responses documented for wild-type p53, stabilization and activation of sequence-specific DNA-binding, were hampered in all but three melanoma cell lines. Furthermore, the observed induction of its target genes did not fully support the activation being dependent on p53; because no p53 DNA-binding activity to either p21 or GADD45 promoter sites was detected in one line, the observed kinetics of p21 induction and the gel shift analyses were discordant in all wild-type p53 lines, and GADD45, p21, and mdm2 mRNAs were induced also in cells expressing mutant p53. The studies presented here indicate that the activation of p53 observed in melanoma cell lines in response to UV does not correlate with the regulation of its target genes, suggesting functional inactivation. A high level of p53 expression in several different tumor cell lines including melanomas is, however, associated with enhanced mdm2 expression but has no effect on p21 or GADD45 transcription (29)
. A similar correlation between high levels of expression of p53 and mdm2 has been observed also in some osteosarcomas (43)
and bladder carcinomas (44)
. The high levels of p53 expression in the presence of high levels of mdm2 may thus be tolerated as a result of functional inactivation. Similarly, in the melanomas studied here, higher mdm2 levels were found in those cells with wild-type p53. Therefore, increased levels of mdm2 or other p53-binding proteins may render p53 functionally inactive although stable. The mechanisms for possible inactivation of p53 in melanoma remain to be elucidated, but it seems that the protein is characterized by several abnormalities in its damage response pathways: direct p53 mutations, aberrantly high levels of protein expression, incapacity to gene transactivation, and altered target gene activation or kinetics.
 |
Materials and Methods
|
|---|
Cell Culture and UV Treatment.
Melanoma cell lines A-375, RPMI-7951, SK-MEL-2, SK-MEL-28, WM239, G361, and Malme-3M were obtained from American Type Culture Collection. Melanoma cells were cultured in DMEM (Life Technologies, Inc.) in the presence of 10% FCS (Life Technologies, Inc.) at 37°C in a humidified atmosphere containing 5% CO2. Primary human skin derived melanocytes were a generous gift of Dr. Olli Saksela. Melanocyte cultures were verified to be 100% pure by S-100 marker immunostaining and were cultured in F-12 medium containing 10% FCS, 3 ng/ml FGF-2, 10 ng/ml phorbol 12-myristate acetate, and 1 µg/ml cholera toxin. Melanocytes were used up to passage 10. Cells were UVC-radiated at 254 nm with Stratalinker 2400 (Stratagene) at a dose of 50 J/m2. DNA replication of cells was measured by 5-BrdUrd (Sigma; 50 µM) incorporation, followed by immunostaining (30)
. Apoptotic nuclear condensation and fragmentation was determined at the same time and visualized with Hoechst 33328 DNA dye.
Immunoblotting Analysis.
Immunoblotting assays were carried out as described earlier (30)
. Briefly, cells were lysed in 25 mM Tris-HCl buffer (pH 8.0) containing 120 mM NaCl, 0.5% NP40, 4 mM NaF, 100 µM Na3VO4, 100 KIU/ml aprotinin, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml leupeptin. Protein concentrations were determined by Bio-RadDC Protein assay. Lysates (150 µg) were analyzed by 12.5% SDS-PAGE, followed by transfer of proteins to Immobilon-P membrane (Millipore). Membranes were probed with monoclonal antibodies DO-1 against p53 and 6B6 against p21 (PharMingen), followed by horseradish peroxidase-conjugated rabbit anti-mouse antibodies and detection with enhanced chemiluminescence (ECL; Amersham). Equal loading was verified by staining of parts of the gel by Coomassie Brilliant Blue-R.
Northern (RNA) Blot Analysis.
Isolation of poly(A)+ RNA and Northern analysis was carried out as described earlier (30)
. RNA was detected by probing with p21 (45)
or GADD45 inserts (46)
labeled with [
-32P]dCTP by random priming. Autoradiograms were quantitated with Fujifilm BAS-1500 Image Analyzer and the MacBAS 2.1 program. mRNA levels were normalized to the level of GAPDH, and fold inductions were calculated by comparing the signals of UV-treated and control cells.
Electrophoretic Gel Mobility Shift Assays.
Nuclear extracts were prepared as described (47)
. Double-stranded oligonucleotide probes representing consensus p53-binding site in p21 gene promoter were prepared as described and labeled with 32P (48)
. Mutant p53-binding site was synthesized and prepared similarly. Binding reactions contained the indicated amount of nuclear extract, 10 µl of 2x binding buffer [40 mM Hepes-KOH (pH 7.9), 50 mM KCl, 0.2 mM EDTA, 20% glycerol, 4 mM MgCl, 1 mM DTT, 0.05% NP40, 4 mM spermidine (Sigma), and 400 ng of poly(deoxyinosinic-deoxycytidylic acid) (Pharmacia)] and, if indicated, 500 ng of monoclonal antibody in a final volume of 20 µl. PAb421 antibody was from Calbiochem. Reactions were incubated at room temperature for 20 min, 0.2 ng of labeled oligonucleotide probe was added, and the incubation was continued for an additional 20 min. Reaction products were separated on a 4% nondenaturing polyacrylamide gel with 5% glycerol in 0.25x Tris-borate-EDTA buffer at 4°C. The gel was dried and exposed to X-ray film.
p53 Sequencing.
p53 coding exons 111 were sequenced from cDNA generated by RT-PCR. For RT-PCR, two sets of primers generating a NH2-terminal, 774-bp fragment (forward primer, CTGCTGGGCTCCGGGGACACTTTG; reverse primer, AGGCGGCTCATAGGGCACCACCAC) and a COOH-terminal 890-bp fragment (forward primer, TACTCCCCTGCCCTCAACAAGATG; reverse primer, TTCAAAGACCCAAAACCCAAAATG) were used. cDNA was sequenced from both strands using automated DNA sequencing. The sequences were compared against p53 cDNAs in the databases.
 |
Acknowledgments
|
|---|
Dr. Olli Saksela is kindly acknowledged for providing melanocyte cell lines.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by the Academy of Finland and the Finnish Cancer Organizations. 
2 To whom requests for reprints should be addressed, at Department of Virology, Haartman Institute, University of Helsinki, P. O. Box 21 (Haartmaninkatu 3), FIN-00014 Helsinki, Finland. Phone: (358)-9-1912 6509; Fax: (358)-9-1912 6491; E-mail: Marikki.Laiho{at}Helsinki.FI 
3 The abbreviations used are: RT-PCR, reverse transcription-PCR; 5-BrdUrd, 5-bromo-2'-deoxyuridine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. 
4 T. Haapajärvi, L. Kivinen, A. Heiskanen, C. des Bordes, M. B. Datto, X-F. Wang, and M. Laiho, unpublished results. 
Received for publication 9/24/98.
Revision received 11/23/98.
Accepted for publication 1/ 7/99.
 |
References
|
|---|
-
Paulovich A. G., Toczyski D. P., Hartwell L. H. When checkpoints fail. Cell, 88: 315-321, 1997.[Medline]
-
Ziegler A., Leffell D. J., Kunala S., Sharma H. W., Gailani M., Simon J. A., Halperin A. J., Baden H. P., Shapiro P. E., Bale A. E., Brash D. E. Mutation hotspot due to sunlight in the p53 gene of nonmelanoma skin cancers. Proc. Natl. Acad. Sci. USA, 90: 4216-4220, 1993.[Abstract/Free Full Text]
-
Nakazawa H., English D., Randell P. L., Nakazawa K., Martel N., Armstrong B. K., Yamasaki H. UV and skin cancer: specific p53 gene mutation in normal skin as a biologically relevant exposure measurement. Proc. Natl. Acad. Sci. USA, 91: 360-364, 1994.[Abstract/Free Full Text]
-
Pollock P. M., Pearson J. V., Hayward N. K. Compilation of somatic mutations of the CDKN2 gene in human cancers: non-random distribution of base substitutions. Genes Chromosomes Cancer, 15: 77-88, 1996.[Medline]
-
Castellano M., Pollock P. M., Walters M. K., Sparrow L. E., Down L. M., Gabrielli B. G., Parsons P. G., Hayward N. CDKN2A/p16 is inactivated in most melanoma cell lines. Cancer Res., 57: 4868-4875, 1997.[Abstract/Free Full Text]
-
Tornaletti S., Pfeifer G. P. Slow repair of pyrimidine dimers at p53 mutation hotspots in skin cancer. Science (Washington DC), 263: 1436-1438, 1994.[Abstract/Free Full Text]
-
Ziegler A., Jonason A. S., Leffell D. J., Simon J. A., Sharma H. W., Kimmelman J., Remington L., Jacks T., Brash D. E. Sunburn and p53 in the onset of skin cancer. Nature (Lond.), 372: 773-776, 1994.[Medline]
-
Ananthaswamy H. N., Loughlin S. M., Cox P., Evans R. L., Ullrich S. E., Kripke M. L. Sunlight and skin cancer: inhibition of p53 mutations in UV-irradiated mouse skin by sunscreens. Nat. Med., 3: 510-514, 1997.[Medline]
-
Hartmann A., Blaszyk H., Cunningham J. S., McGovern R. M., Schroeder J. S., Helander S. D., Pittelkow M. R., Sommer S. S., Kovach J. S. Overexpression and mutations of p53 in metastatic malignant melanomas. Int. J. Cancer, 67: 313-317, 1996.[Medline]
-
Fl
rens V. A., Îyjord T., Holm R., Skrede M., B
rresen A. L., Nesland J. M., F
dstad Î. TP53 allele loss, mutations and expression in malignant melanoma. Br. J. Cancer, 69: 253-259, 1994.[Medline]
-
Akslen L. A., M
nstad S. E., Larsen B., Straume Î., Îgreid D. Frequent mutations of the p53 gene in cutaneous melanoma of the nodular type. Int. J. Cancer, 79: 91-95, 1998.[Medline]
-
Albino A. P., Vidal M. J., McNutt N. S., Shea C. R., Prieto V. G., Nanus D. M., Palmer J. M., Hayward N. K. Mutation and expression of the p53 gene in human malignant melanoma. Melanoma Res., 4: 35-45, 1994.[Medline]
-
Bae I., Smith M. L., Sheikh M. S., Zhan Q., Scudiero D. A., Friend S. H., O`Connor P. M., Fornace A. J., Jr. An abnormality in the p53 pathway following
-radiation in many wild-type p53 human melanoma cell lines. Cancer Res., 56: 840-847, 1996.[Abstract/Free Full Text]
-
Weiss J., Heine M., Arden K. C., Korner B., Pilch H., Herbst R. A., Jung E. G. Mutation and expression of TP53 in malignant melanomas. Recent Results Cancer Res., 139: 137-154, 1995.[Medline]
-
Beroud C., Soussi T. p53 gene mutation: software and database. Nucleic Acids Res., 26: 200-204, 1998.[Abstract/Free Full Text]
-
Levin D. B., Wilson K., Valadares de Amorim G., Webber J., Kenny P., Kusser W. Detection of p53 mutations in benign and dysplastic nevi. Cancer Res., 55: 4278-4282, 1995.[Abstract/Free Full Text]
-
Lee J. Y., Dong S. M., Shin M. S., Kim S. Y., Lee S. H., Kang S. J., Lee J. D., Kim C. S., Kim S. H., Yoo N. J. Genetic alterations of p16INK4a and p53 genes in sporadic dysplastic nevus. Biochem. Biophys. Res. Commun., 237: 667-672, 1997.[Medline]
-
Samsher M., Montano X. Analysis of intron 4 of the p53 gene in human cutaneous melanoma. Gene (Amst.), 176: 259-262, 1996.[Medline]
-
Lassam N. J., From L., Kahn H. J. Overexpression of p53 is a late event in the development of malignant melanoma. Cancer Res., 53: 2235-2238, 1993.[Abstract/Free Full Text]
-
McGregor J. M., Yu C. C., Dublin E. A., Barnes D. M., Levison D. A., MacDonald D. M. p53 immunoreactivity in human malignant melanoma and dysplastic nevi. Br. J. Dermatol., 128: 606-611, 1993.[Medline]
-
Fl
rens V. A., Holm R., F
dstad [/oe]. Accumulation of p53 protein in human malignant melanoma. Melanoma Res., 5: 183-187, 1995.[Medline]
-
Fritsche M., Haessler C., Brandner G. Induction of nuclear accumulation of the tumor-suppressor protein p53 by DNA-damaging agents. Oncogene, 8: 307-318, 1993.[Medline]
-
Lu X., Lane D. P. Differential induction of transcriptionally active p53 following UV or ionizing radiation: defects in chromosome instability syndromes?. Cell, 75: 765-778, 1993.[Medline]
-
Maltzman W., Czyzyk L. UV irradiation stimulate levels of p53 cellular tumor antigen in nontransformed mouse cells. Mol. Cell. Biol., 4: 1689-1694, 1984.[Abstract/Free Full Text]
-
Hall P. A., McKee P. H., Menage H. D., Dover R., Lane D. P. High levels of p53 protein in UV-irradiated normal human skin. Oncogene, 8: 203-207, 1993.[Medline]
-
Zhan Q., Carrier F., Fornace A. J. J. Induction of cellular p53 activity by DNA-damaging agents and growth arrest. Mol. Cell. Biol., 13: 4242-4250, 1993.[Abstract/Free Full Text]
-
Haupt Y., Maya R., Kazaz A., Oren M. MDM2 promotes rapid degradation of p53. Nature (Lond.), 387: 296-299, 1997.[Medline]
-
Kubbutat M. H. G., Jones S. N., Vousden K. H. Regulation of p53 stability by MDM2. Nature (Lond.), 387: 299-303, 1997.[Medline]
-
Landers J. E., Cassel S. L., George D. L. Translational enhancement of mdm2 oncogene expression in human tumor cells containing a stabilized wild-type p53 protein. Cancer Res., 57: 3562-3568, 1997.[Abstract/Free Full Text]
-
Haapajärvi T., Kivinen L., Pitkänen K., Laiho M. Cell cycle dependent effects of UV-radiation on p53 expression and retinoblastoma protein phosphorylation. Oncogene, 11: 151-159, 1995.[Medline]
-
Haapajärvi T., Pitkänen K., Tsubari M., Laiho M. p53 transactivation and protein accumulation are independently regulated by UV light in different phases of the cell cycle. Mol. Cell. Biol., 17: 3074-3080, 1997.[Abstract]
-
Wu L., Levine A. Differential regulation of the p21/WAF-1 and mdm2 genes after high-dose UV irradiation: p53-dependent and p53-independent regulation of the mdm2 gene. Mol. Med., 3: 441-451, 1997.[Medline]
-
Hupp T. R., Sparks A., Lane D. P. Small peptides activate the latent sequence-specific DNA binding function of p53. Cell, 83: 237-249, 1995.[Medline]
-
Lutzker S., Levine A. J. A functionally inactive p53 protein in embryonal carcinoma cells is activated by DNA damage or cellular differentiation. Nat. Med., 2: 804-810, 1996.[Medline]
-
Ko L. J., Prives C. p53: puzzle and paradigm. Genes Dev., 10: 1054-1072, 1996.[Free Full Text]
-
Levine A. J. p53, the cellular gatekeeper for growth and division. Cell, 88: 323-331, 1997.[Medline]
-
Sherr C. J. Tumor surveillance via the ARF-p53 pathway. Genes Dev., 12: 2984-2991, 1998.[Free Full Text]
-
Jayamaran L., Moorthy N. C., Murthy K. G. K., Manley J. L., Bustin M., Prives C. High mobility group protein-1 (HMG-1) ia a unique activator of p53. Genes Dev., 12: 462-472, 1998.[Abstract/Free Full Text]
-
Jayamaran L., Murthy K. G. K., Zhu C., Curran T., Xanthoudakis S., Prives C. Identification of redox/repair protein Ref-1 as a potent activator of p53. Genes Dev., 11: 558-570, 1997.[Abstract/Free Full Text]
-
Loignon M., Fetni R., Gordon A. J., Drobetsky E. A. A p53-independent pathway for induction of p21waf1cip1 and concomitant G1 arrest in UV-irradiated skin fibroblasts. Cancer Res., 57: 3390-3394, 1997.[Abstract/Free Full Text]
-
Kearsey J. M., Coates P. J., Prescott A. R., Warbrick E., Hall P. A. Gadd45 is a nuclear cell cycle regulated protein which interacts with p21Cip1. Oncogene, 11: 1675-1683, 1995.[Medline]
-
Kastan M. B., Zhan Q., El-Deiry W. S., Carrier F., Jacks T., Walsh W. V., Plunkett B. S., Vogelstein B., Fornace A. J. J. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell, 71: 587-597, 1992.[Medline]
-
Cordon-Cardo C., Latres E., Drobnjak M., Oliva M. R., Pollack D., Woodruff J. M., Marechal V., Chen J., Brennan M. F., Levine A. J. Molecular abnormalities of mdm2 and p53 genes in soft tissue sarcomas. Cancer Res., 54: 794-799, 1994.[Abstract/Free Full Text]
-
Lianes P., Orlow I., Zhang Z-F., Oliva M. R., Sarkis A. S., Reuter V. E., Cordon-Cardo C. Altered patterns of MDM2 and TP53 expression in human bladder cancer. J. Natl. Cancer Inst., 86: 1325-1330, 1994.[Abstract/Free Full Text]
-
El-Deiry W. S., Tokino T., Velculescu V. E., Levy D. B., Parsons R., Trent J. M., Lin D., Mercer W. E., Kinzler K. W., Vogelstein B. WAF1, a potential mediator of p53 tumor suppression. Cell, 75: 817-825, 1993.[Medline]
-
Fornace A. J., Jr., Alamo I., Hollander M. C. DNA damage-inducible transcripts in mammalian cells. Proc. Natl. Acad. Sci. USA, 85: 8800-8804, 1988.[Abstract/Free Full Text]
-
Andrews N. C., Faller D. V. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res., 19: 2499 1991.[Free Full Text]
-
Pitkänen K., Haapajärvi T., Laiho M. UVC-induction of p53 activation and accumulation is dependent on cell cycle and pathways involving protein synthesis and phosphorylation. Oncogene, 16: 459-469, 1998.[Medline]
-
Montano X., Shamsher M., Whitehead P., Dawson K., Newton J. Analysis of p53 in human cutaneous melanoma cell lines. Oncogene, 9: 1455-1459, 1994.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
E. Sala, L. Mologni, S. Truffa, C. Gaetano, G. E. Bollag, and C. Gambacorti-Passerini
BRAF Silencing by Short Hairpin RNA or Chemical Blockade by PLX4032 Leads to Different Responses in Melanoma and Thyroid Carcinoma Cells
Mol. Cancer Res.,
May 1, 2008;
6(5):
751 - 759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. A. Zykova, F. Zhu, C. Lu, L. Higgins, Y. Tatsumi, Y. Abe, A. M. Bode, and Z. Dong
Lymphokine-Activated Killer T-Cell-Originated Protein Kinase Phosphorylation of Histone H2AX Prevents Arsenite-Induced Apoptosis in RPMI7951 Melanoma Cells
Clin. Cancer Res.,
December 1, 2006;
12(23):
6884 - 6893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. K. Koblish, S. Zhao, C. F. Franks, R. R. Donatelli, R. M. Tominovich, L. V. LaFrance, K. A. Leonard, J. M. Gushue, D. J. Parks, R. R. Calvo, et al.
Benzodiazepinedione inhibitors of the Hdm2:p53 complex suppress human tumor cell proliferation in vitro and sensitize tumors to doxorubicin in vivo
Mol. Cancer Ther.,
January 1, 2006;
5(1):
160 - 169.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Hussein
Apoptosis in the ovary: molecular mechanisms
Hum. Reprod. Update,
March 1, 2005;
11(2):
162 - 178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Stanhope-Baker, P. M. Kessler, W. Li, M. L. Agarwal, and B. R. G. Williams
The Wilms Tumor Suppressor-1 Target Gene Podocalyxin Is Transcriptionally Repressed by p53
J. Biol. Chem.,
August 6, 2004;
279(32):
33575 - 33585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tiainen, K. Vaahtomeri, A. Ylikorkala, and T. P. Makela
Growth arrest by the LKB1 tumor suppressor: induction of p21WAF1/CIP1
Hum. Mol. Genet.,
June 15, 2002;
11(13):
1497 - 1504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Loignon and E. A. Drobetsky
The initiation of UV-induced G1 arrest in human cells is independent of the p53/p21/pRb pathway but can be attenuated through expression of the HPV E7 oncoprotein
Carcinogenesis,
January 1, 2002;
23(1):
35 - 45.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Girnita, A. Girnita, B. Brodin, Y. Xie, G. Nilsson, A. Dricu, J. Lundeberg, J. Wejde, A. Bartolazzi, K. G. Wiman, et al.
Increased Expression of Insulin-like Growth Factor I Receptor in Malignant Cells Expressing Aberrant p53: Functional Impact
Cancer Res.,
September 1, 2000;
60(18):
5278 - 5283.
[Abstract]
[Full Text]
|
 |
|