| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cell Growth & Differentiation |
Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan 52900, Israel
| Abstract |
|---|
|
|
|---|
The nuclear translocation of the FER proteins is driven by a nuclear localization signal (NLS), which is located within the kinase domain of these enzymes. The functioning of that NLS depends on the integrity of the kinase domain but was not affected by inactivation of the kinase activity. The NH2 terminus of p94fer dictated the cell cycle-dependent functioning of the NLS of FER kinase. This process was governed by coiled-coil forming sequences that are present in the NH2 terminus of the kinase. The regulatory effect of the p94fer NH2-terminal sequences was not affected by kinase activity but was perturbed by mutations in the kinase domain ATP binding site.
Ectopic expression of the constitutively nuclear p51ferT in CHO cells interfered with S-phase progression in these cells. This was not seen in p94fer-overexpressing cells. The FER tyrosine kinases seem, thus, to be regulated by novel mechanisms that direct their different subcellular distribution profiles and may, consequently, control their cellular functioning.
| Introduction |
|---|
|
|
|---|
p94fer is an evolutionarily conserved (9 , 10) nonreceptor tyrosine kinase that is encoded by the FER locus in human (11) , mouse (12) , rat (13) , and Drosophila (10) . The presence of p94fer has been documented in most mammalian cell lines analyzed (11 , 13) , but it was not detected in pre-B, pre-T, and T cells (14) . The subcellular localization pattern of p94fer is, however, less conclusively defined, and in some cell lines, it was found to reside in both the cytoplasm and nucleus of cells (15 , 16) . In the cytoplasm, p94fer associates with cell-cell adhesion molecules (17 , 18) , and its activity is induced in growth factor-stimulated cells (16) .
A truncated form of p94fer, termed p51ferT, is encoded by a testis-specific FER transcript. This tyrosine kinase was shown to accumulate in the nucleus of meiotic pachytene spermatocytes (12 , 19 , 20) .
p51ferT and p94fer differ in their NH2 termini, but they do share common SH2 and kinase domains (Fig. 1A
; Refs. 11
and 12
). The FER kinase domain (11
, 13)
is 70 and 50% homologous to the kinase domains of two other nonreceptor tyrosine kinases, c-Fes (21, 22, 23)
and c-Abl (24)
, respectively. Both c-fes (23)
and c-Abl (24)
were shown to reside in the cytoplasm and nucleus of mammalian cells.
|
The basic element that drives the nuclear accumulation of proteins in eukaryotic cells is the NLS3
(28)
. This positively charged element mediates the interaction of the nuclear transporting factor importin-
with the protein to be translocated (29
, 30)
. The function of the NLS was shown to be constitutive in some proteins and tightly regulated in others (31)
. The nuclear accumulation of a cellular protein could be regulated, however, not only by an import process to the nucleus but also by an active export mechanism that is mediated by leucine-rich NESs (32
, 33)
.
To further the understanding of the cellular role of p94fer and, thereby, extend the knowledge of the functions of other nuclear tyrosine kinases, a detailed analysis of the subcellular distribution pattern of this enzyme was carried out. The subcellular localization of p94fer was determined in both primary fibroblasts and fibroblastic cell lines.
In parallel, a functional assay was applied to identify elements that direct the regulated subcellular distribution of the FER proteins. This revealed unique features that imply the involvement of novel mechanisms in the regulation of the subcellular localization of mammalian tyrosine kinases.
| Results |
|---|
|
|
|---|
-HA monoclonal antibody offered us an efficient and reliable follow-up tool for detection of the expressed FER proteins. p51ferT was shown previously to accumulate in the nucleus of spermatogenic cells (20)
. Similarly, ectopic expression of p51ferT in growing primary fibroblasts confirmed the preferred accumulation of p51ferT in the cell nucleus (Fig. 1Bc)
60% of the transfected cells, in about 23% of the cells, it was equally distributed between the nucleus and the cytoplasm (Table 1
|
|
|
-HA monoclonal antibody. Actively growing COS1 cells exhibited heterogeneous subcellular distribution profile of the exogenous p94fer (Table 1
48% of the cells showed similar staining in the cytoplasm and in the nucleus (Table 1)
37% showed similar staining in the cytoplasm and in the nucleus (Table 1)
As was found in growth-arrested cells, the accumulation of p51ferT in the actively growing COS1 (Fig. 2A, e, f, and h
), BHK21 (data not shown), and CHO (data not shown) cells was restricted to the cell nucleus. The subcellular distribution profile of p94fer seems, therefore, to be cell cycle dependent, and it differs in growth-arrested and actively growing cells. The subcellular localization of the meiotic p51ferT kinase is not affected, however, by cell growth, and it accumulates constitutively in the cell nucleus.
Nuclear Accumulation of p94fer Coincides with Onset of S Phase.
To determine at what stages of the cell cycle p94fer is translocated to the cell nucleus, we adopted two approaches. In the first, cells were grown in the presence of aphidicolin. This drug inhibits the activity of DNA polymerase
and consequently inhibits S-phase progression, thus arresting the cells at the G1-S transition stage (34)
. The cells were transiently transfected with the p94fer expression plasmids and were then exposed to the drug for the last 20 h before fixation. Treating the three cell lines with aphidicolin significantly enriched the percentage of cells that exhibited preferential accumulation of p94fer in the nucleus. In CHO cells, this treatment led to the preferential accumulation of p94fer in the nuclei of 82% of the transfected cells (Table 2)
, whereas only 23% of the untreated cells exhibited that distribution profile (Table 2)
. p94fer was present preferentially in the cytoplasm of only 3% of the transfected and treated cells, compared to 40% of the nontreated cells that exhibited cytoplasmic accumulation of p94fer (Table 2)
. Similar results were obtained with transfected and aphidicolin-treated BHK21 and COS1 cells (data not shown). Releasing the CHO cells from aphidicolin treatment for 3 h, a procedure that allowed the entrance of 8090% of the cells into S phase (data not shown), did not significantly change the subcellular distribution profiles of p94fer in the treated cells (Table 2)
, thus suggesting that the accumulation of p94fer in the nucleus persist throughout S progression. The prominent effect of aphidicolin treatment on the percentage of transfected cells that exhibited preferential nuclear accumulation of p94fer, suggested that the enzyme is translocated to the nucleus concomitantly with the progression of cells through G1 and toward the onset of S phase.
|
-HA and
-BrdUrd monoclonal antibodies. All of the cells that exhibited preferential cytoplasmic accumulation of p94fer did not show incorporation of BrdUrd (Fig. 2B)
Kinase Domain Integrity Affects the Nuclear Accumulation of the FER Tyrosine Kinases.
To identify functional elements that direct the different behavior of the FER kinases, various deletions and mutations were introduced in the FER cDNAs, and the effects of these modifications on the subcellular distribution profile of the FER proteins were analyzed. p51ferT carries a 43-aa NH2-terminal tail, which is absent from p94fer (Fig. 1A
; Ref. (12)
) and which could contribute to its constitutive nuclear accumulation. Removal of that region did not affect the nuclear accumulation of p51ferT (Fig. 3, Ac and B
, ferT
158). This suggested that a common NLS directs the nuclear accumulation of the two FER proteins.
To narrow down the segment that carries the FER NLS, we then introduced serial deletions in the common kinase domain (Fig. 1A)
of p51ferT and p94fer. Removal of the last 147 aa of either p51ferT or p94fer (Fig. 3B
, ferT
307453 and fer
677823, respectively) interfered with the nuclear translocation of the FER proteins and led to the retainment of the truncated kinases in the cytoplasm (Fig. 3B)
. Deletion of the last 66 COOH-terminal aa gave the same results (Fig. 3, Ad and B
, ferT
388453 and fer
758823). Surprisingly, the same effect was obtained when the extreme 8 COOH-terminal aa were removed from both p51ferT and p94fer (Fig. 3, Af and B
, ferT
446453 and fer
816823, respectively). This raised the possibility of the existence of a NLS at the COOH terminus of p51ferT and p94fer. Examination of the sequence of the last 8 aa (TVIKKMIT) of the FER enzymes did not reveal any potential NLS (28)
but, because a cluster of basic aa is a common feature in NLS (28)
, we decided to mutate the two adjacent lysines in the middle of that segment. Replacing these two lysines with glutamines did not change the constitutive nuclear accumulation of p51ferT (see
Fig. 6B
, ferT KK449/50QQ). This disproved the possible functioning of the 8 COOH-terminal aa of the FER proteins as a part of a common NLS. These results indicate that causing deletions in the kinase domain of the FER proteins, even without introducing mutations in a potential NLS, interfered with the ability of these kinases to enter the nucleus. To further test this possibility, we introduced two additional deletions in the kinase domain of p51ferT and p94fer. One of these was in the kinase small lobe (Fig. 3B
, ferT
224264 and fer
594634, respectively), and the other was in the kinase domain large lobe (Fig. 3B
, ferT
315386 and fer
685756, respectively; Ref. (35)
. None of the deleted sequences contain potential NLS elements (28)
, yet all four deletions prevented the nuclear accumulation of the truncated FER proteins (Fig. 3, Ae and B)
. The cytoplasmic retention caused by all of the above described modifications suggested that either kinase domain integrity or kinase activity are essential for the nuclear accumulation of the FER proteins. This could be supported by the fact that all of the above described deletions, including the minimal removal of the last 8 COOH-terminal aa of the FER proteins, abolished the autophosphorylation activity of the FER proteins (Fig. 4A
, Lane 3). To discriminate between the role of kinase domain integrity and kinase activity in nuclear translocation of the FER proteins, we introduced loss-of-function mutations in the FER kinases. The absolutely conserved catalytic Asp-685 in p94fer (Asp-315 in p51ferT), which has been proposed to act as a base that activates the incoming substrate hydroxyl (36
, 37)
, was changed to glutamic acid for the two proteins. These mutations, which lowered the autophosphorylation activity of p94fer by an order of magnitude (data not shown), did not affect the subcellular localization of either p51ferT or of p94fer (Fig. 5, Ac and B
, ferT D315E and fer D685E, respectively). This proved the decoupling between kinase activity and nuclear accumulation of the FER proteins. Thus, kinase domain integrity rather than kinase activity plays a role in nuclear translocation of the FER proteins.
|
|
|
80% (42)
. However, replacing Val-578 in p94fer with aspartic acid drove a constitutive and deregulated cytoplasmic accumulation of p94fer. The corresponding mutation did not affect the constitutive nuclear accumulation of p51ferT (Fig. 5B
A lysine residue positioned 21 aa COOH-terminally to the Gly-571 has also been implicated in binding of ATP, although its main function has been linked to transfer of
-phosphate by coordinating two phosphate oxygens of ATP (43, 44, 45)
. Replacement of that lysine with Arg or Asn (Fig. 5B
, fer K592R and fer K592N, respectively) impaired the autophosphorylation activity of p94fer (Fig. 4B
, Lanes 5 and 6, respectively) and enhanced, though not in a drastic way, the deregulated nuclear accumulation of p94fer. Overall, these results suggest a good correlation between impairment of ATP binding and deregulated subcellular accumulation of p94fer. This effect, however, was not seen on the constitutive nuclear accumulation of p51ferT.
The autophosphorylation site in the kinase domain activation loop was shown to modulate, in addition to substrate entrance, ATP binding in the insulin receptor (46)
. This does not occur in the fibroblast growth factor receptor (45)
. We, therefore, analyzed the role of the p94fer autophosphorylation site on the nuclear accumulation of that kinase. Tyr-715 is the major autophosphorylation site in p94fer (Fig. 4B
, Lane 2). Replacing this residue with phenylalanine, which is supposed to mimic the unphosphorylated state of Tyr-715 (Fig. 5B
, fer Y715F), however, did not affect the nuclear entrance of either p94fer (Fig. 5, Ad and B
, fer Y715F) or p51ferT (Fig. 5B
, ferT Y345F). Changing Tyr-715 or Tyr-345 to glutamic acid, in p94fer and p51ferT (fer Y715E and ferT Y345E, respectively), which is supposed to mimic the autophosphorylation state of p94fer, failed to affect the nuclear accumulation of the FER proteins (Fig. 5B)
. Thus, binding of ATP rather than phosphorylation activity affects the cell cycle-regulated subcellular distribution of p94fer.
A Monopartite NLS Resides in the Kinase Domain of the FER Proteins.
The fact that both kinase domain integrity and ATP binding affected the nuclear accumulation of the FER proteins implied the presence of a NLS within this domain. Inspection of the kinase domain as well as the entire aa sequence of p51ferT and p94fer revealed the presence of two potential NLSs in both p51ferT and p94fer. One of these elements is a putative monopartite NLS (28)
, which extends from Arg-651 to Lys-660 in p94fer and from Arg-281 to Lys-290 in p51ferT, resides in the beginning of the kinase domain large lobe of the enzymes (35)
. This sequence, R281/651KRKDELKLK290/660, is highly conserved in the mouse, rat and human FER proteins (12
, 15)
. It bears four adjacent positive aa residues (underlined), and it possesses 60% homology to the M2 nuclear localization sequence of the avian c-myc protein (15
, 47)
. To test the role of that sequence in the mobilization of p94fer and p51ferT to the cell nucleus, Lys-652 and Arg-653, (28)
were changed to asparagine and glutamine, respectively (Fig. 6B
, fer KR652/3NQ). The same mutations have been introduced in the corresponding aa residues in p51ferT (Lys-282 and Arg-283, ferT KR282/3NQ). These two positively charged aa are not conserved among protein kinases (36)
and, therefore, need not necessarily affect the structure and activity of the kinase domain. In fact, FER proteins that carry these double mutations preserved their tyrosine autophosphorylation activity (Fig. 4A
, Lane 2). Replacement of Lys-652 and Arg-653 in p94fer (fer-KR652/3NQ) resulted in permanent exclusion of the protein from the nucleus and its constitutive accumulation in the cytoplasm (Fig. 6, Aa and B
, fer-KR652/3NQ). The same results were obtained upon introduction of these mutations in the constitutively nuclear mutant of p94fer, which lacks ATP binding activity (fer G571R changed to fer G571R-KR652/3NQ; Fig. 6, Ab and B
, fer G571R-R652/3NQ). Inserting the corresponding mutations into p51ferT (ferT KR282/3NQ) interfered with the nuclear translocation of the kinase and caused accumulation of 60% of the molecules in the cytoplasm (Fig. 6, Ac and B
, ferT KR282/3NQ). These experiments strongly suggest the involvement of this positively charged aa cluster in driving the nuclear import of p51ferT and p94fer. The presence of 40% of the mutated p51ferT molecules in the cell nucleus (Fig. 6, Ac and B
, ferT-KR282/3NQ), could suggest the presence of additional nuclear localization elements in p51ferT. To check whether the residual nuclear accumulation of p51ferT resulted from the presence of a weak NLS within the unique NH2 terminus of p51ferT, the monopartite NLS was mutated in a truncated p51ferT, which already lacked the first 58 NH2-terminal aa. This double modified molecule exhibited the same nuclear accumulation profile as the entire p51ferT that carried a mutated monopartite NLS (Fig. 6B
, ferT
158/KR282/3NQ and ferT KR282/3NQ), thus suggesting the absence of an NH2-terminal NLS, in p51ferT, which could functionally cooperate with the kinase domain monopartite NLS.
Another potential NLS resembling the structure of a bipartite NLS (28)
is located between the SH2 and kinase domain of the FER proteins (Fig. 1A)
. This element is composed of two basic aa residues followed by an interval of ten aa which precede a cluster of three basic of five aa residues (12
, 48)
. It is composed of the sequence K171/541KSGVVLLNPIPKDKKW (the first aa is numbered according to its location in p51ferT and p94fer, respectively), where the underlined aa are predicted to play a role in nuclear importing activity (48)
. However, replacing Lys-185 and Lys-186 with isoleucine and glutamine, respectively, did not affect the subcellular distribution of p51ferT (Fig. 6B
, ferT KK185/6IQ). These mutations did not exert any effect when cointroduced with the monopartite NLS mutations described above (Fig. 6B
, ferT KK185/6 IQ-KR282/3NQ). These results strongly suggest the existence of one major NLS element in the kinase domain of p51ferT and p94fer. The residual nuclear accumulation of p51ferT carrying a nonfunctional NLS results most probably from a non-NLS-dependent diffusional entrance of this mutated but compact molecule into the cell nucleus.
NH2-Terminal Structures Direct the Cell Cycle-regulated Nuclear Accumulation of p94fer.
Most of the p51ferT aa sequence (410 of 453 aa) is included in p94fer (Fig. 1A)
, but the subcellular distribution profiles of these two kinases are different during cell cycle progression (Figs. 2
and 3)
. This implies the presence of specific sequences or domains in p94fer, which regulate the functioning of its NLS during mammalian cell cycle. p94fer carries a 412-aa NH2-terminal tail, which replaces the 43-aa NH2 terminus of p51ferT (Fig. 1A)
. Removal of 376 NH2-terminal aa residues from p94fer drove the constitutive translocation of this enzyme to the cell nucleus of quiescent and actively growing cells (Fig. 7, Aa and B
, fer
1376), thus reconstructing the subcellular distribution profile of p51ferT (Fig. 3Ab)
. To delineate the p94fer NH2-terminal sequences that restrict the nuclear accumulation of p94fer at defined stages along the cell cycle, sequential deletions have been introduced in the kinase NH2-terminal tail. Removal of 147 aa residues did not change the preferential accumulation of p94fer in the cytoplasm of quiescent cells, and it allowed its translocation to the nuclei of G1-S cells (Fig. 7, Ae and B
, fer
1147). Similar results were obtained upon deletion of an additional 31 aa from p94fer (Fig. 7B
, fer
1178). Shortening the NH2 terminus of p94fer by 299 aa drove the deregulated constitutive accumulation of the truncated p94fer in nuclei of both quiescent and actively growing cells (Fig. 7, Ac and B
, fer
1299). Removal of an additional 16 aa to a size of 315 aa led to accumulation of only 40% of the truncated kinase in the nucleus of quiescent cells. In actively growing cells, however, this modified kinase showed higher levels of nuclear accumulation than those seen with intact p94fer (Fig. 7B
, fer
1315). The same results were obtained when 328 NH2-terminal aa were removed from p94fer (Fig. 7, Ab and B
, fer
1328). Because fer
1376 is constitutively nuclear in quiescent and growing cells and fer
1328 is mainly cytoplasmic in quiescent cells (Fig. 7B)
, it may emerge that sequences residing between Ala-328 and Lys-376 play a major role in cytoplasmic retention of p94fer in growth-arrested cells. To check that possibility, a 47-aa fragment that extends from Val-330 to Lys-376 was removed from p94fer. Thus, not only did it not enhance the nuclear accumulation of p94fer, but it also excluded the truncated kinase from nuclei of quiescent and growing cells (Fig. 7B
, fer
330376). The same results were obtained when 91 aa were deleted between Leu-331 and Phe-421 (Fig. 7B
, fer
331421) or when 186 aa were deleted between Val-330 and Tyr-515 (Fig. 7B
, fer
330515). Interestingly, removal of 252 aa extending from Glu-124 to Ala-375 gave the same results (Fig. 7B
, fer
124375). All these last four internal deletions in p94fer, which all removed the 47 aa, residing between Ala-328 and Lys-376, all led to constitutive cytoplasmic accumulation of the truncated enzymes. This effect could reflect the presence of an NLS within these removed 47 aa. However, this interpretation is at odds with the constitutive nuclear accumulation of a truncated p94fer that lacked all of the first 376 NH2-terminal aa (Fig. 7B
, fer
1376). It seems, therefore, that it is NH2-terminal structures, rather than specific NH2-terminal sequences, that exert NLS or NES functions and regulate the cell cycle dependent subcellular distribution of p94fer.
|
|
|
| Discussion |
|---|
|
|
|---|
p94fer was shown to be activated in the cytoplasm of growth factor-stimulated fibroblasts (16) . The activation of p94fer, thus, seems to precede its translocation to the nucleus. This sequence of events may be part of the regulated translocation of p94fer to the cell nucleus, thus ensuring the accumulation of an active kinase at the right time (S phase) and at the right place (the nucleus) during progression of the cell cycle. The cytoplasmic activation of p94fer could also imply the involvement of that kinase in modulation of cytoplasmic signal transduction pathways. Both the cytoplasmic and nuclear pools of p94fer were shown to be highly and equally active in an in vitro kinase assay (15) .
The nuclear accumulation of p94fer in S-phase cells suggests a role for this kinase in regulation of the onset and/or progression of S phase. Intriguingly, the nuclear p94fer was shown to be associated with nuclear chromatin (15) , thus envisaging the involvement of p94fer in chromosomal DNA-related processes.
p94fer was shown to phosphorylate the TATA element modulatory factor (TMF) (52) , which can suppress the functioning of RNA polymerase II promoters (53) . Additional experiments should reveal whether this activity is related to the onset or progression of S phase.
Another nuclear tyrosine kinase, c-Abl, was found to be regulated along the progression of mammalian cell cycle. Despite the fact that c-Abl resides in the cell nucleus throughout the entire cell cycle, its activity was found to be cell cycle regulated. Whereas in G0/G1 cells, c-Abl is inhibited by the retinoblastoma protein (Rb), it becomes active at the G1-S transition stage (54) . Interestingly, c-Abl was also shown to shuttle between the cytoplasm and the cell nucleus under defined cellular conditions. This was dependent on the attachment or detachment of cells from constituents of the extracellular matrix (55 , 56) .
The nuclear entrance of the FER proteins is driven by a NLS which resides within their kinase domain, at the beginning of the kinase large lobe ((35)
; Fig. 7C
). In the murine FER proteins analyzed in this work as well as in rat FER, the NLS is composed of the sequence RKRKDELKLK (12
, 13)
. The human FER NLS is highly similar and is composed of the sequence RRKKDELKLK (11)
. These sequences resemble the M2 NLS of c-myc, RQRRNELKLSF, which was shown to function as a relatively weak nuclear translocation element (47)
. Despite the fact that the FER NLS contains at its beginning four basic aa residues, a feature that is common in monopartite NLS (28)
, it cannot be considered a typical NLS. This stems from the fact that the first basic aa residue in a typical monopartite NLS [K(R/K)X(R/K)] is lysine and not arginine (28
, 57)
, as is found in the FER proteins (15)
. Yet, the two FER proteins exhibit a most prominent nuclear accumulation profile under defined cellular conditions. The p51ferT FER kinase is mainly nuclear throughout the entire cell cycle, and the p94fer kinase accumulates preferentially in the nuclei of S-phase cells. These findings suggest an efficient functioning of the FER NLS and effective translocation of these proteins to the cell nucleus. The efficient functioning of the FER NLS could result from its cooperation with other NLSs in the FER proteins. However, no additional NLS could be detected in p51ferT or p94fer. This raised the possibility that a structural element, rather than another sequence-specific element, potentiates the activity of the FER monopartite NLS. Indeed, the efficient functioning of the FER NLS depended on the integrity of the FER kinase domain within which it resides. The interaction between importin (29
, 30) , and the FER proteins seem, therefore, to be mediated by the FER monopartite NLS and to be stabilized by the specific tertiary structure of the kinase domain within which the NLS is embedded. Any change in the structure of the FER kinase domain drastically impaired the functioning of its NLS. Similar localization of a cryptic NLS within a kinase domain was shown for the cGMP-dependent protein kinase (58)
. In c-Abl, however, three NLSs were identified at the COOH-terminal half of the protein, outside of the SH2 and kinase domains (59)
.
Despite the common kinase domain and NLS in the two FER enzymes, they exhibit different subcellular distribution profiles. Whereas the FER NLS is constitutively active in p51ferT, it is tightly regulated in p94fer. However, we did not detect any effect of unique p51ferT sequences (Fig. 1A)
on the nuclear accumulation of that enzyme. This implied the involvement of unique p94fer sequences in the cell cycle-dependent modulation of the NLS activity of this kinase. p94fer bears a 412-aa NH2-terminal tail that is absent from p51ferT (Fig. 1A)
and that carries three potentially CC-forming regions (as predicted by the Pepcoil application program). These extend from aa 121 to 178 (Figs. 1A
and 7C, I
), from aa 301 to 342 (Figs. 1A
and 7C, II
), and from aa 357 to 387 (Figs. 1A
and 7C, III
; Ref. (16)
). Removal of the entire NH2-terminal tail of p94fer (Fig. 3B
, ferT
158, which is identical to fer
1427) or of 376 aa (Fig. 7B
, fer
1376) drove the constitutive accumulation of p94fer in the cell nucleus, a pattern that is typical for p51ferT (Fig. 3)
. The regulated nuclear accumulation of p94fer is dictated, therefore, by the unique NH2-terminal sequences of that kinase.
Extending the NH2-terminal end of a truncated p94fer from aa 376 to 328 (Fig. 7, Ab and B
, fer
1328) or to aa 315 (Fig. 7B
, fer
1315) reduced the tendency of the enzyme to accumulate in the cell nucleus. This did not result from the presence of an NES in NH2-terminal sequences because deletion of this region from p94fer (fer
330376 and other deletions that include this region; Fig. 7B
) did not drive its nuclear translocation but rather led to deregulated accumulation of p94fer in the cytoplasm (Fig. 7B)
. In addition to that, artificial attachment of the first 124 NH2-terminal aa of p94fer to aa 376 led to constitutive exclusion of p94fer from the cell nucleus (Fig. 7B
, fer
124376). These first 124 aa, however, did not play a regulatory role in the subcellular distribution of the intact p94fer (Fig. 7B
, fer
1147). Thus, attachment of a nonrelevant segment, which is 124 aa long, to a p94fer, truncated at aa 376, led to constitutive cytoplasmic accumulation of the truncated enzyme. Surprisingly, however, further extension of the NH2 terminus of the truncated p94fer from aa 376 up to the preceding aa 299, completely regained the constant nuclear accumulation profile that characterizes p51ferT and p94fer truncated at aa 376 (Fig. 7, Aa and B)
. This does not seem to result from the inclusion of the NLS in the segment extending from aa 300 to 315 in p94fer, because no cluster of basic aa could be identified in that segment. These results suggest that addition of 124 aa residues beyond the NH2-terminal position 376 suffices for interfering with the nuclear entry of p94fer, unless it possesses the CC regions II and III, which reside between aa 301 and 387 (Fig. 7A, c and d
; B
, fer
1299; and C
). Thus, a NH2-terminal tail of 160 aa (124 aa + the remaining 36 unique aa residues in fer
1376; Fig. 7B
), which lacks CC regions II and III interferes with the functioning of the p94fer NLS, which is located in the kinase domain of the enzyme. Indeed, deletion of CC regions II and III from p94fer, which was left with a residual unique NH2-terminal 160 or 366 aa (Fig. 7B
, fer
124376 and fer
330376, respectively), abolished the nuclear accumulation of the enzyme. Intramolecular interference of NH2-terminal sequences with kinase domain activity was demonstrated in MEKK-1 (60)
and Raf-1 (61)
. In cGMP-dependent protein kinase, NH2-terminal sequences were shown to interfere with both the kinase activity and NLS functioning of the enzyme (58)
. COOH-terminal sequences were proposed to intramolecular mask the NLS of p105 nuclear factor
B (62)
. Intramolecular self-regulation was also seen in the c-Abl (63)
and FAK (4)
tyrosine kinases.
Inclusion of CC regions II and III in the unique NH2-terminal sequences of p94fer relieved their NLS interfering activity and allowed either constitutive or regulated accumulation of the enzyme in the cell nucleus (Fig. 7B
, fer
1299 and fer
1178, respectively). Whereas the nuclear accumulation of p94fer depends on the presence of CC regions II and III, the cell cycle regulation of that process depends on sequences that reside NH2-terminally to CC regions II and III. Because p94fer deleted of the first NH2-terminal 147 or 178 aa residues (fer
1147 and fer
1178, respectively) exhibit a subcellular distribution profile that is similar to that of the intact enzyme (Fig. 7B)
, one can conclude that sequences residing between aa 179 and 299 are essential for cell cycle regulated nuclear accumulation of p94fer. This fragment links between CC region I and II (Figs. 1A
and 7C
). Thus, three elements seem to play a major role in the regulatory function of the p94fer NH2-terminal sequences. These are: (a) the sequences that link CC regions I and II, (b) CC region II, and (c) CC region III (Fig. 7C)
. CC region I does not seem to play a critical role in the regulated nuclear entrance of p94fer. It may contribute, however, as was shown for c-fes (64)
, to the oligomerization and autophosphorylation of p94fer.4
The above described analysis suggests that it is not NH2-terminal NLS or NES elements that direct the cell cycle-regulated nuclear accumulation of p94fer but rather structural changes in CC regions II and III. CC regions II and III could be engaged in inter- (16) or intramolecular interactions. Involvement of the CC region II in mediating the oligomerization of p94fer could be stabilized by the catenin like pp120 protein, which binds to the NH2 terminus of p94fer in quiescent cells (16) . This would release CC region III to intramolecularly interfere with the accessibility of the kinase domain-embedded FER NLS. This would most probably restrict also the p94fer tyrosine kinase activity. Growth factor stimulation was shown to promote tyrosine phosphorylation of pp120 and consequently drive its dissociation from p94fer (16) . This may lead to preferential intramolecular interactions between CC II and III. Engagement of CC III in intramolecular structures with CC II should relieve the NLS masking by CC III, thus allowing its nuclear translocation. This structure should also lead to higher accessibility of the kinase to self trans-autophosphorylation (16) and phosphorylation of other potential substrates.
Similarly, regulated transition processes from CC-mediated intramolecular interactions to intermolecular structures were presumed to occur in the heat shock-activated heat shock transcription factors HSF1 and HSF2 (65 , 66) .
One cannot exclude, however, the possibility that the nuclear accumulation of p94fer is regulated by additional cellular factors that bind to its NH2-terminal CC regions or by phosphorylation and dephosphorylation events, which may take place under defined cellular conditions and could affect the CC structures in the kinase.
Most interestingly, the regulatory effect of the p94fer NH2-terminal elements depended on the ability of the enzyme to bind ATP. This effect was most pronouncedly observed in the G571R mutant, in which the highly conserved Gly-571 was replaced with arginine, a mutation that abolishes ATP binding ((38)
), and which led to constitutive nuclear accumulation of p94fer (Fig. 5B)
. The cell cycle-regulated NLS-interfering effect of the NH2-terminal structures in p94fer, thus, depends, at least partially, on the ATP binding by the kinase domain. ATP/ADP may stabilize a structure of the kinase domain that is prone to interact with the NH2-terminal CC region III.
The different subcellular distribution profiles of the somatic (p94fer) and meiotic (p51ferT) FER enzymes may affect their cellular activities. For example, the permanent accumulation of p51ferT in the cell nucleus may enable it to interact with substrates that are not encountered by p94fer. p51ferT could, therefore, exert cellular functions that are not carried out by p94fer. Indeed, ectopic expression of p51ferT in fibroblastic cells interfered with the S-phase progression in these cells. This effect was much slighter in p94fer expressing cells (Fig. 8B)
. Thus, although the cellular role of p94fer could be linked to regulation of cell proliferation, the functioning of p51ferT in meiotic cells may interfere with proliferation-related events like DNA replication (67)
. It was shown before that ectopic overexpression of p94fer in fibroblastic cells led to detachment of cells from the substratum and to arrest of cells at G1 (18)
. We did not see such a dramatic effect under the ectopic expression levels that were achieved in the CHO cells transfected with the metallothionein expression vectors. These levels were most probably lower than those achieved by Rosato et al. (18)
.
The two FER kinases seem thus to exert different cellular roles. This could result from their different subcellular distribution profiles. One cannot rule out, however, the possibility that the different NH2-terminal tails of p94fer and p51ferT dictate their interactions with different cellular proteins, thus leading to their different cellular effects.
The FER proteins represent, therefore, two tyrosine kinase that share identical SH2 and kinase domains but are regulated by novel mechanisms that direct their different subcellular distribution profiles. This could consequently affect their cellular regulatory roles.
| Materials and Methods |
|---|
|
|
|---|
Point mutations in p94fer and p51ferT were introduced using the "oligonucleotide directed-mutagenesis without phenotypic selection" approach ((69) ) with the following modifications. Mutagenized fragments were cloned in pBluescript (KS+) and the R408 M13 strain (Promega) was used as a helper phage for preparation of single-strand DNA stocks. Modified oligonucleotides were extended with T7 DNA polymerase. Modified codons are underlined. All mutations were verified by DNA sequencing.
Point mutations introduced into p94fer (fer) and p51ferT (ferT) as follows. For fer-G571R and ferT-G201R, Gly-571 in fer and Gly-201 in ferT were replaced with arginine by using the oligonucleotide GAATTACTGCGCAAGGGGA in which the underlined cytosine replaced the original guanine ((12) ). For fer-G571A and ferT-G201A, Gly-571 in fer and Gly-201 in ferT were replaced with alanine by using the oligonucleotide GAATTACTGGCCAAGGGGA in which the marked cytosine replaced the original guanine. For fer-G573A and ferT-G203A: Gly-573 (Gly-203 in ferT) was replaced with alanine by using the oligonucleotide CTGGGCAAGGCGAATTTTGGTG in which the underlined cytosine replaced the original guanine. For fer-G576V and ferT-G206V, Gly-576 in fer and Gly-206 in ferT were replaced by valine by using the oligonucleotide GGGGAATTTTGTTGAAGTGTATAAG in which the marked thymine replaced the original guanine. For fer-V578T and ferT-V208T, Val-578 in fer and Val-208 in ferT was replaced with threonine by using the oligonucleotide GAATTTTGGTGAGACGTATAAGGGCACAC in which the marked nt replaced the original AGT. For fer-K592R and ferT-K222R, Lys-592 (Lys-222 in ferT) was replaced with arginine by using the oligonucleotide GCCATTCGTACGTGCAAGGAAGACCTTC in which the marked nt replaced the original AAA sequence in fer and ferT. For fer-K592N and ferT-K222N, Lys-592 (Lys-222 in ferT) was replaced with asparagine by using the oligonucleotide GCCATTAATACGTGCAA in which the marked thymine replaced the original adenine. For fer-D685E and ferT-D315E, Asp-685 (Asp-315 in ferT) was replaced with glutamic acid by using the oligonucleotide TCGAGTC(AG)A(C)AAA(G)AAT(C)TGT- (C)ATA(T)CACAGGGAA(C)CTA(G)GCGGCCA(AC) in which the underlined nt were replaced with the following nt in brackets. Most of these changes did not change the aa sequence. For fer-Y715F, ferT-Y345F, fer-Y715E, and ferT-Y345E: Tyr-715 (Tyr-345 in ferT) was replaced with glutamic acid by ligating a modified and nonmodified fer cDNA fragments which were PCR amplified. In the first reaction, the forward primer TGACGGACAAAGGAGGCAC and the reverse primer GAT(A)TC(A)CACTCCACCGTCTTCTTG, in which the modified nt (underlined) were replaced by the nt that follows in parentheses, were used to amplify the fer cDNA from nt 1564 to 2214. The amplified fragment was then cut with ClaI and was ligated to the second amplified fer cDNA product. The second fer fragment was amplified with the forward primer ATCTTCTGGCTTAAAGCAG and the reverse primer CAGTAAGGTGGTATAAAGTGG. The fragment obtained was cut with SacI. The two fragments were ligated with fer cDNA cut with ClaI and partially cut with SacI. For ferT-KK185/186 IQ, Lys-185 and Lys-186 were replaced with isoleucine and glutamine, respectively, by using the oligonucleotide CCAAAGGATATCCAATGGGTTCTCAATC in which the marked nt replaced the original AGA sequence. For ferKR685/6NQ and ferT-KR282/3NQ, Lys-652 and Arg-653 (Lys-282 and Arg-283 in ferT) were replaced with asparagine and glutamine, respectively, by using the oligonucleotide CCTGAGGAATCAGAAGGACGAGCTG in which the marked nt replaced the original GAG sequence. For ferT-K449/450QQ, Lys-449 and Lys450 were both replaced with glutamine residues by insertion of the double-strand synthetic DNA fragment AACGGTAATACAACAGATGATAACATA/TCGATTGCCATTATGTTGTCTACTATTG into a SacI-DraIII-cut pECEferT.
The following deletions were introduced into p94fer and p51ferT: ferT
158 (fer
1427): pECEfer was partially cut with MunI and subsequent digestion with BamHI, and ends were filled in and religated. fer
677823 and ferT
307453 were constructed by cutting pECEfer and pECE ferT with XhoI and XbaI, filling in the ends with Klenow fragment, and religation. fer
758823 and ferT
388453 were constructed by cutting PECEfer and PECEferT with BlnI and XbaI, and the ends were filled in and religated. fer
816823 and ferT
446453 were constructed by cutting PECEfer and PECEferT with Ecl136I and XbaI, and the ends were filled in and religated. fer
594634 and ferT
224264 were constructed by cutting PECEfer-K592R and PECEferT-K222R with BsiW and AccI, ends were filled in and religated. fer
685756 and ferT
315386 were constructed by cutting PECEfer and PECEferT with Psp511 and BlnI after being propagated in dcm- GM48 Escherichia coli strain. Ends were filled in and religated. The following deletions were introduced into p94fer. fer
1148 was obtained by cutting pECEfer with SmaI and EcoRI, and the ends were filled in and religated. For fer
1178, pECEfer was cut with XbaI and NdeI, and then the ends were filled in and religated. For fer
1299: nt 965-1648 were amplified with the forward primer GGGTTAACAGCAGACAGTTTG, in which the first three underlined nt were exogenously added, and the reverse primer GAATGGTGATCTATAAGC. The amplified fragment was cut with ClaI and was then inserted into a pECEfer plasmid that was cut with ClaI and SmaI. For fer
1315, pECEfer was partially cut with Ecl136I and subsequently cut with SmaI and self-ligated. For fer
1328: pECEfer was cut with EagI and XbaI. Cohesive ends were converted to blunt ends with Klenow fragment and self-ligated. For fer
330376, a fer fragment encoding Val-330 to Lys-376 was deleted as follows: a downstream fer fragment extending from nt 1194 to 1666 was amplified with a forward primer GGAACGGCCGAGTGTGCAGCACA-GAAAG, which harbors an EagI site at its 5' end (underlined), and a reverse primer GAAGTGGTGATCTATAAGC. The PCR product was cut with EagI and ClaI. This was reinserted into a EagI-ClaI cut pECEfer. A similar strategy was used for deleting a fer fragment encoding Leu-331 to Phe-421. In this case the forward primer used was CACATCGGCCGTTGAGTCTATTCGTCATTC. fer
1376: pECEfer
330/376 was cut with XbaI and EagI, and ends were filled in and religated. For fer
124375, a fer fragment extending from nt 1 to 435 was amplified by PCR using the forward primer AGCCTGCAGATGGGATTTGGGAGTGACC and a reverse primer CGGCCGCCTCTA-TCTGTTGATGAATG. The PCR product carried PstI and EagI sites (underlined, respectively) in its two ends and was inserted into a pECEfer
330/376 plasmid that was partially cut with EagI and PstI. For fer
330515, pECEfer was cut with EagI and ClaI, and ends were filled in and religated.
Cells and Transfections.
Primary mouse fibroblasts were isolated from skin of newborn BALB/c mice as described previously (70)
. Briefly, dermises were separated from the overlying epidermis by overnight floatation in 0.25% trypsin solution. Thereafter, dermises were incubated in 0.35% collagenase solution, and a single-cell fibroblast suspension was cultured in DMEM with 15% FCS. Cells (104) were transfected with 125 ng of DNA mixed with 0.75 µl of Lipofectamine plus reagent and 4 µl of Lipofectamine (Life Technologies, Inc.). Approximately 15% of the cells underwent transfection under these conditions.
COS1 and BHK21 were grown in DMEM supplemented with 10% FCS. CHO cells were grown in F12 medium. Cells (4 x 1032 x 104) cells were transfected with 125 ng of DNA mixed with 0.75 µl of Lipofectamine (Life Technologies, Inc.). Although the transfection efficiency of BHK21 and CHO cells was
20% in COS1 cells, the percentage of transfected cells varied between 20 and 80% of a given culture.
Cells were arrested at the different stages of the cell cycle as follows. Mouse primary fibroblasts and COS1 cells were arrested at G0 by being grown to confluence and left at that state for at least 24 h. Growth arrest was confirmed by lack of BrdUrd labeling. COS1, CHO, and BHK21 cells were arrested at the G1-S phase by being treated with 3 µg/ml aphidicolin for 20 h before being exposed to immunocytochemical analysis (71) .
For establishing CHO clones that stably express exogenous p94fer and p51ferT, the cells were transfected with the pHSfer and pHSferT plasmids (49) respectively, using the calcium phosphate precipitation technique (49) .
Western Blot Analysis.
COS1 cells (2.5x105) were transfected with 3 µg of DNA in 60-mm dishes. Proteins were extracted as described (14)
and then resolved in 10% SDS-PAGE. Electroblotted proteins were detected using
-FER C1 antibodies (14)
and pT-66
-phosphotyrosine monoclonal antibodies (Sigma Chemical Co.).
Immunoprecipitation.
Proteins were extracted (49)
from 2.5x105 COS1 cells transfected with the pECEfer expression vector. HA-tagged p94fer variants were immunoprecipitated (49)
with 1:150 diluted
-HA mouse monoclonal antibody (Boehringer). Immunoprecipitates were resolved on 9% SDS-PAGE, blotted onto nitrocellulose membranes, and reacted with monoclonal
-HA and
-phosphotyrosine (PT-66; Sigma Immunochemicals) antibodies.
Indirect Immunocytofluorescence.
Cells (4 x 1032 x 104) were seeded in eight-well chamber slides to achieve different levels of confluence and were transfected with 125 ng of DNA 21 h later. Cells were fixed 40 h posttransfection using 4% paraformaldehyde and subsequently treated with 0.5% Triton X-100 for 30 min. Blocking was carried out with 6% skim milk, 3% BSA, and 0.2% Tween 20 in 100% FCS. Cells were then exposed to 1:1000 diluted
-HA antibodies (Babco) O.N at 4°C. Reacting antibodies were visualized with FITC-conjugated donkey antimouse antibodies (Jackson Laboratories) in a Bio-Rad MRC 1024 upright confocal microscope with a Krypton-Argon ion laser. Nuclear DNA was stained with 10 µg/ml propidium iodide. Relative nuclear and cytoplasmic staining intensity was determined by eye.
S-phase and non-S-phase nuclei were distinguished by analyzing their BrdUrd (Boehringer)-incorporating activity. Transfected cells were incubated 48 h after transfection, for 2 h with 10 µM BrdUrd. The cells were then washed, fixed, and permeabilized with 0.5% Triton X-100, as described above. Slides were immersed for 1 min in boiling 10 mM sodium citrate (pH 6). This procedure was repeated after an interval of 5 min. The incorporated BrdUrd was visualized with FITC-conjugated
-BrdUrd mouse monoclonal antibodies (Becton Dickinson). In experiments that included BrdUrd staining of cells, HA-p94fer was detected by using biotin-conjugated
-HA antibodies (Babco), which were then visualized with Texas Red-conjugated Streptavidin (Jackson Laboratories). Confocal microscope image analysis was performed using Bio-Rad software, and figures were compiled using the Laser Sharp 3.0 application.
Flow Cytometry Analysis.
Cells (2 x 105) were seeded and exposed to 100 µM ZnCl2 3 h later. Cells were harvested after 48 h, spun down, and washed with PBS and resuspended in 1 ml of staining buffer containing: 0.1% BSA, 0.01% sodium azide, 50 mg/ml propidium iodide, 0.1% Triton X-100, and 2.5 mg/ml RNase for 10 min. Nuclei were spun down, resuspended in 0.5 ml PBS, and analyzed for relative DNA content by an Epics XL-MCL flow cytometer.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by the Israel Science Foundation, administered by the Israel Academy of Sciences and Humanities. ![]()
2 To whom requests for reprints should be addressed. Phone: 972-3-5318757; Fax: 972-3-5351824; E-mail: nir{at}mail.biu.ac.il ![]()
3 The abbreviations used are: NLS, nuclear localization sequences; CC, coiled coil; NES, nuclear export sequences. ![]()
4 I. Ben-Dor, K. Orlovsky, and U. Nir, unpublished data. ![]()
5 GenBank accession no. U76762, submitted by K. Letwine and T. Pawson. ![]()
Received for publication 8/27/98. Revision received 11/17/98. Accepted for publication 12/17/98.
| References |
|---|
|
|
|---|
. Cell, 23: 647-648, 1981.[Medline]
B subunit. Cell, 68: 1121-1133, 1992.[Medline]
This article has been cited by other articles:
![]() |
A. Zoubeidi, J. Rocha, F. Z. Zouanat, L. Hamel, E. Scarlata, A. G. Aprikian, and S. Chevalier The Fer Tyrosine Kinase Cooperates with Interleukin-6 to Activate Signal Transducer and Activator of Transcription 3 and Promote Human Prostate Cancer Cell Growth Mol. Cancer Res., January 1, 2009; 7(1): 142 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Y. E. Sayegh, P. D. Arora, L. Fan, C. A. Laschinger, P. A. Greer, C. A. McCulloch, and A. Kapus Phosphorylation of N-Cadherin-associated Cortactin by Fer Kinase Regulates N-Cadherin Mobility and Intercellular Adhesion Strength Mol. Biol. Cell, December 1, 2005; 16(12): 5514 - 5527. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Putzke, S. T. Hikita, D. O. Clegg, and J. H. Rothman Essential kinase-independent role of a Fer-like non-receptor tyrosine kinase in Caenorhabditis elegans morphogenesis Development, July 15, 2005; 132(14): 3185 - 3195. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kogata, M. Masuda, Y. Kamioka, A. Yamagishi, A. Endo, M. Okada, and N. Mochizuki Identification of Fer Tyrosine Kinase Localized on Microtubules as a Platelet Endothelial Cell Adhesion Molecule-1 Phosphorylating Kinase in Vascular Endothelial Cells Mol. Biol. Cell, September 1, 2003; 14(9): 3553 - 3564. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Taler, S. Shpungin, Y. Salem, H. Malovani, O. Pasder, and U. Nir Fer Is a Downstream Effector of Insulin and Mediates the Activation of Signal Transducer and Activator of Transcription 3 in Myogenic Cells Mol. Endocrinol., August 1, 2003; 17(8): 1580 - 1592. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. B. Craig and P. A. Greer Fer Kinase Is Required for Sustained p38 Kinase Activation and Maximal Chemotaxis of Activated Mast Cells Mol. Cell. Biol., September 15, 2002; 22(18): 6363 - 6374. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-M. McCafferty, A. W. B. Craig, Y. A. Senis, and P. A. Greer Absence of Fer Protein-Tyrosine Kinase Exacerbates Leukocyte Recruitment in Response to Endotoxin J. Immunol., May 15, 2002; 168(10): 4930 - 4935. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Priel-Halachmi, I. Ben-Dor, S. Shpungin, T. Tennenbaum, H. Molavani, M. Bachrach, S. Salzberg, and U. Nir FER Kinase Activation of Stat3 Is Determined by the N-terminal Sequence J. Biol. Chem., September 8, 2000; 275(37): 28902 - 28910. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cell Growth & Differentiation |