Cell Growth & Differentiation Vol. 10, 813-818, December 1999
© 1999 American Association for Cancer Research
A Genetic Analysis of PAX3-FKHR, the Oncogene of Alveolar Rhabdomyosarcoma1
Barbara E. Kempf and
Peter K. Vogt2
The Scripps Research Institute, Division of Molecular and Experimental Medicine, La Jolla, California 92037
 |
Abstract
|
|---|
The PAX3-FKHR fusion protein of human alveolar rhabdomyosarcoma consists of the DNA-binding domains of PAX3 and the transcriptional activation domain of FKHR. It induces oncogenic transformation in cultures of chicken embryo fibroblasts (CEFs). PAX3-FKHR-transformed CEFs have been kept in continuous culture for more than 1 year; when quiescent, portions of the cultures differentiate into several distinct cell types. Deletion analysis suggests that both DNA binding and transcriptional activation are required for the induction of the PAX3-FKHR-transformed cellular phenotype. Mutant PAX3-FKHR proteins with reduced DNA binding or transactivation induce altered cellular morphologies and growth behavior distinct from that of CEFs expressing wild-type PAX3-FKHR. Mutant proteins that completely lack DNA binding or transactivation potential fail to transform.
 |
Introduction
|
|---|
The pediatric soft tissue tumor alveolar rhabdomyosarcoma is characterized by a recurrent t(2;13)(q35;q14) translocation (1
, 2)
. This chromosomal rearrangement generates a fusion protein consisting of the NH2-terminal DNA-binding domains of PAX3 and the COOH-terminal transcriptional regulatory domain of the winged-helix protein FKHR (3, 4, 5)
. The PAX3-FKHR protein can be detected in rhabdomyosarcoma cells (2)
. PAX3-FKHR, expressed by the avian retroviral vector RCAS, induces foci of transformed cells and anchorage-independent growth in cultures of CEFs3
(6)
. Transfection of CEFs with wild-type PAX3 does not induce oncogenic transformation. In vitro analyses suggest that PAX3-FKHR functions as a gain of function mutant of PAX3. Although PAX3 binds with a higher affinity than PAX3-FKHR to a sequence recognized by the Pax proteins, PAX3-FKHR is a more potent transcriptional activator (7
, 8)
. The transactivation domains of PAX3 and PAX3-FKHR are negatively regulated by an NH2-terminal inhibitory region. It is possible that the FKHR-derived transactivation domain is refractory to this inhibition, hence the gain of function (9)
.
In the present study, DNA binding, transcriptional activation, and oncogenic transformation in CEFs were studied in deletion mutants of PAX3-FKHR. Deletions affecting the PAX3 DNA-binding domains or the FKHR transactivation domain are still compatible with transforming activity, but the mutant-transformed cells differ in morphology and growth behavior from those expressing intact PAX3-FKHR. Complete transformation requires both DNA binding and transcriptional activation.
 |
Results
|
|---|
DNA Binding of PAX3-FKHR Deletion Mutants.
The NH2-terminal region of PAX3-FKHR contains both PAX3 DNA-binding domains, the paired domain and the paired-type homeo domain (10)
, whereas the COOH terminus contains regions important for FKHR-mediated activation (8
, 11)
. In an effort to examine the contributions of the DNA binding and transactivation domains toward transformation of CEFs, a series of 5' and 3' deletions was created (Fig. 1)
. These NH2-terminal and COOH-terminal deletion mutants were cloned into the expression vector pCDNA3, and in vitro translated proteins were tested for their ability to bind DNA. The e5 sequence of the Drosophila even-skipped promoter was used as target DNA. This sequence contains domains recognized by the paired domain (GTTCC) and the paired-type homeo domain [ATTA (10)
] and has been shown to respond to activation by PAX3 and PAX3-FKHR (7)
. Approximately equal amounts of in vitro translated proteins as estimated by SDS-PAGE were incubated with the labeled probe and separated on a nondenaturing gel (Fig. 2)
. The DNA binding activity of all the COOH-terminal deletions tested as well as the N18 NH2-terminal deletion that leaves the PAX3 DNA-binding domains intact was comparable to that of wild-type PAX3-FKHR. The N274 mutant in which both the PAX3 DNA-binding domains were deleted did not show binding to the probe. This result suggests that only the PAX3 DNA-binding domains are functional in PAX3-FKHR and that the truncated winged helix domain of the FKHR portion cannot mediate interaction with the e5 DNA sequence by itself. The NH2-terminal mutant whose deleted region includes the first 18 amino acids of the paired domain (N40) failed to bind to the DNA probe. Upon removal of the entire paired domain (N193), DNA binding to the e5 sequence is still observed, although at a much reduced level compared with PAX3-FKHR.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 1. Schematic representation of PAX3, PAX3-FKHR, FKHR, and the PAX3-FKHR deletion mutants. A, PAX3 contains two DNA-binding domains, the paired box (PB) and a paired-type homeo domain (HD), separated by a conserved octapeptide motif (OP). FKHR contains a 100-amino acid forkhead DNA binding domain (FKHR DBD) that is bisected as a result of the t(2;13) translocation in the PAX3-FKHR fusion protein. The transcriptional regulatory domain is located in the COOH-terminal region of the proteins. B, structural diagram of the PAX3-FKHR deletion mutants. The mutants were created by PCR mutagenesis and cloned into the pCDNA3 CMV expression plasmid for transient transfections and DNA binding assays and into the replication competent retroviral vector RCAS for the transformation assays. The label of each mutant refers to the number of amino acids deleted from either the NH2-terminal (N) or COOH-terminal (C).
|
|

View larger version (136K):
[in this window]
[in a new window]
|
Fig. 2. DNA binding properties of the PAX3-FKHR mutant proteins. In vitro translated proteins were incubated with a 32P-labeled probe based on the e5 sequence of the Drosophila even-skipped promoter (CACCGCACGATTAGCACCGTTCCGCTCAGG). PAX3-FKHR has previously been demonstrated to bind to this sequence, which contains recognition elements for the paired domain (GTTCC) and the homeo domain (ATTA). Control, unprogrammed reticulocyte lysate.
|
|
Transcriptional Activation of PAX3-FKHR Deletion Mutants.
The mutants were next tested for their ability to transactivate a luciferase reporter gene in transient transfection assays in CEFs. The reporter gene used contained four copies of the e5 sequence upstream of a minimal adenovirus E1b gene TATA sequence (7)
and was previously shown to be activated by PAX3-FKHR in NIH3T3 cells (7)
. The results of a representative luciferase assay are shown in Fig. 3.
As in NIH3T3 cells, PAX3-FKHR was able to transactivate the reporter gene in CEFs. Removal of 18 amino acids from the NH2-terminal (N18) resulted in a greater activation of the reporter gene, in agreement with previous reports that have identified an NH2-terminal inhibitory domain in PAX3 (9)
. The NH2-terminal deletion mutants that showed little or no DNA binding in EMSA also failed to activate the reporter gene (Fig. 3
, N40, N193, and N274), suggesting that both paired domain and homeo domain binding are necessary for activation of this reporter. These results are consistent with those of other reports demonstrating the dependence on both PAX3 DNA-binding domains for activation of a reporter containing both paired and homeo domain recognition sequences (12
, 13)
. Deletion of 74 COOH-terminal FKHR amino acids resulted in decreased transactivation as compared with PAX3-FKHR. Deletion of 152 COOH-terminal amino acids from the FKHR portion still allowed residual transactivation of the reporter. This result is in agreement with a previous report that showed transactivation with a deletion mutant that removed at least 165 COOH-terminal amino acids (14)
.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3. Transcriptional regulation of PAX3-FKHR mutants. CEFs were transfected with CMV promoter-based expression plasmids containing Pax3, PAX3-FKHR, or the various deletion mutants, a control CMV-ß-gal vector, and a luciferase reporter plasmid containing four copies of the e5 sequence upstream of the E1b promoter. The graph illustrates the average luciferase activities (normalized to ß-gal activities) of a representative experiment performed in duplicate.
|
|
Transformation of CEFs by PAX3-FKHR Deletion Mutants.
The deletion mutants were cloned into the retroviral vector RCAS and transfected into CEFs. The cultures were overlaid with nutrient agar, and after approximately 3 weeks, the cells were transferred to larger plates and overlaid again. Protein expression was examined by Western blot analysis using an antibody generated in rabbits against an internal region of PAX3-FKHR fused to GST (Fig. 4)
. Indirect immunofluorescence demonstrated that PAX3-FKHR and the mutant proteins localized to the nucleus (data not shown). Oncogenic transformation was assessed by examining cellular morphology and growth patterns. The wild-type PAX3-FKHR and the construct that deleted the region NH2-terminal to the paired domain (N18) were indistinguishable in morphology and in their ability to induce growth into multilayered foci (Fig. 5)
. As compared with controls transfected with empty vector, these cells were elongated and refractile and grew in parallel orientation in multilayered, whorl-like bundles. The PAX3-FKHR-expressing cells could be grown for more than 14 months, doubling about once every 5 days and showing no signs of senescence. If left on the same culture dish, these cells became quiescent and showed evidence of differentiation, developing islands of epithelial-like cells, colonies of hematopoietic-like cells, and areas of macrophages, dendritic cells, and occasional small myotubes (Fig. 6)
. From most of these "differentiating" cultures, actively growing cell populations could be derived by trypsin-mediated transfer, even after as much as 6 months of quiescence. The N40 and N193 deletion mutants that showed little or no DNA binding in vitro transformed CEFs but induced a cellular morphology that was very different from that of PAX3-FKHR transformants. These cells were flat, polygonal, and highly adherent and grew in a strict monolayer. Only occasional groups of cells were less adherent, elongated, and arrayed in bundles. These characteristic morphological cell types were retained upon multiple subculture, but N193-expressing cells had a limited life span and senesced. These cultures did not develop the diverse differentiated cell types seen with PAX3-FKHR-transformed cultures, except that flattened cells were prone to form epithelial-like arrangements. Cells expressing the N274 deletion construct lacking all PAX3 DNA-binding domains were indistinguishable from CEFs transfected by RCAS alone. These observations suggest that PAX3 DNA-binding domains are essential for transformation. CEFs expressing the C74 and C152 COOH-terminal deletions showed extremely elongated morphology and grew in multiple layers without forming distinct bundles of cells. Multiple transfers and subcultures induced senescence in these transformants. Cells transfected with the more extensive COOH-terminal deletions C231, C335, and C396 did not differ from RCAS transfectants in morphology and growth behavior. Induction of anchorage-independent growth by PAX3-FKHR and its deletion mutants corresponded to transforming potential in monolayer cultures. PAX3-FKHR produced 81 ± 44 agar colonies/104 cells (nine determinations using cells from different chicken embryos). N40 induced about 60% of this number, N193 induced about 20% of this number, and N274 failed to stimulate anchorage-independent growth. C74 induced small colonies with the same efficiency as PAX3-FKHR; with C152, this efficiency was reduced to 14%, and C231 failed to induce growth in agar.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4. Expression of wild-type and mutant proteins. Western blot analysis of CEF extracts. Equal amounts of protein were resolved on an 8% SDS-PAGE gel, transferred to a polyvinylidene difluoride membrane, and incubated with an antibody raised against an internal region of PAX3-FKHR fused to GST. A, RCAS-transfected CEFs (Lane 1) and detection of PAX3-FKHR (Lane 2), N18 (Lane 3), N40 (Lane 4), N193 (Lane 5), and N274 (Lane 6). B, detection of C74 (Lane 7), C152 (Lane 8), C231 (Lane 9), C335 (Lane 10), and C396 (Lane 11). The identity of the band migrating at M, 62,000 in the left panel is unknown but may represent a proteolytic degradation product.
|
|

View larger version (140K):
[in this window]
[in a new window]
|
Fig. 5. Transformation by RCAS-PAX3-FKHR and mutant proteins. CEFs were transfected with the RCAS-PAX3-FKHR constructs and overlaid with nutrient agar, and after 34 weeks, cellular morphology and focus formation were assessed. The photographs illustrate morphological changes in CEFs 4 weeks after transfection with the various constructs. Photographs were taken with x16 objective lens magnification.
|
|

View larger version (143K):
[in this window]
[in a new window]
|
Fig. 6. Differentiating cell types in quiescent PAX3-FKHR-transfected CEFs. A, groups of cells with dendrite-like structures. B, epithelial monolayer. C and D, groups of round, hematopoietic-like cells. E, macrophages. F, myotube. The myotubes and some mononucleated cells stained strongly in immunofluorescence with an antibody to the muscle-specific protein desmin. Photographs were taken with x16 objective lens magnification.
|
|
 |
Discussion
|
|---|
Expression of PAX3-FKHR induces a characteristic transformed cellular phenotype in cultures of CEFs. Most of the cells are elongated and refractile, and a few are rounded and adhere only loosely to the substrate; both grow in multiple layers. Crowded PAX3-FKHR cultures show a tendency to differentiate into diverse cell types. The differentiating PAX3-FKHR chicken embryo cells are reminiscent of mammalian embryonal carcinoma cell lines. The physiological conditions and mechanisms of differentiation in PAX3-FKHR cultures require further analysis. The transforming potential of PAX3-FKHR is modified by NH2-terminal and COOH-terminal deletions. The NH2-terminal deletions primarily affect the DNA binding properties of the protein and secondarily affect its transactivation potential. The DNA binding of PAX3-FKHR is controlled by the PAX3-derived sequences; there is no evidence that the residual winged helix sequences of the FKHR portion coding for a portion of the predicted third helix and basic region affect binding to the e5 sequence. However, an effect on DNA binding to a different target sequence cannot be ruled out. PAX3 has a bipartite DNA binding domain consisting of an NH2-terminal paired domain followed by a paired-type homeo domain. The oligonucleotide used in EMSA assays and the reporter plasmid for the luciferase assays encompassed binding sequences for both domains. Deletions of the paired domain in the mutants N40 and N193 led to either a complete loss or a dramatic reduction of DNA binding ability in vitro. Transactivation in transient transfections was also eliminated. However, these mutants still transformed CEFs, albeit with morphological and growth characteristics that are different from those of PAX3-FKHR transformants. CEFs transformed by these mutants lacked the longevity of the PAX3-FKHR cells and did not develop diverse differentiated cell types upon quiescence. They grew mainly in monolayers but showed some anchorage independence. Analysis of the crystal structure of the PAX3 paired domain bound to DNA shows that the NH2-terminal amino acids of the paired domain form a ß-sheet and a ß-turn that make contacts with the sugar phosphate backbone and the minor groove of DNA, respectively (15)
. The amino acids in this region are conserved in the Pax proteins, and several of the known Pax3 developmental mutations are included in this region (Spd, BU47, and BU26; Refs. 16
and 17
). The splotch-delayed (Spd) mutant mice develop posterior neural tube defects and defects in neural tube migration. BU47 and BU26 describe mutations in the human PAX3 paired domain characterized by sensorineural hearing loss, dystopia canthorum, and pigmentary disturbances. In addition, the BU47 mutation was also associated with musculoskeletal abnormalities (17)
. Studies describing analysis of the Spd mutation have suggested functional interdependence between the paired domain and the homeo domain (18)
. The inability to bind to DNA in the case of the N40 mutation may represent a conformational change in the protein that prohibits the homeo domain from making DNA contacts. A recent study demonstrated that PAX3-FKHR recognizes an AT-rich sequence in the promoter of the platelet-derived growth factor-
receptor gene and is capable of binding to this site even when mutations are present in the paired domain that render this domain unable to bind to the e5 sequence (13)
. It is therefore likely that the N40 and N193 deletions recognize target sequences that differ from those of PAX3-FKHR and that the resulting distinct target spectrum is responsible for the characteristic morphology and growth pattern of cells expressing these mutants.
The partial deletions of the FKHR-derived COOH-terminal transactivation domain C74 and C152 still induce an altered, elongated cell shape and enhanced growth including anchorage independence; however, distinct from PAX3-FKHR transformants, they show less aggregation into foci of transformation. These mutants retain a low residual transactivation potential. COOH-terminal deletions that completely remove the FKHR transactivation domain are nontransforming.
A recent publication describes a mutational analysis of PAX3-FKHR expressed in NIH3T3 cells (14)
. Transformation as measured by anchorage-independent growth was observed with mutations that disrupted DNA binding by the paired domain. These mutations are comparable to the N40 and N193 mutants described here, both of which can induce anchorage-independent growth in CEFs, albeit with a reduced efficiency compared to PAX3-FKHR. The distinct morphological features seen in monolayer cultures were not evident in the agar colonies. For the characteristic transformed phenotype of the PAX3-FKHR-expressing cells (elongated refractile cells growing in bundles, extended and possibly unlimited life span, and the ability to differentiate), both paired domain and homeo domain DNA-binding regions seem to be required. For agar colony formation by NIH3T3 cells, transactivation from an e5-like sequence seems to be dispensable. In the present study, the NH2-terminal deletions N40 and N193 also failed to transactivate, yet they still transformed. However, it is possible that the transactivation potential of these mutants depends on binding to a different DNA target sequence and was therefore not detectable in transient transfections using a reporter with a PAX3 binding site.
The results of the present studies support the conclusion that PAX3-FKHR transformation depends on both DNA binding and the complete transactivation domain encoded by the FKHR portion of the molecule. Reductions or changes in either DNA binding or transactivation lead to distinctly different forms of transformation with less pronounced neoplastic properties. Complete loss of either DNA binding or transactivation is incompatible with transformation.
 |
Materials and Methods
|
|---|
Recombinant Plasmids.
The pCDNA3 expression vector construct containing PAX3-FKHR cDNA and the RCASBP(A) PAX3-FKHR construct have been described previously (6
, 7)
. The PAX3-FKHR NH2-terminal deletion mutants were constructed by PCR using a 3' antisense primer and various 5' sense primers. Similarly, the COOH-terminal deletion mutants were generated with a 5' sense primer and various 3' antisense primers (Fig. 1)
. The deletion mutants were subcloned into the pCDNA3 vector (Invitrogen) for use in transient transfection assays or into RCASBP(A) for use in transformation assays.
Cell Culture and Transfections.
For transformation assays, secondary CEFs were seeded on 6-well plates at a density of 0.5 x 106 cells/35-mm well. Cells were grown overnight in a medium containing 2 µg/ml polybrene. CEFs were transfected with 1 µg of the various constructs using the method of Kawai and Nishizawa (19)
.
Transient transfections were carried out using 0.5 µg of the various expression plasmids. The reporter construct consisted of four copies of the e5 DNA binding sequence upstream of the E1b TATA promoter (7)
linked to luciferase. The e5 sequence 5'-CACCGCACGATTAGCACCGTTCCGCTCAGG-3' is found in the Drosophila even-skipped (eve) promoter and contains the consensus binding sequences for the paired domain (GTTCC) and homeo domain (ATTA) of PAX3 (10)
. A CMV-ß-gal plasmid served as a control for transfection efficiency. Transient transfections were performed with the LipofectAMINE method (Life Technologies, Inc.). Luciferase activity was measured according to the manufacturers instructions (Promega, Madison, WI) and normalized to the ß-gal activity.
Western Blot Analysis.
Transfected CEFs were washed twice with PBS and resuspended in radioimmunoprecipitation assay buffer [150 mM NaCl, 50 mM Tris (pH 8.0), 1% Triton X-100, 1% deoxycholic acid, 0.1% SDS, 5 mM EDTA, and 10 mM NaF]. Protein concentrations were measured using the Bio-Rad Protein Assay Reagent (Bio-Rad Laboratories, Hercules, CA). Equal amounts of protein were boiled in 1x SDS-PAGE sample buffer and separated by 8% SDS-PAGE. Proteins were transferred to an Immobilon-P (Millipore) membrane, and the membrane was probed with a 1:2000 dilution of rabbit antiserum. The rabbit antiserum was prepared against a GST-fusion protein consisting of amino acids 280335 of PAX3-FKHR. The membranes were washed and incubated in a 1:4000 dilution of horseradish peroxidase-conjugated donkey antirabbit IgG (Sigma). Membranes were incubated for 1 min in Western Blot Chemiluminescence Reagent (New England Nuclear) and exposed to film.
EMSA.
An oligonucleotide based on the e5 sequence from the Drosophila even-skipped promoter (eve) was used as a probe in the EMSAs. The oligonucleotide was labeled with [
-32P]dCTP and the Klenow fragment of DNA polymerase. Equal amounts of in vitro translated proteins (TNT; Promega), as estimated by visualization using [35S]methionine on a 10% SDS-PAGE gel, were incubated with the probe in a buffer consisting of 50 mM Tris (pH 7.5), 25% glycerol, 250 mM NaCl, 5 mM EDTA, and 5 mM DTT for 20 min at room temperature. DNA-protein complexes were resolved in a 4% polyacrylamide gel in 0.25 x TBE. The gel was dried and exposed to film at -80°C.
 |
Acknowledgments
|
|---|
We thank Frank J. Rauscher III and Fred G. Barr for the Pax3 and PAX3-FKHR constructs and Bing-Hua Jiang for help with immunofluorescence of myotubes.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by NIH Grants CA42564 and CA78230. B. Kempf is supported by a NIH Fellowship CA76687. 
2 To whom requests for reprints should be addressed, at The Scripps Research Institute, Division of Molecular and Experimental Medicine, 10550 North Torrey Pines Road, La Jolla, CA 92037. Phone: (858) 784-9728; Fax: (858) 784-2070; E-mail: pkvogt{at}scripps.edu 
3 The abbreviations used are: CEF, chicken embryo fibroblast; EMSA, electrophoretic mobility shift assay; GST, glutathione S-transferase; CMV, cytomegalovirus; ß-gal, ß-galactosidase. 
Received for publication 9/ 1/99.
Accepted for publication 11/ 1/99.
 |
References
|
|---|
-
Turc-Carel C., Lizard-Nacol S., Justrabo E., Favrot M., Philip T., Tabone E. Consistent chromosomal translocation in alveolar rhabdomyosarcoma. Cancer Genet. Cytogenet., 19: 361-362, 1986.[Medline]
-
Douglass E. C., Valentine M., Etcubanas E., Parham D., Webber B. L., Houghton P. J., Houghton J. A., Green A. A. A specific chromosomal abnormality in rhabdomyosarcoma. Cytogenet. Cell Genet., 45: 148-155, 1987.[Medline]
-
Barr F. G., Galili N., Holick J., Biegel J. A., Rovera G., Emanuel B. S. Rearrangement of the PAX3 paired box gene in the paediatric solid tumour alveolar rhabdomyosarcoma. Nat. Genet., 3: 113-117, 1993.[Medline]
-
Galili N., Davis R. J., Fredericks W. J., Mukhopadhyay S., Rauscher F. J. d., Emanuel B. S., Rovera G., Barr F. G. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat. Genet., 5: 230-235, 1993.[Medline]
-
Shapiro D. N., Sublett J. E., Li B., Downing J. R., Naeve C. W. Fusion of PAX3 to a member of the forkhead family of transcription factors in human alveolar rhabdomyosarcoma. Cancer Res., 53: 5108-5112, 1993.[Abstract/Free Full Text]
-
Scheidler S., Fredericks W. J., Rauscher F. J., III, Barr F. G., Vogt P. K. The hybrid PAX3-FKHR fusion protein of alveolar rhabdomyosarcoma transforms fibroblasts in culture. Proc. Natl. Acad. Sci. USA, 93: 9805-9809, 1996.[Abstract/Free Full Text]
-
Fredericks W. J., Galili N., Mukhopadhyay S., Rovera G., Bennicelli J., Barr F. G., Rauscher F. J., III. The PAX3-FKHR fusion protein created by the t(2;13) translocation in alveolar rhabdomyosarcomas is a more potent transcriptional activator than PAX3. Mol. Cell. Biol., 15: 1522-1535, 1995.[Abstract/Free Full Text]
-
Sublett J. E., Jeon I. S., Shapiro D. N. The alveolar rhabdomyosarcoma PAX3/FKHR fusion protein is a transcriptional activator. Oncogene, 11: 545-552, 1995.[Medline]
-
Bennicelli J. L., Edwards R. H., Barr F. G. Mechanism for transcriptional gain of function resulting from chromosomal translocation in alveolar rhabdomyosarcoma. Proc. Natl. Acad. Sci. USA, 93: 5455-5459, 1996.[Abstract/Free Full Text]
-
Goulding M. D., Chalepakis G., Deutsch U., Erselius J. R., Gruss P. Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J., 10: 1135-1147, 1991.[Medline]
-
Bennicelli J. L., Fredericks W. J., Wilson R. B., Rauscher F. J., III, Barr F. G. Wild type PAX3 protein and the PAX3-FKHR fusion protein of alveolar rhabdomyosarcoma contain potent, structurally distinct transcriptional activation domains. Oncogene, 11: 119-130, 1995.[Medline]
-
Treisman J., Harris E., Desplan C. The paired box encodes a second DNA-binding domain in the paired homeo domain protein. Genes Dev., 5: 594-604, 1991.[Abstract/Free Full Text]
-
Epstein J. A., Song B., Lakkis M., Wang C. Tumor-specific PAX3-FKHR transcription factor, but not PAX3, activates the platelet-derived growth factor
receptor. Mol. Cell. Biol., 18: 4118-4130, 1998.[Abstract/Free Full Text]
-
Lam P. Y., Sublett J. E., Hollenbach A. D., Roussel M. F. The oncogenic potential of the Pax3-FKHR fusion protein requires the Pax3 homeodomain recognition helix but not the Pax3 paired-box DNA binding domain. Mol. Cell. Biol., 19: 594-601, 1999.[Abstract/Free Full Text]
-
Xu W., Rould M. A., Jun S., Desplan C., Pabo C. O. Crystal structure of a paired domain-DNA complex at 2.5 A resolution reveals structural basis for Pax developmental mutations. Cell, 80: 639-650, 1995.[Medline]
-
Vogan K. J., Epstein D. J., Trasler D. G., Gros P. The splotch-delayed (Spd) mouse mutant carries a point mutation within the paired box of the Pax-3 gene. Genomics, 17: 364-369, 1993.[Medline]
-
Hoth C. F., Milunsky A., Lipsky N., Sheffer R., Clarren S. K., Baldwin C. T. Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I). Am. J. Hum. Genet., 52: 455-462, 1993.[Medline]
-
Underhill D. A., Vogan K. J., Gros P. Analysis of the mouse Splotch-delayed mutation indicates that the Pax-3 paired domain can influence homeodomain DNA-binding activity. Proc. Natl. Acad. Sci. USA, 92: 3692-3696, 1995.[Abstract/Free Full Text]
-
Kawai S., Nishizawa M. New procedure for DNA transfection with polycation and dimethyl sulfoxide. Mol. Cell. Biol., 4: 1172-1174, 1984.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Aoki, H. Jiang, and P. K. Vogt
Proteasomal degradation of the FoxO1 transcriptional regulator in cells transformed by the P3k and Akt oncoproteins
PNAS,
September 14, 2004;
101(37):
13613 - 13617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. W. So and M. L. Cleary
Common mechanism for oncogenic activation of MLL by forkhead family proteins
Blood,
January 15, 2003;
101(2):
633 - 639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zhang and C. Wang
PAX3-FKHR Transformation Increases 26 S Proteasome-dependent Degradation of p27Kip1, a Potential Role for Elevated Skp2 Expression
J. Biol. Chem.,
January 3, 2003;
278(1):
27 - 36.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. W. So and M. L. Cleary
MLL-AFX Requires the Transcriptional Effector Domains of AFX To Transform Myeloid Progenitors and Transdominantly Interfere with Forkhead Protein Function
Mol. Cell. Biol.,
September 15, 2002;
22(18):
6542 - 6552.
[Abstract]
[Full Text]
[PDF]
|
 |
|