| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cell Growth & Differentiation |
State University of New York Health Science Center, Syracuse, New York 13210
 |
Abstract |
|---|
 TOP Abstract IntroductionResultsDiscussionMaterials and MethodsReferences |
|---|
|
Introduction |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsReferences |
|---|
In the normal colon, epithelial cells form a monolayer that invaginates into test tube-shaped cylinders termed crypts that extend into the gut wall. Cells differentiate into fluid-transporting enterocytes or mucin-producing goblet cells as they migrate from the stem cells located near the crypt base toward the gut lumen. The differentiated cells cease division in the upper one-third of the crypt and are considered postmitotic. High levels of both TGF-ß1 and TGF-
are found at this region of the colonic crypt (9
, 10)
, suggesting that both growth factors may mediate normal colonocyte maturation. This is a likely hypothesis for TGF-ß1, because cell line models for the most common colonic epithelial cell type, the fluid-transporting enterocyte, are growth inhibited by TGF-ß1 (11, 12, 13)
. Supporting this in vitro data, the injection of TGF-ß1 into mice decreased the height of intestinal crypts and villi (14)
. We have now shown that the injection of TGF-ß1 into mice leads to an enrichment of one of the common intestinal epithelial cell types, the mucin-producing goblet cell, and we have used two independently cloned colon goblet cell lines to study the mechanism of this resistance to exogenous TGF-ß1.
|
Results |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsReferences |
|---|
; Fig. 1
). These data suggested that TGF-ß1 has differential effects on the maturation of intestinal epithelial cells, inhibiting the proliferation of absorptive epithelial cells (the major lineage in the intestine) but having less effect or no effect on the growth of mucin-producing goblet cells, the second most-common cell type. To test this hypothesis, we used two independently cloned colon cell lines, HD6 and HD8. When cultured under permissive conditions, these cells differentiate morphologically and functionally (Fig. 1)
into a monolayer of cells that are indistinguishable from mature goblet cells (11)
. The HD6 and HD8 goblet cell lines show no detectable growth inhibition at levels of TGF-ß1 capable of blocking the proliferation of other cell lines (11)
.
|
|
, using GAPDH as the positive control. Western blotting of TßRI, TßRII, and the endoglin form of TßRIII also demonstrated equivalent protein levels of these receptors in TGF-ß1-insensitive goblet cells (Fig. 3, G
) and four TGF-ß1-responsive HT29 sublines (Fig. 3)
. Therefore, the down-regulation of functional TßRs on colon goblet cells did not occur by down-regulation at the transcriptional or translational level of any of these receptors.
|
|
. Betaglycan is heavily modified by glycosaminoglycan groups and by N-glycosylation, causing the fully modified mature form to migrate in SDS-PAGE gels as a heterogeneous diffuse band from roughly Mr 280,000 to Mr 330,000. There are six Ser-Gly sequences in the betaglycan extracellular domain that may serve as attachment points for heparan sulfate or chondroitin sulfate (5
, 7)
. In addition, the extracellular domain contains seven canonical sites for N-linked glycosylation (5
, 7)
.
|
). Partially modified betaglycan of about Mr 120,000 was observed in both cell lines. In parallel experiments, cells were treated with tunicamycin, which inhibits cotranslational N-linked glycosylation. Tunicamycin pretreatment eliminated the fully mature betaglycan species in HD6 cells and greatly reduced its abundance in HD3 cells. Tunicamycin pretreatment also prevented the formation of the Mr 120,000 betaglycan species, leading to enrichment of the core protein. These data suggest that posttranslational modification of betaglycan was impaired in the TGF-ß1-insensitive goblet cell line.
This observation was verified by direct Western blotting without immunoprecipitation using an additional two HT29 sublines, thus testing two TGF-ß1-sensitive sublines (HD3 and HD4) and two TGF-ß1-resistant sublines (HD6 and HD8). Western blotting using an antibody to the protein core of betaglycan was performed on cell lysates. In several replicate experiments, this betaglycan antibody detected a large series of bands including a broad band around Mr 300,000 that is the heterodisperse mature form, whereas partially modified forms of betaglycan migrated as diffuse bands around Mr 140,000–160,000 and Mr 120,000. As in the immunoprecipitation data, it was evident in each Western blot that the abundance of the modified betaglycan species was decreased in TGF-ß1-insensitive goblet cell lines HD6 and HD8 as compared with the TGF-ß1-responsive HD3 and HD4 cell lines (data not shown). When the cell lines were pretreated before lysis with tunicamycin to prevent N-glycosylation, approximately equal levels of the betaglycan core protein were evident in each lysate (Fig. 4B
). In tunicamycin-treated cells, the mature betaglycan band was lost, and both the core protein and the intermediate molecular weight, partially modified betaglycan species were enriched. Thus, the TßRIII betaglycan was incompletely modified in each of the two goblet cell lines.
Cell surface betaglycan was detected by cross-linking cell surface-bound 125I-labeled TGF-ß1 to the two colon goblet cell lines and the the four TGF-ß1-responsive cell lines, followed by SDS-PAGE. A broad band of 125I-labeled TGF-ß1 bound to betaglycan at around Mr 300,000 was detected in the four TGF-ß1-responsive cell lines (HD3, HD4, U9, and HP1), whereas excess cold TGF-ß1 competed this binding (Fig. 5
, first lane). The level of 125I-labeled TGF-ß1 binding to the TGF-ß1-unresponsive HD6 and HD8 cells was much lower (Fig. 5)
. Thus, both TGF-ß1-sensitive and -insensitive cell lines made equal levels of betaglycan mRNA and core protein, but posttranslational modification of betaglycan was incomplete in both TGF-ß1-insensitive goblet cell lines. This incompletely modified betaglycan could not bind TGF-ß1.
|
, irrespective of their capacity to respond to TGF-ß1. Thus, the TGF-ß resistance seen in colon goblet cells is not due to a lack of TßRI and TßRII on the cell surface.
|
We next hypothesized that if the defect in betaglycan posttranslational modification was responsible for the lack of goblet cell response to TGF-ß1, elevated levels of ligand might activate this signaling pathway. Betaglycan and endoglin have no signaling sequences. Studies have shown that both TßRIII species may function by concentrating TGF-ß in the cell periphery and presenting it to TßRII (6 , 7 , 18) . Other investigators have shown that cells lacking betaglycan contained predominantly TßRII populations with a low affinity for TGF-ß1, whereas transfectants expressing betaglycan constructs had TßRII populations with a high affinity for TGF-ß1 (18) . Colon goblet cells with incompletely modified betaglycan might respond to elevated levels of TGF-ß1.
To test this hypothesis, we treated HD6 goblet cells and, as a control, HD3 cells with a range of TGF-ß1 concentrations from 1–100 ng/ml and assayed for the induction of cyclin-dependent kinase inhibitor p21waf1/cip1 by Western blotting. TGF-ß has been shown to induce p21waf1/cip1 through a p53-independent mechanism (19)
. Maximal growth inhibition of HD3 cells occurs at 5 ng/ml TGF-ß1 (11)
. p21 induction was strongly elevated at 1 ng/ml TGF-ß1 in HD3 cells, was maintained at 10 ng/ml, and decreased only slightly at 100 ng/ml (Fig. 7)
. In contrast, little elevation of p21 levels was detected in HD6 cells treated with 1 ng/ml TGF-ß1, and little added induction was seen until TGF-ß1 was added at 100 ng/ml, which is 20-fold the optimal inhibitory concentration for HD3 cells (Fig. 7)
. Thus, colon goblet cells possess functional cell surface TßRI and TßRII and could respond to TGF-ß1 if the concentration of ligand was high, possibly to overcome the poor affinity of the incompletely modified betaglycan. At the very high concentration of 100 ng/ml, TGF-ß1 might bind directly to TßRII. To demonstrate that the TGF-ß1 signaling observed did occur through the TßRII, a DN mutant of TßRII was introduced into HD6 cells. Signaling activated by the very high level of 100 ng/ml TGF-ß1 was tested in two clones transfected with this DN TßRII, R1 and R2, and two control, vector-only transfectants. Both control HD6 transfectants and both TßRII DN transfectants responded to 100 ng/ml TGF-ß1 by p21 induction (Fig. 8
, top). However, when the transfectants were treated with Zn2+, expression of the DN TßRII eliminated TGF-ß1 signaling and p21 appearance in both DN TßRII transfectants, whereas the control, empty vector transfectants still responded to TGF-ß1 by p21 induction (Fig. 8
, bottom). These data suggest that colon goblet cells possess functional cell surface TßRI and TßRII and can respond to TGF-ß1 if the concentration of ligand is high enough to overcome the poor affinity of the incompletely modified betaglycan.
|
|
2ß1 integrin (12)
. Because goblet cell lines are strongly adherent to plastic and secrete various extracellular matrix components (data not shown), there might be selection pressure to maintain cell surface 2ß1 integrin.
Analysis of ß1 integrin maturation was performed in two clones (R1 and R2) transfected with a Zn2+-inducible DN mutant of TßRII and in one control, vector-only transfectant cell line (M1). ß1 integrin migrated as a broad band of highly glycosylated mature forms at Mr 140,000–145,000, whereas the less glycosylated precursor forms migrated at Mr 105,000–115,000, as seen in our earlier studies with the HD6 goblet cell line (22)
. The broadness of the bands reflects the polydisperse nature of the glycosylation. In the control transfectant M1, about 80% of ß1 integrin migrated as the mature form, with or without induction of the vector with Zn2+ (Fig. 9)
. In contrast, when the DN TßRII was expressed with Zn2+ treatment, the maturation of ß1 integrin was inhibited, and the majority of ß1 integrin remained in the precursor form in both transfectant cell lines. The simplest hypothesis from these data is that the functional TßRI and TßRII on these two goblet cell lines respond to the autocrine TGF-ß1 produced by these cells by maintaining ß1 integrin in a fully glycosylated mature form so that it can heterodimerize with integrin 2 chain and form a functional collagen I receptor. Because this response to autocrine TGF-ß1 occurs in cells that lack a functional TßRIII, this data indicate that such a receptor is unnecessary. In such cells, response to exogenous TGF-ß1 would be inhibited, but response to autocrine TGF-ß1 would be maintained. This is a novel mechanism for separating cellular responses to TGF-ß1 from autocrine and from paracrine sources.
|
|
Discussion |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsReferences |
|---|
Recently, normal non-neoplastic plasma cells were found to be sensitive to TGF-ß-mediated growth arrest and apoptosis, whereas each of 15 plasmacytomas was resistant to TGF-ß, giving the transformed cells a pronounced growth advantage (24) . Plasmacytoma cells were resistant to TGF-ß because they lacked functional TßRs capable of binding 125I-labeled TGF-ß, although the cells expressed TßRI and TßRII (24) , similar to the goblet cells described in the current study. However, in contrast to plasmacytomas, colon goblet cells also express functional TßRI and TßRII on the cell surface.
Differential regulation by TGF-ß1 of intestinal goblet cells and absorptive enterocytic cells within the same crypt may also allow alterations in the fraction of cells necessary to respond to different stresses. Stresses in the colon such as that observed in inflammatory bowel disease are known to inhibit goblet cell maturation, leading to the production of less mucous. Other conditions in which the ratio of mature goblet cells:absorptive epithelial cells is decreased include microscopic colitis, lymphocytic colitis, radiation colitis (also called radiation enteritis), and the presence of inflammatory fibroid polyps.
Aberrant glycosylation of TßRIII may be a likely mechanism for TGF-ß resistance and malignant progression in human colon cancer. Most colon cancer cells do not respond to TGF-ß by growth inhibition (25) . However, a gene defect has been identified only in a minority of cases (about 30% with mutations in either smad4, smad2, or TßRII; Refs. 16 and 26 ). We do not yet know the mechanism for loss of TßRIII glycosylation, but down-regulation of N-acetylglucosaminyltransferase V is a likely candidate (data not shown). TGF-ß resistance by any mechanism is likely to have profound consequences for colon carcinogenesis. Although smad3 mutations have not been detected in colorectal cancers (26) , targeted homozygous disruption of smad3 in mice caused metastatic colon cancer (27) .
In this report, we show evidence that the functional TßRI and TßRII on these two goblet cell lines respond to the autocrine TGF-ß1 produced by these cells by maintaining ß1 integrin in a fully glycosylated mature form so that it can heterodimerize with the integrin 2 chain and form a functional collagen I receptor. This necessity to maintain 2ß1 integrin receptors to maintain cell adhesion may provide a selection bias for TßRI and TßRII in culture and in vivo where goblet cells intermingle with absorptive epithelial cells within the cell monolayer, forming a colonic crypt. Decreased ß1 integrin expression has been associated with a more malignant and invasive phenotype in several tumor cell models (28)
. During cancer progression, the maintenance of functional TßRI and TßRII may allow cancer cells that make TGF-ß1, such as prostate cancer cells (29)
and colon cancer cells (30)
, to maintain expression of the type IV collagenase matrix metalloproteinase 9 (31)
, which has a known role in metastasis. Thus, TGF-ß-resistant but TGF-ß-secreting cancer cells could make the tumor microenvironment favorable for continued growth and invasion.
|
Materials and Methods |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsReferences |
|---|
RT-PCR and Sequencing.
Total RNA was isolated from monolayer cultures with Trizol (Life Technologies, Inc.) according to the manufacturer’s manual. RNA was treated with DNase I (Life Technologies, Inc.; amplification grade), and RT-PCR was performed on a Perkin-Elmer Corp. DNA Thermal Cycler 480 using Promega’s access RT-PCR kit as follows: (a) reverse transcription at 48°C for 45 min; (b) denaturation at 94°C for 2 min and 30 s; and (c) PCR for 30–40 cycles (20 cycles for GAPDH) at 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min. The amplification products were analyzed by ethidium bromide agarose gel electrophoresis. The primer sets for PCR and the size of the expected amplification products, respectively, were as follows: alk-5, GTGCACCCTCTTCAAAAACTG and TCTCCAAACTTCTCCAAATCG, 403 bp; TßRII, TGGAGAAAGAATGACGAGAAC and TAACGCGGTAGCAGTAGAAGA, 313 bp; betaglycan, CCGAACTCAAGATAGCAAGAA and TCAGGAGGAATGGTGTGGACT, 592 bp; alk2, TGGTAGATGGAGTGATGATTC and TTGGTGGTGATGAGCCCTTCG, 499 bp; second set for alk2, ATGGACATTTTCTTTTATTAT and GCATTTTCCCCGTAGCGTTCA, 176 bp; GAPDH (from Clontech), 452bp.
Cell Culture.
The HT29 sublines HD6 and HD8 (which are capable of goblet cell differentiation when placed at permissive conditions) and HD3 and HD4 (which are capable of fluid-transporting enterocyte differentiation when placed at permissive conditions) were maintained in low-glucose DMEM buffered with 25 mM HEPES (Atlanta Biologicals) and containing 7% fetal bovine serum, as described previously (11)
. Serum-free insulin/transferrin/selenous acid-supplemented DMEM and DMEM containing 0.2% fetal bovine serum were used for the TGF-ß1 and TGF- growth experiments, respectively, as described previously (11)
.
Immunoprecipitation of TßRIII.
Cell lysates (500 µg) were incubated overnight at 4°C with 2 µg of anti-TßRIII antibody and 40 µl of protein G plus-agarose (Santa Cruz Biotechnology), pelleted at 2500 rpm, and washed three times with lysis buffer. After the final wash, the pellet was mixed with 50 µl of SDS sample buffer and boiled in a water bath for 5 min. Aliquots were analyzed by SDS-PAGE, and TßRIII was detected by Western blotting using anti-TßRIII antibody, horseradish peroxidase-rabbit antigoat IgG (Zymed), and enhanced chemiluminescence.
Inducible Expression of DN TßRII.
DN TßRIIK277R in pMEP4 tagged with the Lerner epitope of influenza hemagglutinin was obtained from J. Massague (4)
. High levels of TßRII were expressed after an induction with 50 µM ZnCl2 in HD6 goblet cells and as a control in TGF-ß1-responsive HD3 cells by transfection with either the wild-type TßRII expression plasmid or the empty episomal vector pMEP4 as a control. The plasmid contains the EBV replication origin and the EBNA-1 nuclear antigen to allow extrachromosomal replication in eukaryotic cells.
Immunodetection.
Cells grown in complete media were lysed in buffer containing 25 mM Tris (pH 7.4), 1% Triton X-100, 20 µg/ml leupeptin, 20 µg/ml aprotinin, 0.5 mM phenylmethylsulfonyl fluoride, 200 µM sodium orthovanadate, and 20 mM sodium fluoride. Depending on the experiment, 30–70 µg of cell lysate proteins were blotted onto polyvinylidene difluoride membranes after separation on SDS-PAGE. The blots were blocked in TBST blocking buffer [TBS containing 0.05% Tween 20] and 3% nonfat dry milk for 1 h at RT. Anti-p21waf1/cip1 (0.5 µg/ml), TßRI (1 µg/ml), TßRII (1 µg/ml), TßRIII (betaglycan; 1 µg/ml), endoglin (1 µg/ml), and ß1 integrin (1:2500 dilution) were used in TBST containing 1% dry milk and then incubated for 2–3 h with the primary antibody, and proteins were subsequently detected by enhanced chemiluminescence (Amersham). For p21cip1 blots, cells were lysed in radioimmunoprecipitation assay buffer, and blocking was performed in 1% dry milk plus 1% BSA.
Tunicamycin Treatment.
Cells were treated with 10 µg/ml tunicamycin for 48 h before lysis in 25 mM Tris buffer containing 1% Triton X-100 and protease/phosphatase inhibitors as described previously.
Cell Surface Biotinylation and Western Blotting of TßRI and TßRII.
Cell surface proteins were biotinylated essentially as described by the vendor (Amersham). Briefly, exponentially growing cells were washed once with cold PBS and once with 40 mM sodium bicarbonate (pH 8.6). Cells were then incubated for 30 min at 4°C in 40 mM bicarbonate buffer containing 30 µl of biotin reagent/ml of buffer. After two washes with cold PBS, cells were lysed in 25 mM Tris buffer containing 1% Triton X-100, 20 µg/ml leupeptin, 20 µg/ml aprotinin, 0.5 mM phenylmethylsulfonyl fluoride, 200 µM sodium orthovanadate, and 20 mM sodium fluoride. Cell lysates (300 µg) were incubated overnight at 4°C with 200 µl of streptavidin coupled to agarose beads (Sigma). The beads were then washed extensively and resuspended in SDS-PAGE sample buffer. TßRI and TßRII were detected by immunoblotting as described previously.
Affinity Labeling of TßRs.
Late log-phase cells were washed twice with PBS and twice with binding buffer [50 mM HEPES buffer (pH 7.4) containing 128 mM NaCl, 5 mM KCl, 1.2 mM CaCl2, and 5 mM MgSO4] and treated with dissociation buffer for 3 min on ice [0.1% acetic acid (pH 2.5) containing 150 mM sodium chloride and 1 mg/ml BSA] to remove bound TGF-ß isoforms. After two more washes with binding buffer, the cells were labeled by cross-linking as described previously (15)
with 2 ng/ml 125I-labeled TGF-ß1 (100.4 µCi/µg). Protein (200 µg/lane) was analyzed by 5–8% gradient gel SDS-PAGE, followed by autoradiography for 14 days at -70 with intensifying screens.
|
Acknowledgments |
|---|
. |
Footnotes |
|---|
1 Supported by National Cancer Institute Grant RO1 CA75708 (to E. F.) and the Jones/Rohner Endowment Fund (E. F.). 
2 To whom requests for reprints should be addressed, at State University of New York Health Science Center at Syracuse, Pathology Department, 2305 Weiskotten Hall, 750 East Adams Street, Syracuse, NY 13210. Phone: (315) 464-7148; Fax: (315) 464-8419; E-mail: friedmae{at}vax.cs.hscsyr.edu
3 The abbreviations used are: TGF, transforming growth factor; TßR, TGF-ß receptor; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DN, dominant negative.
4 S. Bellis and E. Friedman. Steps in integrin ß1-chain glycosylation mediated by TGFß1 signaling through Ras, submitted for publication.
Received for publication 9/18/98. Revision received 11/16/98. Accepted for publication 11/17/98.
|
References |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsReferences |
|---|
in the normal adult gastrointestinal tract. Gut, 33: 628-631, 1992.This article has been cited by other articles:
 |
|
 |
|
  K. Jin, D. Z. Ewton, S. Park, J. Hu, and E. Friedman Mirk Regulates the Exit of Colon Cancer Cells from Quiescence J. Biol. Chem., August 21, 2009; 284(34): 22916 - 22925. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. J. You, T. How, and G. C. Blobe The type III transforming growth factor-{beta} receptor negatively regulates nuclear factor kappa B signaling through its interaction with {beta}-arrestin2 Carcinogenesis, August 1, 2009; 30(8): 1281 - 1287. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Mythreye and G. C. Blobe The type III TGF-{beta} receptor regulates epithelial and cancer cell migration through {beta}-arrestin2-mediated activation of Cdc42 PNAS, May 19, 2009; 106(20): 8221 - 8226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. Finger, N. Y. Lee, H.-j. You, and G. C. Blobe Endocytosis of the Type III Transforming Growth Factor-{beta} (TGF-{beta}) Receptor through the Clathrin-independent/Lipid Raft Pathway Regulates TGF-{beta} Signaling and Receptor Down-regulation J. Biol. Chem., December 12, 2008; 283(50): 34808 - 34818. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. Finger, R. S. Turley, M. Dong, T. How, T. A. Fields, and G. C. Blobe T{beta}RIII suppresses non-small cell lung cancer invasiveness and tumorigenicity Carcinogenesis, March 1, 2008; 29(3): 528 - 535. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. J. You, M. W. Bruinsma, T. How, J. H. Ostrander, and G. C. Blobe The type III TGF- receptor signals through both Smad3 and the p38 MAP kinase pathways to contribute to inhibition of cell proliferation Carcinogenesis, December 1, 2007; 28(12): 2491 - 2500. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Pakula, A. Melchior, A. Denys, C. Vanpouille, J. Mazurier, and F. Allain Syndecan-1/CD147 association is essential for cyclophilin B-induced activation of p44/42 mitogen-activated protein kinases and promotion of cell adhesion and chemotaxis Glycobiology, May 1, 2007; 17(5): 492 - 503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Deng, S. E. Mercer, S. Shah, D. Z. Ewton, and E. Friedman The Cyclin-dependent Kinase Inhibitor p27Kip1 Is Stabilized in G0 by Mirk/dyrk1B Kinase J. Biol. Chem., May 21, 2004; 279(21): 22498 - 22504. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Chen, K. C. Kirkbride, T. How, C. D. Nelson, J. Mo, J. P. Frederick, X.-F. Wang, R. J. Lefkowitz, and G. C. Blobe {beta}-Arrestin 2 Mediates Endocytosis of Type III TGF-{beta} Receptor and Down-Regulation of Its Signaling Science, September 5, 2003; 301(5638): 1394 - 1397. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Wimmel, B Wiedenmann, and S Rosewicz Autocrine growth inhibition by transforming growth factor {beta}-1 (TGF{beta}-1) in human neuroendocrine tumour cells Gut, September 1, 2003; 52(9): 1308 - 1316. [Abstract] [Full Text]
|
|
|
|
 |
|
 K. L. Stenvers, M. L. Tursky, K. W. Harder, N. Kountouri, S. Amatayakul-Chantler, D. Grail, C. Small, R. A. Weinberg, A. M. Sizeland, and H.-J. Zhu Heart and Liver Defects and Reduced Transforming Growth Factor {beta}2 Sensitivity in Transforming Growth Factor {beta} Type III Receptor-Deficient Embryos Mol. Cell. Biol., June 15, 2003; 23(12): 4371 - 4385. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yan, G.-Y. Kim, X. Deng, and E. Friedman Transforming Growth Factor beta 1 Induces Proliferation in Colon Carcinoma Cells by Ras-dependent, smad-independent Down-regulation of p21cip1 J. Biol. Chem., March 15, 2002; 277(12): 9870 - 9879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. C. Blobe, X. Liu, S. J. Fang, T. How, and H. F. Lodish A Novel Mechanism for Regulating Transforming Growth Factor beta (TGF-beta ) Signaling. FUNCTIONAL MODULATION OF TYPE III TGF-beta RECEPTOR EXPRESSION THROUGH INTERACTION WITH THE PDZ DOMAIN PROTEIN, GIPC J. Biol. Chem., October 19, 2001; 276(43): 39608 - 39617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Lee, X. Deng, and E. Friedman Mirk Protein Kinase Is a Mitogen-activated Protein Kinase Substrate That Mediates Survival of Colon Cancer Cells Cancer Res., July 1, 2000; 60(13): 3631 - 3637. [Abstract] [Full Text]
|
|
|
|
 |
|
 A.-E. Biemer-Huttmann, M. D. Walsh, M. A. McGuckin, L. A. Simms, J. Young, B. A. Leggett, and J. R. Jass Mucin Core Protein Expression in Colorectal Cancers with High Levels of Microsatellite Instability Indicates a Novel Pathway of Morphogenesis Clin. Cancer Res., May 1, 2000; 6(5): 1909 - 1916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yan, X. Deng, and E. Friedman Oncogenic Ki-ras Confers a More Aggressive Colon Cancer Phenotype through Modification of Transforming Growth Factor-beta Receptor III J. Biol. Chem., January 5, 2001; 276(2): 1555 - 1563. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. De Crescenzo, S. Grothe, J. Zwaagstra, M. Tsang, and M. D. O'Connor-McCourt Real-time Monitoring of the Interactions of Transforming Growth Factor-beta (TGF-beta ) Isoforms with Latency-associated Protein and the Ectodomains of the TGF-beta Type II and III Receptors Reveals Different Kinetic Models and Stoichiometries of Binding J. Biol. Chem., August 3, 2001; 276(32): 29632 - 29643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. C. Blobe, W. P. Schiemann, M.-C. Pepin, M. Beauchemin, A. Moustakas, H. F. Lodish, and M. D. O'Connor-McCourt Functional Roles for the Cytoplasmic Domain of the Type III Transforming Growth Factor beta Receptor in Regulating Transforming Growth Factor beta Signaling J. Biol. Chem., June 29, 2001; 276(27): 24627 - 24637. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cell Growth & Differentiation |
