CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, X.
Right arrow Articles by Friedman, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, X.
Right arrow Articles by Friedman, E.
Cell Growth & Differentiation Vol. 10, 11-18, January 1999
© 1999 American Association for Cancer Research

Differential Responsiveness to Autocrine and Exogenous Transforming Growth Factor (TGF) ß1 in Cells with Nonfunctional TGF-ß Receptor Type III1

Xiaobing Deng, Susan Bellis, Zhongfa Yan and Eileen Friedman2

State University of New York Health Science Center, Syracuse, New York 13210


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The two major intestinal epithelial cell lineages are columnar fluid-absorbing cells and mucin-producing goblet cells. High levels of transforming growth factor (TGF) ß1 are found surrounding postmitotic cells in the colonic crypt, suggesting that TGF-ß1 mediates the maturation and growth inhibition of both epithelial cell types. However, we now show that the injection of recombinant TGF-ß1 into mice leads to an enrichment of goblet cells, indicating that these normal epithelial cells are resistant to TGF-ß1. In support of this interpretation, each of two independently isolated cell lines modeling normal colon goblet cells was also growth resistant to exogenous TGF-ß1 but made levels of TGF-ß receptor (TßR) I, TßRII, and TßIII mRNA and protein equal to those made by two TGF-ß1-sensitive cell lines. No mutations were found in the alk5 or alk2 forms of TßRI or in TßRII; these receptors were found on the cell surface, although they could not bind 125I-labeled TGF-ß1. TßRIII binds TGF-ß1, concentrates it, and presents it to TßRII. The major TßRIII form, betaglycan, did not undergo normal posttranslational modification in either of the goblet cell lines and could not bind 125I-labeled TGF-ß1; thus, it was nonfunctional. TGF-ß resistance was overcome by raising TGF-ß1 levels 100-fold, at which point TßRII could bind TGF-ß1. Signaling initiated by these higher TGF-ß1 levels was blocked by the expression of dominant negative TßRII, demonstrating that TßRII and TßRI were functional. Cells resistant to exogenous TGF-ß1 maintained functional cell surface TßRI and TßRII to mediate responses to autocrine TGF-ß1, which controlled the maturation of the adhesion protein integrin ß1. Expression of dominant negative TßRII in goblet cells greatly inhibited the conversion of the ß1 integrin from its precursor to its mature form. Thus, in normal intestinal epithelial goblet cells, TßRI and TßRII can respond to autocrine but not exogenous TGF-ß without the participation of TßRIII. Absorptive epithelial cells are growth inhibited by TGF-ß1 both in vivo and in vitro; therefore, the loss of functional TßRIIIs on goblet cells allows differential regulation of the two major intestinal epithelial cell types.


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
TGF-ß3 is a multifunctional protein that regulates cell proliferation, differentiation, migration, extracellular matrix formation, and immunosuppression. Three TGF-ß isoforms have been identified in humans: (a) ß1; (b) ß2; and (c) ß3. The TGF-ßs belong to a superfamily of structurally related proteins that includes the activins, inhibins, and bone morphogenic proteins (1) . The TGF-ßs induce diverse biological responses by binding to the high-affinity receptors TßRI (Mr 53,000) and TßRII (Mr 75,000), which function as a heterodimer. Both receptors have a cysteine-rich extracellular domain, one transmembrane segment, and a cytoplasmic tail that includes a serine/threonine kinase domain (2 , 3) . Constitutively phosphorylated TßRII binds TGF-ß1, and then TßRI is recruited into the complex. TßRI is transphosphorylated by TßRII and propagates the signal by its kinase activity to downstream substrates (4) . Two other cell surface TGF-ß-binding proteins are the type III receptors betaglycan and endoglin, which modulate cellular responses to TGF-ß but have no signaling sequences. Betaglycan and endoglin may function by regulating TGF-ß access to TßRII (5, 6, 7) . TßRIIIs are not found in every TGF-ß-responsive cell and are down-regulated during myoblast differentiation into myotubes (8) .

In the normal colon, epithelial cells form a monolayer that invaginates into test tube-shaped cylinders termed crypts that extend into the gut wall. Cells differentiate into fluid-transporting enterocytes or mucin-producing goblet cells as they migrate from the stem cells located near the crypt base toward the gut lumen. The differentiated cells cease division in the upper one-third of the crypt and are considered postmitotic. High levels of both TGF-ß1 and TGF-{alpha} are found at this region of the colonic crypt (9 , 10) , suggesting that both growth factors may mediate normal colonocyte maturation. This is a likely hypothesis for TGF-ß1, because cell line models for the most common colonic epithelial cell type, the fluid-transporting enterocyte, are growth inhibited by TGF-ß1 (11, 12, 13) . Supporting this in vitro data, the injection of TGF-ß1 into mice decreased the height of intestinal crypts and villi (14) . We have now shown that the injection of TGF-ß1 into mice leads to an enrichment of one of the common intestinal epithelial cell types, the mucin-producing goblet cell, and we have used two independently cloned colon goblet cell lines to study the mechanism of this resistance to exogenous TGF-ß1.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Two Types of Normal Intestinal Epithelial Cells Show Differential Regulation by TGF-ß1.
Elevated protein levels of TGF-ß1 are found in the upper third of the colonic crypt in the region of postmitotic cells, suggesting that TGF-ß1 mediates colonocyte maturation. The injection of TGF-ß1 into 10–12-week-old mice inhibited the length of intestinal crypts and villi, which is consistent with a reduction in the number of progenitor cells released from the stem cell compartment and with a decreased proliferation of the differentiating cells that ascend the crypt to form the villi and are then shed (14) . We repeated this experiment but performed only half as many injections of TGF-ß1. This protocol approximately doubled the percentage of mucin-producing goblet cells in two pairs of mice (Table 1Citation ; Fig. 1Citation ). These data suggested that TGF-ß1 has differential effects on the maturation of intestinal epithelial cells, inhibiting the proliferation of absorptive epithelial cells (the major lineage in the intestine) but having less effect or no effect on the growth of mucin-producing goblet cells, the second most-common cell type. To test this hypothesis, we used two independently cloned colon cell lines, HD6 and HD8. When cultured under permissive conditions, these cells differentiate morphologically and functionally (Fig. 1)Citation into a monolayer of cells that are indistinguishable from mature goblet cells (11) . The HD6 and HD8 goblet cell lines show no detectable growth inhibition at levels of TGF-ß1 capable of blocking the proliferation of other cell lines (11) .


View this table:
[in this window]
[in a new window]
 
Table 1 Percentage of goblet cells of total intestinal epithelial cells

 


View larger version (103K):
[in this window]
[in a new window]
 
Fig. 1. Sections of intestinal epithelium from control (CT) and TGF-ß1-treated mice were stained for goblet cell mucins with Alcian blue dye, and nuclei were stained with nuclear fast red. TGF-ß1-treated intestinal epithelium was enriched in Alcian blue-positive goblet cells relative to untreated control epithelium. HD6 colon goblet cell line shown was grown on permeable supports in transwells. HD6 cells differentiated to mature goblet cells with apical theca filled with mucin granules that bind Alcian blue dye and also exhibit a basal nucleus, similar to normal goblet cells in the sections. With extended culture, the theca in HD6 cells will burst, releasing mucin granules as in vivo (11) .

 
Both TGF-ß1-insensitive Goblet Cell Lines Express Levels of TßRI, TßRII, and TßRIII Protein and mRNA Equal to the Levels Expressed in TGF-ß1-responsive Cell Lines.
In our earlier studies, four TGF-ß1-responsive HT29 sublines (HD3, HD4, HP1, and U9) and two TGF-ß1-insensitive HT29 goblet cell sublines (HD6 and HD8) were cross-linked with 125I-labeled TGF-ß1 to measure cell surface TßRs. In each of the four TGF-ß1-responsive cell lines, TGF-ß1 was cross-linked to TßRI and TßRII, whereas neither receptor bound TGF-ß1 in the two goblet cell lines (15) . We now tested whether the functional down-regulation of TßRI and TßRII in both goblet cell lines was due to down-regulation on either the transcriptional or the translational level. Steady-state mRNA levels were assayed by RT-PCR in the four TGF-ß1-responsive HT29 sublines and the two TGF-ß1-insensitive HT29 goblet cell sublines. Roughly equal levels of mRNA were detected for TßRII, TßRIII, and the two forms of TßRI displayed on mammalian cells, alk5 and the less abundant alk2 (Fig. 2)Citation , using GAPDH as the positive control. Western blotting of TßRI, TßRII, and the endoglin form of TßRIII also demonstrated equivalent protein levels of these receptors in TGF-ß1-insensitive goblet cells (Fig. 3, GCitation ) and four TGF-ß1-responsive HT29 sublines (Fig. 3)Citation . Therefore, the down-regulation of functional TßRs on colon goblet cells did not occur by down-regulation at the transcriptional or translational level of any of these receptors.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 2. Both TGF-ß1-insensitive colon goblet cell lines, HD6 and HD8, exhibit equal levels of mRNA for TßRI (alk5), TßRII, and TßRIII compared to four TGF-ß1-responsive HT29 colon carcinoma sublines (HD3, HD4, U9, and HP1) by RT-PCR with GAPDH assayed as an internal control. Expression of the TßRI form alk2 was also detected by RT-PCR at equal levels in TGF-ß1-unresponsive HD6 cells and in TGF-ß1-responsive HD3 and U9 cells. alk2 mRNA was detected using two sets of primers.

 


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3. Both TGF-ß1-insensitive colon goblet cell lines (G) express protein levels of TßRI, TßRII, and TßRIII endoglin equal to those expressed by the four TGF-ß1-responsive cell lines. E, enterocytic differentiated cells; U, undifferentiated cells.

 
TGF-ß1-insensitive Goblet Cell Lines Express Incompletely Modified Betaglycan Incapable of Binding TGF-ß1.
The more abundant form of TßRIII, betaglycan, was immunoprecipitated from TGF-ß1-insensitive HD6 goblet cells and TGF-ß1-responsive HD3 cells, followed by immunoblotting. (Fig. 4)Citation . Betaglycan is heavily modified by glycosaminoglycan groups and by N-glycosylation, causing the fully modified mature form to migrate in SDS-PAGE gels as a heterogeneous diffuse band from roughly Mr 280,000 to Mr 330,000. There are six Ser-Gly sequences in the betaglycan extracellular domain that may serve as attachment points for heparan sulfate or chondroitin sulfate (5 , 7) . In addition, the extracellular domain contains seven canonical sites for N-linked glycosylation (5 , 7) .



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. A, immunoprecipitation with antibetaglycan followed by Western blot with the same antibody showing a decreased abundance in TGF-ß1-unresponsive HD6 goblet cells compared to TGF-ß1-sensitive HD3 cells of the fully posttranslationally modified betaglycan. Betaglycan is polydisperse and migrates in a broad band from Mr 280,000–330,000 because of posttranslational modifications including glycosylation and proteoglycanation. B, Western blot for the betaglycan of TGF-ß1-unresponsive HD6 and HD8 goblet cell lines and TGF-ß1-sensitive HD3 and HD4 cell lines pretreated with tunicamycin to block N-glycosylation. Inhibition of N-glycosylation shifts much of the betaglycan into a faster-migrating form consistent in molecular weight to the core peptide, with similar levels present in each cell line.

 
The TGF-ß1-responsive HD3 cell line exhibited much higher levels of the Mr 300,000, fully modified, mature betaglycan than did the TGF-ß1-insensitive HD6 cells (Fig. 4ACitation ). Partially modified betaglycan of about Mr 120,000 was observed in both cell lines. In parallel experiments, cells were treated with tunicamycin, which inhibits cotranslational N-linked glycosylation. Tunicamycin pretreatment eliminated the fully mature betaglycan species in HD6 cells and greatly reduced its abundance in HD3 cells. Tunicamycin pretreatment also prevented the formation of the Mr 120,000 betaglycan species, leading to enrichment of the core protein. These data suggest that posttranslational modification of betaglycan was impaired in the TGF-ß1-insensitive goblet cell line.

This observation was verified by direct Western blotting without immunoprecipitation using an additional two HT29 sublines, thus testing two TGF-ß1-sensitive sublines (HD3 and HD4) and two TGF-ß1-resistant sublines (HD6 and HD8). Western blotting using an antibody to the protein core of betaglycan was performed on cell lysates. In several replicate experiments, this betaglycan antibody detected a large series of bands including a broad band around Mr 300,000 that is the heterodisperse mature form, whereas partially modified forms of betaglycan migrated as diffuse bands around Mr 140,000–160,000 and Mr 120,000. As in the immunoprecipitation data, it was evident in each Western blot that the abundance of the modified betaglycan species was decreased in TGF-ß1-insensitive goblet cell lines HD6 and HD8 as compared with the TGF-ß1-responsive HD3 and HD4 cell lines (data not shown). When the cell lines were pretreated before lysis with tunicamycin to prevent N-glycosylation, approximately equal levels of the betaglycan core protein were evident in each lysate (Fig. 4BCitation ). In tunicamycin-treated cells, the mature betaglycan band was lost, and both the core protein and the intermediate molecular weight, partially modified betaglycan species were enriched. Thus, the TßRIII betaglycan was incompletely modified in each of the two goblet cell lines.

Cell surface betaglycan was detected by cross-linking cell surface-bound 125I-labeled TGF-ß1 to the two colon goblet cell lines and the the four TGF-ß1-responsive cell lines, followed by SDS-PAGE. A broad band of 125I-labeled TGF-ß1 bound to betaglycan at around Mr 300,000 was detected in the four TGF-ß1-responsive cell lines (HD3, HD4, U9, and HP1), whereas excess cold TGF-ß1 competed this binding (Fig. 5Citation , first lane). The level of 125I-labeled TGF-ß1 binding to the TGF-ß1-unresponsive HD6 and HD8 cells was much lower (Fig. 5)Citation . Thus, both TGF-ß1-sensitive and -insensitive cell lines made equal levels of betaglycan mRNA and core protein, but posttranslational modification of betaglycan was incomplete in both TGF-ß1-insensitive goblet cell lines. This incompletely modified betaglycan could not bind TGF-ß1.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 5. Colon goblet cells show no functional cell surface betaglycan (TßRIII) capable of binding TGF-ß1. 125I-labeled TGF-ß1 was cross-linked to four TGF-ß1-responsive HT29 colon carcinoma sublines (HD3, HD4, U9, and HP1) and two TGF-ß1-unresponsive lines (HD6 and HD8). Excess unlabeled TGF-ß1 was added to a duplicate HD3 sample and analyzed in Lane 1.

 
Each TGF-ß1-insensitive Goblet Cell Line Expresses Levels of TßRI and TßRII Protein on the Cell Surface Equal to Those Expressed in TGF-ß1-responsive Cell Lines.
We confirmed that TßRI and TßRII are present at the cell surface of HD6 and HD8 goblet cells at levels equal to those in TGF-ß1-responsive U9 and HD3 cells. Viable cells were surface labeled by biotinylation, which has been shown to label TßRI and TßRII in other cell types (4) . The biotinylated surface-labeled proteins were then collected on streptavidin-coupled beads and analyzed by Western blot for TßRII and TßRI/alk5. Equivalent amounts of TßRII and TßRI/alk5 were detected on the cell surfaces of U9, HD3, HD6, and HD8 cells (Fig. 6)Citation , irrespective of their capacity to respond to TGF-ß1. Thus, the TGF-ß resistance seen in colon goblet cells is not due to a lack of TßRI and TßRII on the cell surface.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 6. Biotin surface labeling demonstrates that both TGF-ß1-insensitive colon goblet cell lines HD6 and HD8 express cell surface TßRI and TßRII proteins at protein levels equal to those expressed on the cell surface of two TGF-ß1-responsive cell lines, U9 and HD3.

 
Colon Goblet Cells Express Functional TGF-ßRI and TßRII Capable of Responding to Very High Levels of TGF-ß1.
The data outlined above strongly suggest that the lack of functional response to TGF-ß1 in colon goblet cells is due to impaired betaglycan posttranslational processing. However, mutations in TßRII have been uncovered in repair-deficient colon carcinoma cells (16) , whereas kinase-inactivating mutations have been found in other types of cancers (17) . We sequenced TßRII by RT-PCR of overlapping fragments from bp 220–767 of the coding region that covers the polyA tracts mutated in repair-deficient syndromes and the majority of the extracellular sequence and the transmembrane domain. We found no mutations, only variations that were also found in this region in TGF-ß1-responsive U9 and HD3 cells that were sequenced in parallel (data not shown).

We next hypothesized that if the defect in betaglycan posttranslational modification was responsible for the lack of goblet cell response to TGF-ß1, elevated levels of ligand might activate this signaling pathway. Betaglycan and endoglin have no signaling sequences. Studies have shown that both TßRIII species may function by concentrating TGF-ß in the cell periphery and presenting it to TßRII (6 , 7 , 18) . Other investigators have shown that cells lacking betaglycan contained predominantly TßRII populations with a low affinity for TGF-ß1, whereas transfectants expressing betaglycan constructs had TßRII populations with a high affinity for TGF-ß1 (18) . Colon goblet cells with incompletely modified betaglycan might respond to elevated levels of TGF-ß1.

To test this hypothesis, we treated HD6 goblet cells and, as a control, HD3 cells with a range of TGF-ß1 concentrations from 1–100 ng/ml and assayed for the induction of cyclin-dependent kinase inhibitor p21waf1/cip1 by Western blotting. TGF-ß has been shown to induce p21waf1/cip1 through a p53-independent mechanism (19) . Maximal growth inhibition of HD3 cells occurs at 5 ng/ml TGF-ß1 (11) . p21 induction was strongly elevated at 1 ng/ml TGF-ß1 in HD3 cells, was maintained at 10 ng/ml, and decreased only slightly at 100 ng/ml (Fig. 7)Citation . In contrast, little elevation of p21 levels was detected in HD6 cells treated with 1 ng/ml TGF-ß1, and little added induction was seen until TGF-ß1 was added at 100 ng/ml, which is 20-fold the optimal inhibitory concentration for HD3 cells (Fig. 7)Citation . Thus, colon goblet cells possess functional cell surface TßRI and TßRII and could respond to TGF-ß1 if the concentration of ligand was high, possibly to overcome the poor affinity of the incompletely modified betaglycan. At the very high concentration of 100 ng/ml, TGF-ß1 might bind directly to TßRII. To demonstrate that the TGF-ß1 signaling observed did occur through the TßRII, a DN mutant of TßRII was introduced into HD6 cells. Signaling activated by the very high level of 100 ng/ml TGF-ß1 was tested in two clones transfected with this DN TßRII, R1 and R2, and two control, vector-only transfectants. Both control HD6 transfectants and both TßRII DN transfectants responded to 100 ng/ml TGF-ß1 by p21 induction (Fig. 8Citation , top). However, when the transfectants were treated with Zn2+, expression of the DN TßRII eliminated TGF-ß1 signaling and p21 appearance in both DN TßRII transfectants, whereas the control, empty vector transfectants still responded to TGF-ß1 by p21 induction (Fig. 8Citation , bottom). These data suggest that colon goblet cells possess functional cell surface TßRI and TßRII and can respond to TGF-ß1 if the concentration of ligand is high enough to overcome the poor affinity of the incompletely modified betaglycan.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. Colon goblet HD6 cells respond to 10–100-fold elevated levels of TGF-ß1 (100 ng/ml) by the induction of p21cip1, showing that TßRI and TßRII are functional on the cell surface but are incapable of responding to low levels of added TGF-ß1.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8. As assayed by p21cip1 production, elevated levels of TGF-ß1 (100 ng/ml) induce signaling in HD6 goblet cells by activating TßRII. Without induction of the DN TßRII (top), clones R1 and R2 are as capable of response to the elevated TGF-ß1 level as are the control transfectants V1 and V2. Transient expression of DN TßRII by Zn2+ in clones R1 and R2 blocks the 100 ng/ml TGF-ß1 induction of p21 as compared to vector-only transfectants V1 and V2 (bottom).

 
Colon Goblet Cells Retain Functional TßRI and TßRII to Maintain ß1 Integrin in a Mature, Functional Form.
The maintenance of functional cell surface TßRIs and TßRIIs on both goblet cell lines indicates that there are selection pressures to maintain the expression of these receptors. We considered the hypothesis that at least one selection pressure was the need for cell surface TßRIs and TßRIIs to continue mediating signaling from autocrine TGF-ß1. Both goblet cell lines secrete approximately as much biologically active TGF-ß1 as other HT29 sublines [about 2 ng/108 cells/24 h (11 , 20) ; data not shown]. TGF-ß1 has been shown to mediate ß1 integrin maturation from a large pool of incompletely glycosylated precursors (21) . We have found that ß1 integrin maturation in colon cancer cells can be blocked by incubation with a neutralizing antibody to TGF-ß1.4 Both goblet cell lines in this study bind to collagen I through the heterodimeric collagen receptor {alpha}2ß1 integrin (12) . Because goblet cell lines are strongly adherent to plastic and secrete various extracellular matrix components (data not shown), there might be selection pressure to maintain cell surface {alpha}2ß1 integrin.

Analysis of ß1 integrin maturation was performed in two clones (R1 and R2) transfected with a Zn2+-inducible DN mutant of TßRII and in one control, vector-only transfectant cell line (M1). ß1 integrin migrated as a broad band of highly glycosylated mature forms at Mr 140,000–145,000, whereas the less glycosylated precursor forms migrated at Mr 105,000–115,000, as seen in our earlier studies with the HD6 goblet cell line (22) . The broadness of the bands reflects the polydisperse nature of the glycosylation. In the control transfectant M1, about 80% of ß1 integrin migrated as the mature form, with or without induction of the vector with Zn2+ (Fig. 9)Citation . In contrast, when the DN TßRII was expressed with Zn2+ treatment, the maturation of ß1 integrin was inhibited, and the majority of ß1 integrin remained in the precursor form in both transfectant cell lines. The simplest hypothesis from these data is that the functional TßRI and TßRII on these two goblet cell lines respond to the autocrine TGF-ß1 produced by these cells by maintaining ß1 integrin in a fully glycosylated mature form so that it can heterodimerize with integrin {alpha}2 chain and form a functional collagen I receptor. Because this response to autocrine TGF-ß1 occurs in cells that lack a functional TßRIII, this data indicate that such a receptor is unnecessary. In such cells, response to exogenous TGF-ß1 would be inhibited, but response to autocrine TGF-ß1 would be maintained. This is a novel mechanism for separating cellular responses to TGF-ß1 from autocrine and from paracrine sources.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 9. Transient expression of DN TßRII by Zn2+ in clones R1 and R2 blocks the maturation of the ß1 integrin. Cells were treated with 50 µM ZnCl2 for 4 days before the lysis and analysis of ß1 integrin maturation.

 

    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Normal intestinal goblet cells exhibit a novel mechanism for TGF-ß1 resistance: incomplete modification of the TßRIII betaglycan. Why should the loss of cell surface betaglycan block TGF-ß1 response on colon goblet cells? Loss of TGF-ß signaling has been observed in several cell types but has been ascribed to mutations in TßRII or TßRI or mutations in the smad family of signaling mediators. Betaglycan has no signaling motifs in its cytoplasmic domain. Betaglycan, with a somewhat lower binding affinity for TGF-ß isoforms and a greater abundance than the signaling receptors TßRI and TßRII, captures processed TGF-ß for presentation to the signaling receptors. When bound to TGF-ß1, betaglycan forms a complex with TßRII (5 , 18) . Stable expression of TßRIII under a tetracycline-repressible promoter led to increased TGF-ß1 binding to TßRI and TßRII that was reversible with tetracycline treatment, which formally proved that TßRIII is necessary for TGF-ß response in MCF-7 cells (23) . The colon goblet cells described in this study express normal levels of TßRIII protein, but this protein does not undergo normal posttranslational processing. This block in TßRIII modification is a unique and unexpected but efficient method of modulating TGF-ß response. Because normal goblet cells exhibit a resistance to growth inhibition by TGF-ß1 in vivo similar to the growth resistance of HD6 and HD8 cells in vitro, the mechanism of growth inhibition that we have described for the two independently cloned colon cell lines is likely to be used in vivo.

Recently, normal non-neoplastic plasma cells were found to be sensitive to TGF-ß-mediated growth arrest and apoptosis, whereas each of 15 plasmacytomas was resistant to TGF-ß, giving the transformed cells a pronounced growth advantage (24) . Plasmacytoma cells were resistant to TGF-ß because they lacked functional TßRs capable of binding 125I-labeled TGF-ß, although the cells expressed TßRI and TßRII (24) , similar to the goblet cells described in the current study. However, in contrast to plasmacytomas, colon goblet cells also express functional TßRI and TßRII on the cell surface.

Differential regulation by TGF-ß1 of intestinal goblet cells and absorptive enterocytic cells within the same crypt may also allow alterations in the fraction of cells necessary to respond to different stresses. Stresses in the colon such as that observed in inflammatory bowel disease are known to inhibit goblet cell maturation, leading to the production of less mucous. Other conditions in which the ratio of mature goblet cells:absorptive epithelial cells is decreased include microscopic colitis, lymphocytic colitis, radiation colitis (also called radiation enteritis), and the presence of inflammatory fibroid polyps.

Aberrant glycosylation of TßRIII may be a likely mechanism for TGF-ß resistance and malignant progression in human colon cancer. Most colon cancer cells do not respond to TGF-ß by growth inhibition (25) . However, a gene defect has been identified only in a minority of cases (about 30% with mutations in either smad4, smad2, or TßRII; Refs. 16 and 26 ). We do not yet know the mechanism for loss of TßRIII glycosylation, but down-regulation of N-acetylglucosaminyltransferase V is a likely candidate (data not shown). TGF-ß resistance by any mechanism is likely to have profound consequences for colon carcinogenesis. Although smad3 mutations have not been detected in colorectal cancers (26) , targeted homozygous disruption of smad3 in mice caused metastatic colon cancer (27) .

In this report, we show evidence that the functional TßRI and TßRII on these two goblet cell lines respond to the autocrine TGF-ß1 produced by these cells by maintaining ß1 integrin in a fully glycosylated mature form so that it can heterodimerize with the integrin {alpha}2 chain and form a functional collagen I receptor. This necessity to maintain {alpha}2ß1 integrin receptors to maintain cell adhesion may provide a selection bias for TßRI and TßRII in culture and in vivo where goblet cells intermingle with absorptive epithelial cells within the cell monolayer, forming a colonic crypt. Decreased ß1 integrin expression has been associated with a more malignant and invasive phenotype in several tumor cell models (28) . During cancer progression, the maintenance of functional TßRI and TßRII may allow cancer cells that make TGF-ß1, such as prostate cancer cells (29) and colon cancer cells (30) , to maintain expression of the type IV collagenase matrix metalloproteinase 9 (31) , which has a known role in metastasis. Thus, TGF-ß-resistant but TGF-ß-secreting cancer cells could make the tumor microenvironment favorable for continued growth and invasion.


    Materials and Methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Materials.
125I-labeled TGF-ß1 and [3H]thymidine were obtained from DuPont New England Nuclear, human recombinant TGF-ß1 was obtained from R&D Systems, protein A-Sepharose was obtained from Pharmacia, and polyvinylidene difluoride transfer paper Immobulin-P was obtained from Millipore. Antibodies to TßRI/alk5 and TßRII were purchased from Santa Cruz Biotechnology, antibody to endoglin was obtained from PharMingen, antibody to betaglycan/TßRIII was obtained from R&D Systems, and mouse monoclonal IgG2a clone 70 to p21cip1 and anti-ß1 integrin monoclonal antibody were purchased from Transduction Laboratories. All other reagents were from Sigma.

RT-PCR and Sequencing.
Total RNA was isolated from monolayer cultures with Trizol (Life Technologies, Inc.) according to the manufacturer’s manual. RNA was treated with DNase I (Life Technologies, Inc.; amplification grade), and RT-PCR was performed on a Perkin-Elmer Corp. DNA Thermal Cycler 480 using Promega’s access RT-PCR kit as follows: (a) reverse transcription at 48°C for 45 min; (b) denaturation at 94°C for 2 min and 30 s; and (c) PCR for 30–40 cycles (20 cycles for GAPDH) at 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min. The amplification products were analyzed by ethidium bromide agarose gel electrophoresis. The primer sets for PCR and the size of the expected amplification products, respectively, were as follows: alk-5, GTGCACCCTCTTCAAAAACTG and TCTCCAAACTTCTCCAAATCG, 403 bp; TßRII, TGGAGAAAGAATGACGAGAAC and TAACGCGGTAGCAGTAGAAGA, 313 bp; betaglycan, CCGAACTCAAGATAGCAAGAA and TCAGGAGGAATGGTGTGGACT, 592 bp; alk2, TGGTAGATGGAGTGATGATTC and TTGGTGGTGATGAGCCCTTCG, 499 bp; second set for alk2, ATGGACATTTTCTTTTATTAT and GCATTTTCCCCGTAGCGTTCA, 176 bp; GAPDH (from Clontech), 452bp.

Cell Culture.
The HT29 sublines HD6 and HD8 (which are capable of goblet cell differentiation when placed at permissive conditions) and HD3 and HD4 (which are capable of fluid-transporting enterocyte differentiation when placed at permissive conditions) were maintained in low-glucose DMEM buffered with 25 mM HEPES (Atlanta Biologicals) and containing 7% fetal bovine serum, as described previously (11) . Serum-free insulin/transferrin/selenous acid-supplemented DMEM and DMEM containing 0.2% fetal bovine serum were used for the TGF-ß1 and TGF-{alpha} growth experiments, respectively, as described previously (11) .

Immunoprecipitation of TßRIII.
Cell lysates (500 µg) were incubated overnight at 4°C with 2 µg of anti-TßRIII antibody and 40 µl of protein G plus-agarose (Santa Cruz Biotechnology), pelleted at 2500 rpm, and washed three times with lysis buffer. After the final wash, the pellet was mixed with 50 µl of SDS sample buffer and boiled in a water bath for 5 min. Aliquots were analyzed by SDS-PAGE, and TßRIII was detected by Western blotting using anti-TßRIII antibody, horseradish peroxidase-rabbit antigoat IgG (Zymed), and enhanced chemiluminescence.

Inducible Expression of DN TßRII.
DN TßRIIK277R in pMEP4 tagged with the Lerner epitope of influenza hemagglutinin was obtained from J. Massague (4) . High levels of TßRII were expressed after an induction with 50 µM ZnCl2 in HD6 goblet cells and as a control in TGF-ß1-responsive HD3 cells by transfection with either the wild-type TßRII expression plasmid or the empty episomal vector pMEP4 as a control. The plasmid contains the EBV replication origin and the EBNA-1 nuclear antigen to allow extrachromosomal replication in eukaryotic cells.

Immunodetection.
Cells grown in complete media were lysed in buffer containing 25 mM Tris (pH 7.4), 1% Triton X-100, 20 µg/ml leupeptin, 20 µg/ml aprotinin, 0.5 mM phenylmethylsulfonyl fluoride, 200 µM sodium orthovanadate, and 20 mM sodium fluoride. Depending on the experiment, 30–70 µg of cell lysate proteins were blotted onto polyvinylidene difluoride membranes after separation on SDS-PAGE. The blots were blocked in TBST blocking buffer [TBS containing 0.05% Tween 20] and 3% nonfat dry milk for 1 h at RT. Anti-p21waf1/cip1 (0.5 µg/ml), TßRI (1 µg/ml), TßRII (1 µg/ml), TßRIII (betaglycan; 1 µg/ml), endoglin (1 µg/ml), and ß1 integrin (1:2500 dilution) were used in TBST containing 1% dry milk and then incubated for 2–3 h with the primary antibody, and proteins were subsequently detected by enhanced chemiluminescence (Amersham). For p21cip1 blots, cells were lysed in radioimmunoprecipitation assay buffer, and blocking was performed in 1% dry milk plus 1% BSA.

Tunicamycin Treatment.
Cells were treated with 10 µg/ml tunicamycin for 48 h before lysis in 25 mM Tris buffer containing 1% Triton X-100 and protease/phosphatase inhibitors as described previously.

Cell Surface Biotinylation and Western Blotting of TßRI and TßRII.
Cell surface proteins were biotinylated essentially as described by the vendor (Amersham). Briefly, exponentially growing cells were washed once with cold PBS and once with 40 mM sodium bicarbonate (pH 8.6). Cells were then incubated for 30 min at 4°C in 40 mM bicarbonate buffer containing 30 µl of biotin reagent/ml of buffer. After two washes with cold PBS, cells were lysed in 25 mM Tris buffer containing 1% Triton X-100, 20 µg/ml leupeptin, 20 µg/ml aprotinin, 0.5 mM phenylmethylsulfonyl fluoride, 200 µM sodium orthovanadate, and 20 mM sodium fluoride. Cell lysates (300 µg) were incubated overnight at 4°C with 200 µl of streptavidin coupled to agarose beads (Sigma). The beads were then washed extensively and resuspended in SDS-PAGE sample buffer. TßRI and TßRII were detected by immunoblotting as described previously.

Affinity Labeling of TßRs.
Late log-phase cells were washed twice with PBS and twice with binding buffer [50 mM HEPES buffer (pH 7.4) containing 128 mM NaCl, 5 mM KCl, 1.2 mM CaCl2, and 5 mM MgSO4] and treated with dissociation buffer for 3 min on ice [0.1% acetic acid (pH 2.5) containing 150 mM sodium chloride and 1 mg/ml BSA] to remove bound TGF-ß isoforms. After two more washes with binding buffer, the cells were labeled by cross-linking as described previously (15) with 2 ng/ml 125I-labeled TGF-ß1 (100.4 µCi/µg). Protein (200 µg/lane) was analyzed by 5–8% gradient gel SDS-PAGE, followed by autoradiography for 14 days at -70 with intensifying screens.


    Acknowledgments
 
We acknowledge the expert assistance of Dr. Steve Landas and the histology technicians in the Department of Pathology in the preparation of the sections of Fig. 1Citation .


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by National Cancer Institute Grant RO1 CA75708 (to E. F.) and the Jones/Rohner Endowment Fund (E. F.). Back

2 To whom requests for reprints should be addressed, at State University of New York Health Science Center at Syracuse, Pathology Department, 2305 Weiskotten Hall, 750 East Adams Street, Syracuse, NY 13210. Phone: (315) 464-7148; Fax: (315) 464-8419; E-mail: friedmae{at}vax.cs.hscsyr.edu Back

3 The abbreviations used are: TGF, transforming growth factor; TßR, TGF-ß receptor; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DN, dominant negative. Back

4 S. Bellis and E. Friedman. Steps in integrin ß1-chain glycosylation mediated by TGFß1 signaling through Ras, submitted for publication. Back

Received for publication 9/18/98. Revision received 11/16/98. Accepted for publication 11/17/98.


    References
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Cui W., Akhurst R. TGFß: biochemistry and biology in vitro and in vivo Bondy C. LeRoith D. eds. . Growth Factors and Cytokines in Health and Disease, : 531-542, JAI Press Greenwich, CT 1996.
  2. Lin H., Wang X-F., Ng-Eaton E., Weinberg R., Lodish H. Expression cloning of the TGFß type II receptor, a functional transmembrane serine/threonine kinase. Cell, 68: 775-785, 1992.[Medline]
  3. Franzen P., ten Dijke P., Ichijo H., Yamashita H., Schultz P., Heldin D., Miyazono K. Cloning of a TGFß type I receptor that forms a heterodimeric complex with the TGFß type II receptor. Cell, 75: 681-692, 1993.[Medline]
  4. Wrana J., Attisano L., Wieser R., Ventura F., Massague J. Mechanism of activation of the TGFß receptor. Nature (Lond.), 370: 341-347, 1994.[Medline]
  5. Lopez-Casillas F., Cheifetz S., Doody J., Andres J., Lane W., Massague J. Structure and expression of the membrane proteoglycan betaglycan, a component of the TGFß receptor system. Cell, 67: 785-795, 1991.[Medline]
  6. Lastres P., Letamendia A., Zhang H., Rius C., Almendro N., Raab U., Lopez L., Langa C., Fabra A., Letarte M., Bernabeu C. Endoglin modulates cellular responses to TGFß1. J. Cell Biol., 133: 1109-1121, 1996.[Abstract/Free Full Text]
  7. Wang X.-F., Lin H., Ng-Eaton E., Downward J., Lodish H. Expression cloning and characterization of the TGFß type III receptor. Cell, 67: 797-805, 1991.[Medline]
  8. Ewton D., Spizz G., Olson E., Florini J. Decrease in TGFß binding and action during differentiation in muscle cells. J. Biol. Chem., 263: 4029-4032, 1988.[Abstract/Free Full Text]
  9. Pelton R., Saxena B., Jones M., Moses H., Gold L. Immunohistochemical localization of TGFß1, TGFß2 and TGFß3 in the mouse embryo: expression patterns suggest multiple roles during embryonic development. J. Cell Biol., 115: 1091-1105, 1991.[Abstract/Free Full Text]
  10. Thomas D., Nasim M., Gullick W., Alison M. Immunoreactivity of transforming growth factor {alpha} in the normal adult gastrointestinal tract. Gut, 33: 628-631, 1992.[Abstract/Free Full Text]
  11. Hafez M., Infante D., Winawer S., Friedman E., Yan Z., Hsu S., Winawer S., Friedman E. Transforming growth factor ß1 acts as an autocrine negative growth regulator in colon enterocytic differentiation but not in goblet cell maturation. Cell Growth Differ, 1: 617-626, 1990.[Abstract]
  12. Hafez M., Hsu S., Yan Z., Winawer S., Friedman E. Two roles for transforming growth factor ß1 in colon enterocytic differentiation. Cell Growth Differ., 3: 753-762, 1992.[Abstract]
  13. Barnard J. A., Beauchamp R. D., Coffey R. J., Moses H. L. Regulation of intestinal epithelial cell growth by TGFß. Proc. Natl. Acad. Sci. USA, 86: 1578-1582, 1989.[Abstract/Free Full Text]
  14. Migdalska A., Molineux G., Demuynck H., Evans G., Ruscetti F., Dexter T. Growth inhibitory effects of TGFß1 in vivo. Growth Factors, 4: 239-245, 1991.[Medline]
  15. Yan Z., Hsu S., Winawer S., Friedman E. TGFß1 inhibits retinoblastoma gene expression but not pRB phosphorylation in TGFß1-growth-stimulated colon carcinoma cells. Oncogene, 7: 801-805, 1992.[Medline]
  16. Markowitz S., Wang J., Myeroff L., Parsons R., Sun L., Lutterbaugh J., Fan R., Zborowska E., Kinzler K., Vogelstein B., Brattain M., Willson J. Inactivation of the type II TGFß receptor in colon cancer cells with microsatellite instability. Science (Washington DC), 268: 1336-1338, 1995.[Abstract/Free Full Text]
  17. Knaus P., Lindemann D., Decoteau J., Perlman R., Yankelev H., Hille M., Kadin M., Lodish H. A dominant inhibitory mutant of the type II TGFß receptor in the malignant progression of a cutaneous T-cell lymphoma. Mol. Cell. Biol., 16: 3480-3489, 1996.[Abstract]
  18. Lopez-Casillas F., Wrana J., Massague J. Betaglycan presents ligand to the TGFß signaling receptor. Cell, 73: 1435-1444, 1993.[Medline]
  19. Datto M., Li Y., Panus J., Howe D., Xiong Y., Wang X. TGFß induces the cdk inhibitor p21 through a p53-independent mechanism. Proc. Natl. Acad. Sci. USA, 92: 5545-5549, 1995.[Abstract/Free Full Text]
  20. Hsu S., Huang F., Hafez M., Winawer S., Friedman E. Colon carcinoma cells switch their response to transforming growth factor ß1 with tumor progression. Cell Growth Differ., 5: 267-275, 1994.[Abstract]
  21. Heino J., Ignotz R., Hemler M., Crouse C., Massague J. Regulation of cell adhesion receptors by TGFß. J. Biol. Chem., 264: 380-388, 1989.[Abstract/Free Full Text]
  22. Yan Z., Chen M., Perucho M., Friedman E. Oncogenic K-ras but not oncogenic H-ras blocks ß1 integrin maturation in colon epithelial cells. J. Biol. Chem., 272: 30928-30937, 1997.[Abstract/Free Full Text]
  23. Chen C., Wang X-F., Sun L. Expression of the TGFß type III receptor restores autocrine TGFß1 activity in human breast cancer MCF-7 cells. J. Biol. Chem., 272: 12862-12867, 1997.[Abstract/Free Full Text]
  24. Amoroso S., Huang N., Roberts A., Potter M., Letterio J. Consistent loss of functional TGFß receptor expression in murine plasmacytomas. Proc. Natl. Acad. Sci. USA, 95: 189-194, 1998.[Abstract/Free Full Text]
  25. Fynan T., Reiss M. Resistance to inhibition of cell growth by transforming growth factor-ß and its role in oncogenesis. Crit. Rev. Oncog., 4: 493-540, 1993.[Medline]
  26. Riggins G., Kinzler K., Vogelstein B., Thagalingam S. Frequency of Smad gene mutations in human cancers. Cancer Res., 57: 2578-2580, 1997.[Abstract/Free Full Text]
  27. Zhu Y., Richardson J., Parada L., Graff J. Smad3 mutant mice develop metastatic colorectal cancer. Cell, 94: 703-714, 1998.[Medline]
  28. Keely P., Parise L., Juliano R. Integrins and GTPases in tumour cell growth, motility and invasion. Trends Cell Biol., 8: 101-106, 1998.[Medline]
  29. Truong L., Kadmon D., McCune B., Flanders K., Scardino P., Thompson T. Association of TGFß1 with prostate cancer. Hum. Pathol, 24: 4-9, 1993.[Medline]
  30. Friedman E., Gold L., Klimstra D., Zeng Z., Winawer S., Cohen A. High levels of transforming growth factor ß1 correlate with disease progression in human colon cancer. Cancer Epidemiol. Biomark. Prev., 4: 549-554, 1995.[Abstract]
  31. Sehgal I., Baley P., Thompson T. Transforming growth factor ß1 stimulates contrasting responses in metastatic versus primary mouse prostate cancer-derived cell lines in vitro. Cancer Res., 56: 3359-3365, 1996.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
E. C. Finger, R. S. Turley, M. Dong, T. How, T. A. Fields, and G. C. Blobe
T{beta}RIII suppresses non-small cell lung cancer invasiveness and tumorigenicity
Carcinogenesis, March 1, 2008; 29(3): 528 - 535.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
H. J. You, M. W. Bruinsma, T. How, J. H. Ostrander, and G. C. Blobe
The type III TGF- receptor signals through both Smad3 and the p38 MAP kinase pathways to contribute to inhibition of cell proliferation
Carcinogenesis, December 1, 2007; 28(12): 2491 - 2500.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
R. Pakula, A. Melchior, A. Denys, C. Vanpouille, J. Mazurier, and F. Allain
Syndecan-1/CD147 association is essential for cyclophilin B-induced activation of p44/42 mitogen-activated protein kinases and promotion of cell adhesion and chemotaxis
Glycobiology, May 1, 2007; 17(5): 492 - 503.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Deng, S. E. Mercer, S. Shah, D. Z. Ewton, and E. Friedman
The Cyclin-dependent Kinase Inhibitor p27Kip1 Is Stabilized in G0 by Mirk/dyrk1B Kinase
J. Biol. Chem., May 21, 2004; 279(21): 22498 - 22504.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
W. Chen, K. C. Kirkbride, T. How, C. D. Nelson, J. Mo, J. P. Frederick, X.-F. Wang, R. J. Lefkowitz, and G. C. Blobe
{beta}-Arrestin 2 Mediates Endocytosis of Type III TGF-{beta} Receptor and Down-Regulation of Its Signaling
Science, September 5, 2003; 301(5638): 1394 - 1397.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A Wimmel, B Wiedenmann, and S Rosewicz
Autocrine growth inhibition by transforming growth factor {beta}-1 (TGF{beta}-1) in human neuroendocrine tumour cells
Gut, September 1, 2003; 52(9): 1308 - 1316.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
K. L. Stenvers, M. L. Tursky, K. W. Harder, N. Kountouri, S. Amatayakul-Chantler, D. Grail, C. Small, R. A. Weinberg, A. M. Sizeland, and H.-J. Zhu
Heart and Liver Defects and Reduced Transforming Growth Factor {beta}2 Sensitivity in Transforming Growth Factor {beta} Type III Receptor-Deficient Embryos
Mol. Cell. Biol., June 15, 2003; 23(12): 4371 - 4385.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Yan, G.-Y. Kim, X. Deng, and E. Friedman
Transforming Growth Factor beta 1 Induces Proliferation in Colon Carcinoma Cells by Ras-dependent, smad-independent Down-regulation of p21cip1
J. Biol. Chem., March 15, 2002; 277(12): 9870 - 9879.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. C. Blobe, X. Liu, S. J. Fang, T. How, and H. F. Lodish
A Novel Mechanism for Regulating Transforming Growth Factor beta (TGF-beta ) Signaling. FUNCTIONAL MODULATION OF TYPE III TGF-beta RECEPTOR EXPRESSION THROUGH INTERACTION WITH THE PDZ DOMAIN PROTEIN, GIPC
J. Biol. Chem., October 19, 2001; 276(43): 39608 - 39617.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Lee, X. Deng, and E. Friedman
Mirk Protein Kinase Is a Mitogen-activated Protein Kinase Substrate That Mediates Survival of Colon Cancer Cells
Cancer Res., July 1, 2000; 60(13): 3631 - 3637.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
A.-E. Biemer-Hüttmann, M. D. Walsh, M. A. McGuckin, L. A. Simms, J. Young, B. A. Leggett, and J. R. Jass
Mucin Core Protein Expression in Colorectal Cancers with High Levels of Microsatellite Instability Indicates a Novel Pathway of Morphogenesis
Clin. Cancer Res., May 1, 2000; 6(5): 1909 - 1916.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Z. Yan, X. Deng, and E. Friedman
Oncogenic Ki-ras Confers a More Aggressive Colon Cancer Phenotype through Modification of Transforming Growth Factor-beta Receptor III
J. Biol. Chem., January 5, 2001; 276(2): 1555 - 1563.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. De Crescenzo, S. Grothe, J. Zwaagstra, M. Tsang, and M. D. O'Connor-McCourt
Real-time Monitoring of the Interactions of Transforming Growth Factor-beta (TGF-beta ) Isoforms with Latency-associated Protein and the Ectodomains of the TGF-beta Type II and III Receptors Reveals Different Kinetic Models and Stoichiometries of Binding
J. Biol. Chem., August 3, 2001; 276(32): 29632 - 29643.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. C. Blobe, W. P. Schiemann, M.-C. Pepin, M. Beauchemin, A. Moustakas, H. F. Lodish, and M. D. O'Connor-McCourt
Functional Roles for the Cytoplasmic Domain of the Type III Transforming Growth Factor beta Receptor in Regulating Transforming Growth Factor beta Signaling
J. Biol. Chem., June 29, 2001; 276(27): 24627 - 24637.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, X.
Right arrow Articles by Friedman, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, X.
Right arrow Articles by Friedman, E.


<