Cell Growth & Differentiation, Vol 4, Issue 4 269-279, Copyright © 1993 by American Association of Cancer Research

ARTICLES

Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor

GE Muscat, R Griggs, M Downes and J Emery
University of Queensland, Centre for Molecular Biology and Biotechnology, Ritchie Research Laboratories, St. Lucia, Australia.

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner. The alpha-actin TRE bound TR alpha dimers cooperatively. Mutagenesis of the alpha-actin TRE indicated that the core binding motifs and the gap sequences were the most important for efficient binding to TR alpha. The retinoid X receptor alpha (RXR alpha) interacted with the alpha-actin TRE in a sequence specific fashion and formed heterodimeric complexes with TR alpha on the alpha-actin TRE. However, increased levels of RXR alpha decreased the binding of TR alpha to the alpha-actin TRE, in contrast to promoting TR alpha binding to the alpha-myosin heavy chain TRE. Furthermore, the alpha-actin, palindromic, synthetic direct repeat, alpha-myosin heavy chain, and growth hormone TREs interacted with an identical nuclear factor in vitro in muscle cells. In conclusion, our data suggest that the human skeletal alpha-actin TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

This article has been cited by other articles:

				M. H. Hong, H. Sun, C. H. Jin, M. Chapman, J. Hu, W. Chang, K. Burnett, J. Rosen, A. Negro-Vilar, and J. N. Miner Cell-Specific Activation of the Human Skeletal {alpha}-Actin by Androgens Endocrinology, March 1, 2008; 149(3): 1103 - 1112. [Abstract] [Full Text] [PDF]

				S. Lee and M. L. Privalsky Heterodimers of Retinoic Acid Receptors and Thyroid Hormone Receptors Display Unique Combinatorial Regulatory Properties Mol. Endocrinol., April 1, 2005; 19(4): 863 - 878. [Abstract] [Full Text] [PDF]

				B. J. Mengeling, F. Pan, and M. L. Privalsky Novel Mode of Deoxyribonucleic Acid Recognition by Thyroid Hormone Receptors: Thyroid Hormone Receptor {beta}-Isoforms Can Bind as Trimers to Natural Response Elements Comprised of Reiterated Half-Sites Mol. Endocrinol., January 1, 2005; 19(1): 35 - 51. [Abstract] [Full Text] [PDF]

				Z. Jia, M. D. Person, J. Dong, J. Shen, S. C. Hensley, J. L. Stevens, T. J. Monks, and S. S. Lau Grp78 is essential for 11-deoxy-16,16-dimethyl PGE2-mediated cytoprotection in renal epithelial cells Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1113 - F1122. [Abstract] [Full Text] [PDF]

				C. E. Wright, F. Haddad, A. X. Qin, P. W. Bodell, and K. M. Baldwin In vivo regulation of beta -MHC gene in rodent heart: role of T3 and evidence for an upstream enhancer Am J Physiol Cell Physiol, April 1, 1999; 276(4): C883 - C891. [Abstract] [Full Text] [PDF]

				L. J. Burke, M. Downes, V. Laudet, and G. E. O. Muscat Identification and Characterization of a Novel Corepressor Interaction Region in RVR and Rev-erbA{alpha} Mol. Endocrinol., February 1, 1998; 12(2): 248 - 262. [Abstract] [Full Text]

				J. E. Anderson, L. M. McIntosh, and Z. Yablonka-Reuveni Levels of MyoD Protein Expression Following Injury of mdx and Normal Limb Muscle Are Modified by Thyroid Hormone J. Histochem. Cytochem., January 1, 1998; 46(1): 59 - 68. [Abstract] [Full Text]

				T. Collins, J. E. Joya, R. M. Arkell, V. Ferguson, and E. C. Hardeman Reappearance of the minor alpha -sarcomeric actins in postnatal muscle Am J Physiol Cell Physiol, December 1, 1997; 273(6): C1801 - C1810. [Abstract] [Full Text] [PDF]