CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muscat, G. E.
Right arrow Articles by Emery, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muscat, G. E.
Right arrow Articles by Emery, J.

Cell Growth & Differentiation, Vol 4, Issue 4 269-279, Copyright © 1993 by American Association of Cancer Research


ARTICLES

Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor

GE Muscat, R Griggs, M Downes and J Emery
University of Queensland, Centre for Molecular Biology and Biotechnology, Ritchie Research Laboratories, St. Lucia, Australia.

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner. The alpha-actin TRE bound TR alpha dimers cooperatively. Mutagenesis of the alpha-actin TRE indicated that the core binding motifs and the gap sequences were the most important for efficient binding to TR alpha. The retinoid X receptor alpha (RXR alpha) interacted with the alpha-actin TRE in a sequence specific fashion and formed heterodimeric complexes with TR alpha on the alpha-actin TRE. However, increased levels of RXR alpha decreased the binding of TR alpha to the alpha-actin TRE, in contrast to promoting TR alpha binding to the alpha-myosin heavy chain TRE. Furthermore, the alpha-actin, palindromic, synthetic direct repeat, alpha-myosin heavy chain, and growth hormone TREs interacted with an identical nuclear factor in vitro in muscle cells. In conclusion, our data suggest that the human skeletal alpha-actin TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)


This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
J. Lado-Abeal, A. Romero, I. Castro-Piedras, A. Rodriguez-Perez, and J. Alvarez-Escudero
Thyroid hormone receptors are down-regulated in skeletal muscle of patients with non-thyroidal illness syndrome secondary to non-septic shock
Eur. J. Endocrinol., November 1, 2010; 163(5): 765 - 773.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Jia, M. D. Person, J. Dong, J. Shen, S. C. Hensley, J. L. Stevens, T. J. Monks, and S. S. Lau
Grp78 is essential for 11-deoxy-16,16-dimethyl PGE2-mediated cytoprotection in renal epithelial cells
Am J Physiol Renal Physiol, November 2, 2004; 287(6): F1113 - F1122.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. E. Wright, F. Haddad, A. X. Qin, P. W. Bodell, and K. M. Baldwin
In vivo regulation of beta -MHC gene in rodent heart: role of T3 and evidence for an upstream enhancer
Am J Physiol Cell Physiol, April 1, 1999; 276(4): C883 - C891.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Collins, J. E. Joya, R. M. Arkell, V. Ferguson, and E. C. Hardeman
Reappearance of the minor alpha -sarcomeric actins in postnatal muscle
Am J Physiol Cell Physiol, December 1, 1997; 273(6): C1801 - C1810.
[Abstract] [Full Text] [PDF]


Home page
J Biol ChemHome page
I. Bendik and M. Pfahl
Similar Ligand-induced Conformational Changes of Thyroid Hormone Receptors Regulate Homo- and Heterodimeric Functions
J. Biol. Chem., February 17, 1995; 270(7): 3107 - 3114.
[Abstract] [Full Text] [PDF]




HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation
Copyright © 1993 by the American Association of Cancer Research.