CG&D
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Downes, M.
Right arrow Articles by Muscat, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Downes, M.
Right arrow Articles by Muscat, G. E.

Cell Growth & Differentiation, Vol 4, Issue 11 901-909, Copyright © 1993 by American Association of Cancer Research


ARTICLES

Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site

M Downes, R Griggs, A Atkins, EN Olson and GE Muscat
Centre for Molecular Biology and Biotechnology, Ritchie Research Laboratories, University of Queensland, St. Lucia, Australia.

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)


This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
K. R. Sultan, B. Henkel, M. Terlou, and H. P. Haagsman
Quantification of hormone-induced atrophy of large myotubes from C2C12 and L6 cells: atrophy-inducible and atrophy-resistant C2C12 myotubes
Am J Physiol Cell Physiol, February 1, 2006; 290(2): C650 - C659.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. J. Burke, M. Downes, V. Laudet, and G. E. O. Muscat
Identification and Characterization of a Novel Corepressor Interaction Region in RVR and Rev-erbA{alpha}
Mol. Endocrinol., February 1, 1998; 12(2): 248 - 262.
[Abstract] [Full Text]


Home page
J. Histochem. Cytochem.Home page
J. E. Anderson, L. M. McIntosh, and Z. Yablonka-Reuveni
Levels of MyoD Protein Expression Following Injury of mdx and Normal Limb Muscle Are Modified by Thyroid Hormone
J. Histochem. Cytochem., January 1, 1998; 46(1): 59 - 68.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
F Aurade, C. Pfarr, C Lindon, A Garcia, M Primig, D Montarras, and C Pinset
The glucocorticoid receptor and AP-1 are involved in a positive regulation of the muscle regulatory gene myf5 in cultured myoblasts
J. Cell Sci., January 11, 1997; 110(22): 2771 - 2779.
[Abstract] [PDF]




HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cell Growth & Differentiation
Copyright © 1993 by the American Association of Cancer Research.